posted
Yuehai Ke, Bing Su, Xiufeng Song, Daru Lu, Lifeng Chen, Hongyu Li, Chunjian Qi, Sangkot Marzuki, Ranjan Deka, Peter Underhill, Chunjie Xiao, Mark Shriver, Jeff Lell, Douglas Wallace, R Spencer Wells, Mark Seielstad, Peter Oefner, Dingliang Zhu, Jianzhong Jin, Wei Huang, Ranajit Chakraborty, Zhu Chen, Li Jin, African Origin of Modern Humans in East Asia: A Tale of 12,000 Y Chromosomes, Science, 292:5519, pp. 1151-1153, Issue of 11 May 2001.
Yuehai Ke,1* Bing Su,2, 1, 3* Xiufeng Song,1 Daru Lu,1 Lifeng Chen,1 Hongyu Li,1 Chunjian Qi,1 Sangkot Marzuki,4 Ranjan Deka,5 Peter Underhill,6 Chunjie Xiao,7 Mark Shriver,8 Jeff Lell,9 Douglas Wallace,9 R Spencer Wells,10 Mark Seielstad,11 Peter Oefner,6 Dingliang Zhu,12 Jianzhong Jin,1 Wei Huang,12, 13 Ranajit Chakraborty,3 Zhu Chen,12, 13 Li Jin1, 3, 13
To test the hypotheses of modern human origin in East Asia, we sampled 12,127 male individuals from 163 populations and typed for three Y chromosome biallelic markers (YAP, M89, and M130). All the individuals carried a mutation at one of the three sites. These three mutations (YAP+, M89T, and M130T) coalesce to another mutation (M168T), which originated in Africa about 35,000 to 89,000 years ago. Therefore, the data do not support even a minimal in situ hominid contribution in the origin of anatomically modern humans in East Asia.
1 State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Sciences, Fudan University, 220 Handan Road, Shanghai, China 200443, and Morgan-Tan International Center for Life Sciences, Shanghai, China. 2 Kunming Institute of Zoology, the Chinese Academy of Sciences, Kunming, China. 3 Human Genetics Center, University of Texas-Houston, 1200 Herman Pressler E547, Houston, TX 77030, USA. 4 Eijkman Institute for Molecular Biology, Jakarta, Indonesia. 5 Department of Environmental Health, University of Cincinnati, Cincinnati, OH 45267, USA. 6 Department of Genetics, Stanford University, Stanford, CA 94305, USA. 7 Department of Biology, Yunnan University, Kunming, China. 8 Department of Anthropology, Pennsylvania State University, University Park, PA 16802, USA. 9 Center for Molecular Medicine, Emory University School of Medicine, Atlanta, GA 30322, USA. 10 Wellcome Trust Center for Human Genetics, University of Oxford, UK. 11 Program for Population Genetics, Harvard School of Public Health, Boston, MA 02115, USA. 12 Shanghai Second Medical University, Shanghai, China. 13 National Human Genome Center at Shanghai, China. * These authors contributed equally to this work.
To whom correspondence should be addressed. E-mail: ljin@fudan.edu or ljin@sph.uth.tmc.edu
The "Out-of-Africa" hypothesis suggests that anatomically modern humans originated in Africa about 100,000 years ago and then spread outward and completely replaced local archaic populations outside Africa (1, 2). This proposition has been supported by genetic evidence and archaeological findings (3-9). The replacement in Europe was supported by recent ancient DNA analyses, which ruled out the contribution of Neanderthals to modern Europeans (10, 11). However, it has been argued that the abundant hominid fossils found in China and other regions in East Asia (e.g., Peking man and Java man) demonstrate continuity, not only in morphological characters but also in spatial and temporal distributions (12-16). In this report, we test the competing hypotheses of modern Asian human origins using Y chromosome polymorphisms. We sampled 12,127 male individuals from 163 populations across Southeast Asia, Oceania, East Asia, Siberia, and Central Asia and typed for three Y chromosome biallelic markers (YAP, M89, and M130) (17, 18) (Table 1). Being a single-locus multiple-site (i.e., haplotype) system, the Y chromosome is one of the most powerful molecular tools for tracing human evolutionary history (5, 9, 19-21). In previous Y chromosome studies, an extreme geographic structure was revealed in global populations in which the oldest clade represents Africans and the younger ones represent some Africans and all non-African populations (21). One Y chromosome polymorphism (C to T mutation) at the M168 locus is shared by all non-African populations and was originally derived from Africa on the basis of a study of 1062 globally representative male individuals (21). The age of M168 was estimated at 44,000 years (95% confidence interval: 35,000 to 89,000 years), marking the recent Out-of-Africa migrations (21). Under the M168T lineage, there are three major derived sublineages defined by polymorphisms at loci YAP (Alu insertion) (5), M89 (C to T mutation), and M130 (C to T mutation, also called RPS4Y) (Fig. 1) (21, 22). Therefore, these three markers can be used to test the completeness of the replacement of modern humans of African origin in East Asia. An observation of a male individual not carrying one of the three polymorphisms would be indicative of a potential ancient origin and could possibly lead to the rejection of such completeness.
