posted
st updated at: (Beijing Time) Wednesday, December 18, 2002 East-West Exchanges Began 5,000 Years Ago: Experts Contact between the East and West probably began more than 5,000 years ago, 3,000 years earlier than previously thought, according to Chinese archaeologists.
Contact between the East and West probably began more than 5,000 years ago, 3,000 years earlier than previously thought, according to Chinese archaeologists.
New research on relics unearthed along the famous Silk Road, an ancient commercial route linking China and Central Asia, has lead to the conclusion.
Li Shuicheng, a professor of archaeology at Beijing University, said that many people held that East-West exchanges started after the opening of the Silk Road over 2,000 years ago, but archaeological discoveries showed the date was much earlier.
Li said that a dozen mace heads dating back between 3,000 and 5,000 years, extremely similar to those used by kings of ancient Egypt, had been excavated in northwest China.
The oldest of the mace heads found in Gansu, Shaanxi and Xinjiang in northwest China date back 5,500 years, Li said.
"Many experts shared the view that the mace heads were not a product of ancient Chinese civilization, but were transported from the West," said Li.
Most mace heads unearthed in northwest China are made of stone, jade or bronze, and are in the shape of balls, peaches and pentagrams, according to Li. Some of them even carry colored drawings.
Their shapes and functions were surprisingly similar to those of ancient Egypt, Li told an International Symposium on the Silk Road sponsored by the United Nations Educational, Scientific and Cultural Organization, held in Xi'an, capital of Shaanxi Province.
The symposium was attended by experts and scholars from 29 countries and regions worldwide.
Li said the origins of civilizations were various and exchanges between different cultures were not "invasions." Central Asia and Xinjiang were the major regions where ancient Chinese and Western civilizations influenced and mingled with each other.
Li's views were echoed by many experts.
Wang Jianxin, a leading archaeologist and a professor with Xibei (Northwest China) University, said exchanges between nomadic tribes of Asia and Europe began before the opening of the Silk Road in the Han Dynasty (206 BC-220 AD).
According to Wang, the exchanges occurred through the vast region between the Tianshan Mountains and Altay Mountains, officially recognized as the "Oasis Silk Road," also known as the "Prairie Silk Road," in the Han Dynasty. The road links prairies in Mongolia, Central and West Asia and Europe.
Archaeological discoveries and research in recent decades had shown that this region had been an important path for exchanges between eastern and western nomadic tribes as early as in the Bronze Age, dating back 3,000 to 4,000 years, Wang said.
The fact that unearthed utensils of nomadic tribes, exhibited in museums of European and Asian countries, were surprisingly similar also proved that the "Prairie Silk Road" played an important role in early East-West exchanges, Wang noted.
"Cultural influence is mutual and the earliest date for East-West exchanges might surpass our imagination," said Wang Hui, deputy director of Gansu Provincial Archaeological Institute, who has long devoted himself to archaeological excavations along the Silk Road.
Wang said wheat originated in West Asia and the earliest wheat seeds unearthed in the region were 10,000 years old. But wheat seeds dating back more than 4,000 years had been unearthed in Gansu Province, northwest China.
Millet originated in China's Yellow River valley, known as the cradle of Chinese civilization, but a kind cake made of millet had been excavated in Xinjiang.
Professor Victor H. Mair, of the University of Pennsylvania, the United States, praised Li Shuicheng's view as "brave," "just" and "objective."
He said that for thousands of years, Central Asia and China's Xinjiang had been regions where ancient civilizations contacted, influenced and mingled with each other.
The infiltration and blending of different cultures had a profound and long-term impact on the formation and development of a complex cultural structure in these regions and at the same time, promoted development of the East and West, Mair said.
posted
Ausar, I really don't think these maces have anything to do with ancient Egypt. The ones in ancient Egypt were pear-shaped and were ritual icons of the pharaohs used in sacrifice. Why would the Egyptians trade such highly important ritual objects so far away?
also is the fact of their description:
quote:Most mace heads unearthed in northwest China are made of stone, jade or bronze, and are in the shape of balls, peaches and pentagrams, according to Li. Some of them even carry colored drawings.
Jade was used by the Chinese and peaches and pentagrams are also ancient Chinese icons.
Posts: 26295 | From: Atlanta, Georgia, USA | Registered: Feb 2005
| IP: Logged |
posted
This was not my article. This article appeared in the press about two years ago. There was never a follow up article or a published report in any journal that I am aware of.