Each of the 12,127 samples typed carried one of the three polymorphisms (YAP+, M89T, or M130T) (Table 1). In other words, they all fall into the lineage of M168T that was originally derived from Africa. Hence, no ancient non-African Y chromosome was found in the extant East Asian populations (P = 5.4 × 106 assuming a frequency of 1/1000 of local contribution in the extant populations), suggesting an absence of either an independent origin or a 1,000,000-year shared global evolution. This result indicates that modern humans of African origin completely replaced earlier populations in East Asia.
It was argued that the extensive genetic data supporting the Out-of-Africa hypothesis could also be explained by the multiregional hypothesis under a version of the trellis model (23). This model suggests that a multiregional evolutionary paradigm is shared across the human range by frequent gene exchanges between continental populations since Homo erectus came out of Africa about 1 million years ago (23). It is difficult to test the trellis model with markers from mitochondrial hypervariable region (D-loop) and autosome because these markers show frequent recurrent mutations and/or recombination (24, 25), respectively. However, this can be circumvented by the application of a large number of Y chromosome biallelic markers, which escape recombination and have a low mutation rate. It has been shown that all the Y chromosome haplotypes found outside Africa are younger than 35,000 to 89,000 years and derived from Africa (21), although this estimation is crude and depends on several assumptions. In addition, if extensive gene flow had occurred between continental populations during the past 1 million years but before the divergence between Africans and non-Africans, as suggested by the multiregionalists, the ancient Y chromosome haplotypes seen in African populations or even much older haplotypes would have been expected in East Asia, which was not observed in our data. However, this observation does not necessarily preclude the possibility of selection sweep that could erase archaic Y chromosomes of modern humans in East Asia. On the other hand, a minor contribution from a female lineage of local origin cannot be excluded either, which should be further studied with the use of mitochondrial DNA (mtDNA) markers. Because the Y chromosome has a relatively small effective population size, it is subject to stochastic process, e.g., genetic drift, which could also lead to extinction of archaic lineages. However, in our study, with 163 populations from different regions of Asia, it is hard to imagine that all of the 163 populations should drift in the same direction.
Inconsistency of age estimations for a common ancestor with the use of mitochondrial/Y chromosome and autosome/X chromosome markers, however, creates confusion. The age estimated with the use of autosome/X chromosome genes ranges from 535,000 to 1,860,000 years (26-29), much older than those for mtDNA and Y chromosome. However, this difference in age estimation might only reflect the difference in the effective population sizes between Y chromosome/mtDNA and X chromosome/autosome (three to four times as many as the former) in the presence of bottleneck events associated with the outbound migrations from Africa, therefore disqualifying the utility of the latter in distinguishing the competing hypotheses (24, 30).
REFERENCES AND NOTES 1. R. L. Cann, M. Stoneking, A. C. Wilson, Nature 325, 31 (1987) [Medline]. 2. L. Vigilant, M. Stoneking, H. Harpending, K. Hawkes, A. C. Wilson, Science 253, 1503 (1991) [Medline]. 3. C. B. Stringer and P. Andrew, Science 239, 1263 (1988) [Medline]. 4. A. M. Bowcock, et al., Nature 368, 455 (1994) [Medline]. 5. M. F. Hammer, Nature 378, 376 (1995) [Medline]. 6. S. A. Tishkoff, et al., Science 271, 1380 (1996) . 7. J. Y. Chu, et al., Proc. Natl. Acad. Sci. U.S.A. 95, 11763 (1998) [Abstract/Full Text]. 8. L. Quintana-Murci, et al., Nature Genet. 23, 437 (1999) [Medline]. 9. B. Su, et al., Am. J. Hum. Genet. 65, 1718 (1999) [Medline]. 10. M. Krings, et al., Cell 90, 19 (1997) [Medline]. 11. V. O. Igor, et al., Nature 404, 490 (2000) [Medline]. 12. A. S. Brooks and B. Wood, Nature 344, 288 (1990) [Medline]. 13. T. Li and D. A. Etler, Nature 357, 404 (1992) [Medline]. 14. X. Z. Wu, F. E. Poirier, Human Evolution in China (Oxford Univ. Press, Oxford, 1995). 15. D. A. Etler, Annu. Rev. Anthropol. 25, 275 (1996) . 16. C. C. Swisher, et al., Science 274, 1870 (1996) [Abstract/Full Text]. 17. A total of 163 populations were sampled from Central Asia (Crimean Tatar, Iranian, Dungan, Tajik, Turkmen, Karakalpak, Eastern Uzbek, Sinte Romani, Khorezmian Uzbek, Uighur, Kazak, Bukharan Arab, and Kyrgyz); Central Siberia (Tuvan, Tofalar, Yenisey Evenk, Buryat-1, and Buryat-2); Okhotsk/Amur (Okhotsk Evenk, Ulchi/Nanai, Upriver Negidal, Downriver Negidal, Udegey, and Nivkh); Kamchatka/Chukotka (Koryak, Itelman, Chukchi, and Siberian Eskimo); northern East Asia (Ewenki, Manchurian-1, Manchurian-2, Korean, Japanese, Hui-1, Hui-2, Jingpo, Tu, Sala, Mongolian-1, Mongolian-2, Tibetan-Qinghai, Tibetan-Tibet, Tibetan-Yunnan, Kazak-Xinjiang, and Uyghur); northern Han Chinese (Heilongjiang, Liaoning, Hebei, Beijing, Tianjin, Shandong, Shanxi, Gansu, Xinjiang, Henan, Inner-Mongolia, Qinghai, Shaanxi, and Jilin); southern Han Chinese (Anhui, Zhejiang, Jiangsu, Shanghai, Hubei, Sichuan, Jiangxi, Hunan, Fujian, Yunnan, Guangxi, Guangdong, and Guizhou); Taiwan (Bunun, Atayal, Yami, Paiwan, and Ami); Southeast Asia (Tujia, Yao-Nandan, Yao-Jinxiu, Zhuang, Dong, Wa-1, Wa-2, Wa-3, Aini, Blang-1, Blang-2, Lahu-1, Lahu-2, Lahu-3, Lahu-4, Deang, Yi, She, Li, Cambodian, Dai-1, Dai-2, Akha, Karen, Lisu, Jino, Hmong, Yao, Kinh, Muong, Naxi, Ahom, So, Northern Thailand, Northeast Thailand, Bai-1, and Bai-2); Indonesia/Malaysia [Malay CB, Malay KM, Orang Asli, Batak, Malay (Pakanbaru), Minangkabau, Palembang, Bangka, Nias, Dayak, Java, Tengger, Bali, Sasak, Sumbawa, Sumba, Alor, Makassar, Bugis, Torajan, Kaili, Manado, Irian, Kota Kinabalu, and Sakai]; Polynesia/Micronesia (Truk, Guam, Palau, Majuro, Kribati, Pohnpei, Nauru, Kapingamarangi, Tonga, American Somoan, and West Somoan); Papuan and New Guinean Highland (Australian Aborigine, Nasioi-Melanesian, New Guinean-1, New Guinean-2, Bankes and Torres, Santo, and Maewo); and Northeastern India [Adi, Nishi, Assam, Apatani, Rabha(Assam), and Naga]. The numbered populations of the same ethnicity were sampled independently. 18. Genotyping was conducted by a polymerase chain reaction restriction fragment length polymorphism assay. The restriction sites were engineered for M130 (Bsl I) and M89 (Nla III) by designing mismatch primers. The primer sequences are ACAGAAGGATGCTGCTCAGCTT/GCAACTCAGGCAAAGTGAGACAT (M89) and TATCTCCTCTTCTATTGCAG/CCACAAGGGGGAAAAAACAC (M130). The typing of YAP follows previous reports (5, 9). Genotyping was repeated to clarify any equivocal typing results. 19. M. A. Jobling, et al., Trends Genet. 11, 449 (1995) [Medline]. 20. P. A. Underhill, et al., Ann. Hum. Genet. 65, 43 (2001) . 21. P. A. Underhill, et al., Nature Genet. 26, 358 (2000) [Medline]. 22. A. W. Bergen, et al., Ann. Hum. Genet. 63, 63 (1999) [Medline]. 23. M. H. Wolpoff, J. Hawks, R. Caspari, Am. J. Phys. Anthropol. 112, 129 (2000) [Medline]. 24. L. Jin and B. Su, Nature Rev. Genet. 1, 126 (2000) . 25. M. Stoneking, et al., Curr. Opin. Genet. Dev. 6, 731 (1996) [Medline]. 26. R. M. Harding, et al., Am. J. Hum. Genet. 60, 772 (1997) [Medline]. 27. H. Kaessmann, F. Heissig, A. Haeseler, S. Paabo, Nature Genet. 22, 78 (1999) [Medline]. 28. E. Harris and J. Hey, Proc. Natl. Acad. Sci. U.S.A. 96, 3320 (1999) [Abstract/Full Text]. 29. Z. M. Zhao, et al., Proc. Natl. Acad. Sci. U.S.A. 97, 11354 (2000) [Abstract/Full Text]. 30. J. C. Fay and C. I. Wu, Mol. Biol. Evol. 16, 1003 (1999) [Medline]. 31. We thank all the 12,127 men who donated DNA for this study. This study was supported by the China Natural Science Foundation. B.S., R.C., and L.J. were supported by NIH grants. R.D. was supported by the Center for Environmental Genetics at the University of Cincinnati. 20 February 2001; accepted 20 March 2001 10.1126/science.1060011 Include this information when citing this paper.