Posts: 8675 | From: Tukuler al~Takruri as Ardo since OCT2014 | Registered: Feb 2003
| IP: Logged |
posted
Egypt and China make good bedfellows for several reasons. For one thing, they were remote enough from one another to be good neighbours. As I understand the situation, the vanished Toccharian culture existed along the Silk Road and profited from their existence as "hoteliers" - offering a string of civilized enclaves for travellers of all sorts. Archaeologists have remarked on the similarities between Toccharian culture and Egyptian.
From another angle, Egypt had some longstanding trade contact with Nepal. This was a direct offshoot of commerce in nard - or nardashir - the rare plant from which precious unguents and perfumes were distilled in Egypt. This presumes a maritime route via coast hugging relays as well as an overland one. It is possible that Sri Lankans and Indians served as go betweens. Almost certainly, however, Egyptian sailors managed to steer as far as Australia at an early date. A large amount of "circumstantial" evidence points to serious interchange between China and Egypt - icons, divination and board games being somewhat of a key to --- hmmmm - many things.
He who lives by the river, owns the entire ocean. If the monumental size of Khufu's buried boats are any indication, Egyptians made the most of their riverfront property and were, at least in theory, not strictly limited to Puntine adventures.
a bientot DMc
[This message has been edited by Pimander (edited 14 July 2005).]
[This message has been edited by Pimander (edited 14 July 2005).]
I posted the page below before but it's relevant to this discussion on analogies or substantive relationships between Egypt and China:
From the upper right table: nearly identical cattle altars (4, 6); red and black stick figures [1A, 3D]; black stick figures and cattle [1B, 3E].
Left column Chinese shabti [9] protecting king not dissimilar to Egyptian shabti whereas it appears no cultures between Egypt and China share this burial tradition (not isolated but with others mentioned here).
From the right column: Chinese feline standing before pyramid substantively the same as that of Egypt; Double feline both among Shang of China and Egypt.
Finally, Chinese scientists state (as shown in the article below the web page) that genetic evidence shows all Chinese tested arose from Africa. Granted, that's from the distant past. However, the third paragraph in the right column shows that Chinese have many of the same family names as Africans. I would say this is not accidental as we don't find any cultures laying on a straight line between Africa and China that have the same grouping of tribal names. Again, this is not an isolated similarity but added with the others means that in all likelihood, the similarities spoken of by the authors of the article Ausar referred to are not due to chance.
Li Jin, A Tale of 12,000 Y Chromosomes, Science, 11 May 2001.
Yuehai Ke, Bing Su, Xiufeng Song, Daru Lu, Lifeng Chen, Hongyu Li, Chunjian Qi, Sangkot Marzuki, Ranjan Deka, Peter Underhill, Chunjie Xiao, Mark Shriver, Jeff Lell, Douglas Wallace, R Spencer Wells, Mark Seielstad, Peter Oefner, Dingliang Zhu, Jianzhong Jin, Wei Huang, Ranajit Chakraborty, Zhu Chen, Li Jin, African Origin of Modern Humans in East Asia: A Tale of 12,000 Y Chromosomes, Science, 292:5519, pp. 1151-1153, Issue of 11 May 2001.
Yuehai Ke,1* Bing Su,2, 1, 3* Xiufeng Song,1 Daru Lu,1 Lifeng Chen,1 Hongyu Li,1 Chunjian Qi,1 Sangkot Marzuki,4 Ranjan Deka,5 Peter Underhill,6 Chunjie Xiao,7 Mark Shriver,8 Jeff Lell,9 Douglas Wallace,9 R Spencer Wells,10 Mark Seielstad,11 Peter Oefner,6 Dingliang Zhu,12 Jianzhong Jin,1 Wei Huang,12, 13 Ranajit Chakraborty,3 Zhu Chen,12, 13 Li Jin1, 3, 13
To test the hypotheses of modern human origin in East Asia, we sampled 12,127 male individuals from 163 populations and typed for three Y chromosome biallelic markers (YAP, M89, and M130). All the individuals carried a mutation at one of the three sites. These three mutations (YAP+, M89T, and M130T) coalesce to another mutation (M168T), which originated in Africa about 35,000 to 89,000 years ago. Therefore, the data do not support even a minimal in situ hominid contribution in the origin of anatomically modern humans in East Asia.