Related articles in Science:
HUMAN ANTHROPOLOGY: Modern Men Trace Ancestry to African Migrants.
Ann Gibbons Science 2001 292: 1051-1052. (in News Focus) [Summary] [Full Text
-------------------- The nature of homelife is the fate of the nation. Posts: 2334 | Registered: May 2006
| IP: Logged |
posted
Hey Marc - He, he, seems the world is coming around to our way of thinking! What took them so long!
Too bad Clyde isn't posting anymore; before Wells did his genographic project, and before all of these other studies; it was Clyde who was saying that the original civilizations of China and Japan were started by Black people. He should be taking his Kudos.
BTW - I read somewhere (I didn't save it), that the Chinese had Chariots. That would be very interesting, do you know anything about it?
Posts: 22721 | Registered: Oct 2005
| IP: Logged |
posted
Marc - great post, thank you. But I thought that they had stopped Human sacrifice by that late date. The spoked wheels on the chariot indicate an advanced design, but the driver platform looks too small, any idea how it was used?
Posts: 22721 | Registered: Oct 2005
| IP: Logged |
posted
Marc, you need to learn more about the OOA theory, rather than promoting this nonsense of "even the Chinese say they come from Africa" since all humans alive today can trace them selves back to Africa, please do so.
Posts: 6572 | From: N.Y.C....Capital of the World | Registered: Jun 2008
| IP: Logged |
Hi Mike. I don't know for certain how it was used and wouldn't like to guess.
M-over-M. It is not I who is promoting what you call "this nonsense" of Chinese saying they come from Africa. It is the Chinese themselves.
I draw your attention to the authors of the article where the scientists include Peter Underhill and Spencer Wells but the lead scientists are indeed, themselves, Chinese:
Yuehai Ke, Bing Su, Xiufeng Song, Daru Lu, Lifeng Chen, Hongyu Li, Chunjian Qi, Sangkot Marzuki, Ranjan Deka, Peter Underhill, Chunjie Xiao, Mark Shriver, Jeff Lell, Douglas Wallace, R Spencer Wells, Mark Seielstad, Peter Oefner, Dingliang Zhu, Jianzhong Jin, Wei Huang, Ranajit Chakraborty, Zhu Chen, Li Jin, African Origin of Modern Humans in East Asia: A Tale of 12,000 Y Chromosomes, Science, 292:5519, pp. 1151-1153, Issue of 11 May 2001.
. .
-------------------- The nature of homelife is the fate of the nation. Posts: 2334 | Registered: May 2006
| IP: Logged |
M-over-M. It is not I who is promoting what you call "this nonsense" of Chinese saying they come from Africa. It is the Chinese themselves.
Marc, yes, all Asians whether they be Chinese, Japanese, Indian, Melanesian etc... can all trace their roots back to Africa.
This is what I am saying Marc, this notion is not new, and what it is actually saying, well, basically is that all humans alive today come from Africa, this is proven genetically, please I implore you to read more on the OOA theory.
You'll have a better understanding afterwards.
What I call "this nonsense" is your misunderstanding of OOA and your use of said reason from these individuals of China (who also acknowledge the fact that all humans come from Africa) to promote an extra African migration into China after the initial OOA who reached said area.
You have to do much better than that..understand?
Posts: 6572 | From: N.Y.C....Capital of the World | Registered: Jun 2008
| IP: Logged |
posted
MindoverMatter718 - You wrote Quote: to promote an extra African migration into China after the initial OOA who reached said area.
Are you confused, or was that just a typo? No one said anything about an "Extra" migration from Africa into China. We are all talking about the one migration of about 50,000 ya. (which in all likelihood was a series of smaller migrations spread out over many centuries - that many people collectively coming together for one migration would suggest a cohesion and leadership that is not known to have existed).
Posts: 22721 | Registered: Oct 2005
| IP: Logged |
posted
MindoverMatter718 - In giving it a second thought: You can't wrap your mind around the fact that the original Chinese were Black people - can you?
Posts: 22721 | Registered: Oct 2005
| IP: Logged |
"What I call "this nonsense" is your misunderstanding of OOA and your use of said reason from these individuals of China."
In my view, this makes no sense.
The web page Chariots of the Black Shang of China is simple, non-complex and stands on its own feet.
Knowledge about OOA theory or how to raise tomatoes shares with all things that new learning itself is valuable. We all have much to learn.
I have nothing further to say to you about this.
. .
Knowledge of the OOA theory tells us that when humans first reached all these areas around the world they were still tropically adapted, when we look at the genetic evidence this informs us that indeed all people around the world are descended from Africans, so in essence every non African is African under the skin, difference is adaptation to said environment, but they all originally resembled tropical people coming from Africa.
This is what you fail to understand Marc.
Posts: 6572 | From: N.Y.C....Capital of the World | Registered: Jun 2008
| IP: Logged |
quote:Originally posted by Mike111: MindoverMatter718 - You wrote Quote: to promote an extra African migration into China after the initial OOA who reached said area.
Are you confused, or was that just a typo? No one said anything about an "Extra" migration from Africa into China. We are all talking about the one migration of about 50,000 ya. (which in all likelihood was a series of smaller migrations spread out over many centuries - that many people collectively coming together for one migration would suggest a cohesion and leadership that is not known to have existed).
So basically Mike, if there was no extra migration, then these individuals from 50kya that have been in these areas for this amount of time, were/are no longer African, just as Melanesians and Australian aborigines are no longer African.
quote:Originally posted by Mike111: MindoverMatter718 - In giving it a second thought: You can't wrap your mind around the fact that the original Chinese were Black people - can you?
All people around the world were originally black, this is what your simple mind fails to understand.
Posts: 6572 | From: N.Y.C....Capital of the World | Registered: Jun 2008
| IP: Logged |
posted
MindoverMatter718 - Bypassing all the other junk, please explain WHAT "difference is adaptation to said environment" but they all originally resembled tropical people coming from Africa.
You are obviously trying to say that modern people look the way they do, due to LOCAL adaptations, other than the fatty eyelids on Eskimos, I can't think of one. I want one or more examples of said adaptions, Because to me it is all admixture.
Posts: 22721 | Registered: Oct 2005
| IP: Logged |
quote:Originally posted by Mike111: MindoverMatter718 - Bypassing all the other junk, please explain WHAT "difference is adaptation to said environment" but they all originally resembled tropical people coming from Africa.
You are obviously trying to say that modern people look the way they do, due to LOCAL adaptations, other than the fatty eyelids on Eskimos, I can't think of one. I want one or more examples of said adaptions, Because to me it is all admixture.
The many different hues, body builds, i.e, Eskimos are very adapted to the cold and have shorter limbs than those adapted to the tropics.
The admixture you think of Mike is simply that, your thought, because as far as genetics goes there is no proof of this admixture that you speak of.
See Mike oldschool outdated anthropologists used to say Africans only looked a certain way (true "negro") and if there was another variation then it had to come from outside admixture, this is similar to your train of thought, but just like you, they were refuted by genetics.
Posts: 6572 | From: N.Y.C....Capital of the World | Registered: Jun 2008
| IP: Logged |
so in essence every non African is African under the skin, difference is adaptation to said environment, but they all originally resembled tropical people coming from Africa.
And the point you fail to understand is that this isn't a question of everyone being African 'under the skin.' All accept that. New Ooint: they also physically resemble Africans.
Mike said, as you quoted him,
quote:Originally posted by Mike111: MindoverMatter718 - In giving it a second thought: You can't wrap your mind around the fact that the original Chinese were Black people - can you?
and you, M-O-M, replied,
quote:All people around the world were originally black, this is what your simple mind fails to understand.
What Mike and I are saying isn't the above. Everyone knows you and all whites and Asians are black under the skin.
The point is that not only are ancient Chinese African under the skin, they physically look African with full, fleshy, facial features.
AFRICANS BROUGHT THE MOTHER CIVILIZATION TO CHINA WITH THE ER-LI-TUO AND SHANG.
This is the point that should be understood.
. .
-------------------- The nature of homelife is the fate of the nation. Posts: 2334 | Registered: May 2006
| IP: Logged |
so in essence every non African is African under the skin, difference is adaptation to said environment, but they all originally resembled tropical people coming from Africa.
And the point you fail to understand is that this isn't a question of everyone being African 'under the skin.' All accept that. New Ooint: they also physically resemble Africans.
Mike said, as you quoted him,
quote:Originally posted by Mike111: MindoverMatter718 - In giving it a second thought: You can't wrap your mind around the fact that the original Chinese were Black people - can you?
and you, M-O-M, replied,
quote:All people around the world were originally black, this is what your simple mind fails to understand.
What Mike and I are saying isn't the above. Everyone knows you and all whites and Asians are black under the skin.
The point is that not only are ancient Chinese African under the skin, they physically look African with full, fleshy, facial features.
AFRICANS BROUGHT THE MOTHER CIVILIZATION TO CHINA WITH THE ER-LI-TUO AND SHANG.
This is the point that should be understood.
. .
Sorry Marc but there just is no evidence for Africans bringing civilization to China.
Posts: 6572 | From: N.Y.C....Capital of the World | Registered: Jun 2008
| IP: Logged |
posted
MindoverMatter718 - While you are trying to think of some nonsense answer; here is an example of why you are wrong.
This is an American Indian from the COLD Northern Plains of the United States. They originally came from Northern Asia.
This is an American Indian from the HOT HUMID JUNGLES of South America. They also, originally came from Northern Asia.
Except for the fact that the South American may no longer perspire; they are physically identical. Not to put too fine a point on it; but they live in extremely different environments, they have lived in these environments for thousands of years, yet they are still identical. Where is your local adaption in phenotype????
Posts: 22721 | Registered: Oct 2005
| IP: Logged |
quote:Originally posted by Mike111: MindoverMatter718 - While you are trying to think of some nonsense answer; here is an example of why you are wrong.
This is an American Indian from the COLD Northern Plains of the United States. They originally came from Northern Asia.
This is an American Indian from the HOT HUMID JUNGLES of South America. They also, originally came from Northern Asia.
Except for the fact that the South American may no longer perspire; they are physically identical. Not to put too fine a point on it; but they live in extremely different environments, they have lived in these environments for thousands of years, yet they are still identical. Where is your local adaption in phenotype????
They really don't live in extremely different environments and yes they all migrated from Asia, hence resemble Asians.
Posts: 6572 | From: N.Y.C....Capital of the World | Registered: Jun 2008
| IP: Logged |
posted
MindoverMatter718 - Quote: "The many different hues, body builds, i.e, Eskimos are very adapted to the cold and have shorter limbs than those adapted to the tropics."
What does that nonsense mean? Give me an example. The Eskimos have the same body type as the South American Indians above, why didn't they change??
MindoverMatter718 - Quote: "Sorry Marc but there just is no evidence for Africans bringing civilization to China."
"Brought" may be a poor choice of words, at that time (50,000 B.C.) there was NO civilization. But if you doubt that Africans "Created" civilization in China, try to tell me who else was there to do it.
Better yet; knowing just how silly you can get.
At that time, there were ONLY Black Africans in Eastern China, and White Africans (Albinos) in Western Asia. Go ahead and dig a hole for yourself.
Posts: 22721 | Registered: Oct 2005
| IP: Logged |
quote:Originally posted by Mike111: MindoverMatter718 - While you are trying to think of some nonsense answer; here is an example of why you are wrong.
This is an American Indian from the COLD Northern Plains of the United States. They originally came from Northern Asia.
This is an American Indian from the HOT HUMID JUNGLES of South America. They also, originally came from Northern Asia.
Except for the fact that the South American may no longer perspire; they are physically identical. Not to put too fine a point on it; but they live in extremely different environments, they have lived in these environments for thousands of years, yet they are still identical. Where is your local adaption in phenotype????
They really don't live in extremely different environments and yes they all migrated from Asia, hence resemble Asians.
You are just a tad bit silly; the average winter temp. of Fargo, North Dakota is 6.8 degrees.
The average temp. in the Amazon Jungle is probably about 88 F degrees.
In terms of Human habitation, ya I would say that those are extremes.
Posts: 22721 | Registered: Oct 2005
| IP: Logged |
quote:Originally posted by Mike111: MindoverMatter718 - Quote: "The many different hues, body builds, i.e, Eskimos are very adapted to the cold and have shorter limbs than those adapted to the tropics."
What does that nonsense mean? Give me an example. The Eskimos have the same body type as the South American Indians above, why didn't they change??
Actually Mike, more southerly Native Americans are not adapted to the extreme cold as Eskimos are, I thought that would be common sense.
Then again I have to remember I am dealing with you.
quote:Originally posted by Mike111: MindoverMatter718 - Quote: "Sorry Marc but there just is no evidence for Africans bringing civilization to China."
"Brought" may be a poor choice of words, at that time (50,000 B.C.) there was NO civilization. But if you doubt that Africans "Created" civilization in China, try to tell me who else was there to do it.
At the time Chinese civilization arose humans had already been living there for thousands of years, they were no more African than an Australian aborigine Mike.
Ex. Australians start a civilization and since their phenotype resembles Africans, so now to you this civilization would be brought by Africans, and this is now an African civilization?
quote:Originally posted by Mike111: Better yet; knowing just how silly you can get.
At that time, there were ONLY Black Africans in Eastern China, and White Africans (Albinos) in Western Asia. Go ahead and dig a hole for yourself.
There were Africans in China at the beginning of their civilization?
Please post the genetic evidence. Oh yea that's right, you'll just explain it off as the pale Chinese committing mass genocide and killed off all the Native Africans of China, right?
Don't use statues that look "African by phenotype" either, because in all reality this is the same nonsense that Euro-centrists try to do with Egyptian statues saying they look Caucasoid and hence have to be non Africans, do you see how faulty your logic is Mike and Marc?
Anyway, I know talking to you is like talking to a wall, and as many times as people try to save you from your own ignorance you continue to spout it.
In this regard I'll let you be, especially since genetic evidence destroyed your theories already.
Posts: 6572 | From: N.Y.C....Capital of the World | Registered: Jun 2008
| IP: Logged |
posted
MindoverMatter718 - Do you read?? Don't be such a ditz, Marcs second post IS the genetic evidence. Pale Chinese is a current condition due to admixture. see the link below - last post.
quote:Originally posted by Mike111: MindoverMatter718 - Do you read?? Don't be such a ditz, Marcs second post IS the genetic evidence. Pale Chinese is a current condition due to admixture. see the link below - last post.
It's you who needs to pay attention Mike, since all Marc did was post evidence which is actually correlating with OOA, which is that yes Chinese, Melanesians, Europeans, Eskimos etc... can all trace their dna lineages back to Africa.
This is OOA, you dunce.
Posts: 6572 | From: N.Y.C....Capital of the World | Registered: Jun 2008
| IP: Logged |
posted
MindoverMatter718 - Rather then run around in circles with you;
Please explain and give examples to explain the very wide range of phenotypes and skin colors in Asia as local adaptions rather than admixture.
Posts: 22721 | Registered: Oct 2005
| IP: Logged |
posted
Today archaeologists believe that the Erlitou culture is the Xia Dynasty. This is supported by the fact that the historical text place Xia in Henan and southern Shanxi. These Chinese provinces are the main areas where Erlitou artifacts have been discovered. Chinese archaeologists have suggested that the Henan Lungshan culture and the Erlitou I-III periods are representative of the Xia Dynasty. (An 1986)
Xia is considered the first dynasty of the sandai (three Dynasties) of ancient China: Xia, Shang and Zhou. There are many references to the Xia people. The Xia people were recognized as westerners, because they settled the middle Yellow river region of China. As a result they were called the Hua Xia "the middle states people".
There are numerous textual references to Xia. Han Fei Tzu writing in the third century B.C., in his Shih Guo, observed that:
"Yu made the ritual vessels painting the interior black and the exterior in red."
The tradition recorded by Han, of the black-and-red ware for the Xia li min suggest some relationship of Xia to the Yangshao culture which also used BRW and analogous pottery signs.
Chang (1987) believes that the legendary sages and heroes of China, probably lived during the Lungshan culture period. The Lungshan culture had walled cities and evidence of rank and rituals. This clearly illustrates how archaeology can compliment textual history.
The artifacts of Erlitou include BRW, red,black and buff wares. These artifacts were made of stone, shell and bronze. The bronze instruments found by archaeologists at Erlitou sites correspond to the descriptions by Yuan Kang, in the Yueh Zhueh Shu, quoting the philosopher Feng Hu Tzu of the tools made by the Xia. Yuan Kang wrote that:
"In the Age of Yu, weapons were made of bronze, for build -ing canals...and..houses...."
The black-and-red ware (BRW) common to the Fertile African Crescent was also used in China. There is affinity between the BRW from Nubia, and the pottery from Yangshao sites in the Henan and Gansu sites of China.
The textual history of Xia is synthesized in the Chinese book Shih Zhi. This evidence from the Shih Zhi, was used by Hsu Husheng , of the Chinese Institute of Archaeology, to find the xu (ruins) of Xia: the Xia xu. Hsu Husheng using this source hypothesized that the center for traditional Xia Dynasty towns was the Loyang plains and the Dengfeng river valley. This coincides with the Erlitou sites of this area which date to 2100- 1800 B.C.
The Xia people were recognized as being different people from the mongoloid Chinese they politically dominate China today as a people that came from the west (i.e., Iran), before they settled the middle Yellow river. A Zhou saying observed that :
"The rituals [or rules of] the Three Dynasties [sandai] are one".
The early Xia lived on mounds, in houses made of grass and mud. Pounded earth walls surrounded Xia villages to protect the li mim from attack. The Xia probably spoke a Manding language. This view is supported by the earlier discussion of the analogy between ancient Chinese and Manding.
The major clan totem of the Xia as mentioned earlier was the dragon. The zu (clan) or tsu was the basic point of social organization for the li min.
In China the dragon was regarded as the deified serpent. (Andersson 1973, p.7) It also denoted the symbol of perfect man, the son of Heaven, the Emperor.
The clan emblem for the ancient Manding was the first lizard/dragon. A dragon is nothing more than a giant lizard. This dragon motif was also found in Iran and Babylonian Assyrian civilization and the Anau civilization in Russia, which had similar painted pottery to the pottery styles of Henan (Xia). (Winters 1983c)
The Xia li min built their settlements near rivers, lakes and streams. They are mentioned in the Oracle bone writing. The sacred tree of the Xia was the pine. The Xia naming system was the same as that used by the Shang.
The founder of the Xia Dynasty was Yu. His father was Gun. Myths about Gun are found throughout southwest Shanxi. Yu's son founded the Pa culture. The Pa culture was a megalithic culture. Great Yu was the regulator of the waters and builder of canals. He invented wetfield agriculture.
Yu was born in Shihnew. His mother was Sewege (Seuge). She is alleged to have become pregnant and swallowed a spirit's pearl.
Under the orders of Emperor Shun, Yu was to dredge the Yellow river. Yu traveled the empire for 10 years draining the land of water. One tradition claims that "but for Yu we should all have been fishes".
Beginning with Xia the fundamental political unit of this dynasty and succeeding dynasties of China was the yi or walled town. These yi were organized into small and large guo (states). Each guo, was known as a shih.
The administrator of the guo was a member of an agnati clan or xing. The xing, ruled over members of their own clan and non- related clans living in the various yi, forming the guo.
Emperor Shun, appears to have given Egeu, his son, the princi -pality of Shang, and Yu the principality of Xia. After the death of Shun, Yu became the leader of the confederation of Seihshin: the large guos of Xia and Shang. According to Gu Tsu Yu, in the Du Shih fang yu Zihiyao, written in the 1600's:
"It is traditionally stated that when Yu assembled the lords at Dushan there were ten thousand states [cities] that came carrying jades and silks".
The second great leader of the Xia Dynasty was Qi, the son of Di (Emperor) Yu. According to the Guben zhu Shu Zhi Nien, the Xia dynasty had seventeen kings and lasted 471 years.
The Xia Dynasty remained strong until the tyrant , Zhieh, came to power. In 1766 B.C., Zhieh was deposed and exiled by Zheng Dang, ruler of Shang.
There are thirty references to the capital of Xia in the Zo Zhuan, Guo Yu , and Guben zhu Shu Zhi Nien. Loyang plain in central Henan, especially the region of Dengfeng and Yuxien in the upper Ying river valley, and the area near the Fenhe river valley in southwestern Shanxi south of mount Ho are usually mentioned in these sources as the area where the Xia capital was established.
The first capital of Xia was Yangcheng. This city was in southwestern Shanxi. Archaeologist believe that Taosi and Wangchenggang may be Xia cities.
Taosi dates to 2500 to 1900 B.C. Here the people raised oxen, pigs and sheep. They grew millet. Their homes were built half-way below ground. They smelted copper . The coiled dragon motif is common at this site along with crocodile skin drums.
The Taosi site is important because the artifacts excavated from the more than 1,000 tombs, indicate that a hereditary system of chiefs and class was already established.
The dragon motif at Taos may have been the totem of the Xia dynasts at Taosi. This would correspond to Chinese legends of the Long (Dragon) ethnic group.Huan Long (Dragon Breeding Clan) and Yu Long (Defend the Dragon) clan. The dragon legends are associated with the Chinese sages Yan, Yao, Shun and Yu.
The capital of Xia Yangcheng is believed to be the city of Wangshenggang. As mentioned earlier the yi, or 'walled city', was the basic political unit of Xia. These walls were built layer upon layer and called hangtu. Chinese traditions allege that Yu's father, Gun, built the first hangtu.
Wangshenggang site is 10,000 sq. meters . It is situated near the Wudu river. This structure contains skeletons of all ages.
-------------------- C. A. Winters Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
It was from Central China’s Shaanxi, Chang’an province of the West Han Kingdom (206BC -25.AD). But already Shang / Xia traditions (Shang being called in National Geographic as the Mother Civilization of China) had been and were being passed on seen in the Han and still today. This further evidence blacks gave China a splendid civilization that any open-minded person can acknowledge.
Thank you for the extensive background above.
Marc
. .
. .
-------------------- The nature of homelife is the fate of the nation. Posts: 2334 | Registered: May 2006
| IP: Logged |
Phenotypic variation between human populations in skin pigmentation correlates with latitude at the continental level, in that populations who adapted to more northern latitudes are more lighter in complexion while those of more southerly areas are darker, this is plain logical common sense, anyone can see this.....
The reason we also know this fact is because genetically it has been shown that all non Africans descend from Africans migrating OOA (as explained in the links above), there is no way for you to disprove this genetic fact, if you could've you would've.
Not even the top dissenting scientists who support a multi-regional origin can refute this.
All genetic lineages around the world can be TRACED BACK TO AFRICA , nowhere else!
....and that all non Africans originally resembled tropical Africans before locally adapting to whatever habitat they were in is proven by the fact that modern local inhabitants of said areas still carry genetic lineages found from ancient skeletal remains to this day.
No Neanderthal admixture and no recent post OOA African admxiture.
So where is the admixture Mike? Where is your evidence to prove this admixture?
Btw there isn't much variety in Asia, and this is due to numerous population bottlenecks in which it decreased the population size and in turn the diversity, genetically and phenotypically.
This actually goes for all non Africans as one gets farther from Africa the diversity genetically and phenotypically is decreased.
^^ Topic: Distance from Africa, not climate, explains within-population phenotypic diversity
Posts: 6572 | From: N.Y.C....Capital of the World | Registered: Jun 2008
| IP: Logged |
posted
MindoverMatter718 - No one argues that all Humans originated in Africa. The issue is why do different sub-species (specifically Caucasians and Mongols) look different than the original Human - the African.
I say it is because of admixture between different African phenotypes and African Albinos. And I showed examples to prove my point.
You say quote: "The reason has already been explained and this is because of local adaptation."
But you present no data or opinion or picture to support your claim. Those links that you posted don't say what you say. They only concur in the OOA, so what?
Posts: 22721 | Registered: Oct 2005
| IP: Logged |