1 State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Sciences, Fudan University, 220 Handan Road, Shanghai, China 200443, and Morgan-Tan International Center for Life Sciences, Shanghai, China. 2 Kunming Institute of Zoology, the Chinese Academy of Sciences, Kunming, China. 3 Human Genetics Center, University of Texas-Houston, 1200 Herman Pressler E547, Houston, TX 77030, USA. 4 Eijkman Institute for Molecular Biology, Jakarta, Indonesia. 5 Department of Environmental Health, University of Cincinnati, Cincinnati, OH 45267, USA. 6 Department of Genetics, Stanford University, Stanford, CA 94305, USA. 7 Department of Biology, Yunnan University, Kunming, China. 8 Department of Anthropology, Pennsylvania State University, University Park, PA 16802, USA. 9 Center for Molecular Medicine, Emory University School of Medicine, Atlanta, GA 30322, USA. 10 Wellcome Trust Center for Human Genetics, University of Oxford, UK. 11 Program for Population Genetics, Harvard School of Public Health, Boston, MA 02115, USA. 12 Shanghai Second Medical University, Shanghai, China. 13 National Human Genome Center at Shanghai, China. * These authors contributed equally to this work.
To whom correspondence should be addressed. E-mail: ljin@fudan.edu or ljin@sph.uth.tmc.edu
The "Out-of-Africa" hypothesis suggests that anatomically modern humans originated in Africa about 100,000 years ago and then spread outward and completely replaced local archaic populations outside Africa (1, 2). This proposition has been supported by genetic evidence and archaeological findings (3-9). The replacement in Europe was supported by recent ancient DNA analyses, which ruled out the contribution of Neanderthals to modern Europeans (10, 11). However, it has been argued that the abundant hominid fossils found in China and other regions in East Asia (e.g., Peking man and Java man) demonstrate continuity, not only in morphological characters but also in spatial and temporal distributions (12-16). In this report, we test the competing hypotheses of modern Asian human origins using Y chromosome polymorphisms.
We sampled 12,127 male individuals from 163 populations across Southeast Asia, Oceania, East Asia, Siberia, and Central Asia and typed for three Y chromosome biallelic markers (YAP, M89, and M130) (17, 18) (Table 1). Being a single-locus multiple-site (i.e., haplotype) system, the Y chromosome is one of the most powerful molecular tools for tracing human evolutionary history (5, 9, 19-21). In previous Y chromosome studies, an extreme geographic structure was revealed in global populations in which the oldest clade represents Africans and the younger ones represent some Africans and all non-African populations (21).
One Y chromosome polymorphism (C to T mutation) at the M168 locus is shared by all non-African populations and was originally derived from Africa on the basis of a study of 1062 globally representative male individuals (21). The age of M168 was estimated at 44,000 years (95% confidence interval: 35,000 to 89,000 years), marking the recent Out-of-Africa migrations (21). Under the M168T lineage, there are three major derived sublineages defined by polymorphisms at loci YAP (Alu insertion) (5), M89 (C to T mutation), and M130 (C to T mutation, also called RPS4Y) (Fig. 1) (21, 22). Therefore, these three markers can be used to test the completeness of the replacement of modern humans of African origin in East Asia. An observation of a male individual not carrying one of the three polymorphisms would be indicative of a potential ancient origin and could possibly lead to the rejection of such completeness.
Each of the 12,127 samples typed carried one of the three polymorphisms (YAP+, M89T, or M130T) (Table 1). In other words, they all fall into the lineage of M168T that was originally derived from Africa. Hence, no ancient non-African Y chromosome was found in the extant East Asian populations (P = 5.4 � 106 assuming a frequency of 1/1000 of local contribution in the extant populations), suggesting an absence of either an independent origin or a 1,000,000-year shared global evolution. This result indicates that modern humans of African origin completely replaced earlier populations in East Asia.
It was argued that the extensive genetic data supporting the Out-of-Africa hypothesis could also be explained by the multiregional hypothesis under a version of the trellis model (23). This model suggests that a multiregional evolutionary paradigm is shared across the human range by frequent gene exchanges between continental populations since Homo erectus came out of Africa about 1 million years ago (23). It is difficult to test the trellis model with markers from mitochondrial hypervariable region (D-loop) and autosome because these markers show frequent recurrent mutations and/or recombination (24, 25), respectively. However, this can be circumvented by the application of a large number of Y chromosome biallelic markers, which escape recombination and have a low mutation rate.
It has been shown that all the Y chromosome haplotypes found outside Africa are younger than 35,000 to 89,000 years and derived from Africa (21), although this estimation is crude and depends on several assumptions. In addition, if extensive gene flow had occurred between continental populations during the past 1 million years but before the divergence between Africans and non-Africans, as suggested by the multiregionalists, the ancient Y chromosome haplotypes seen in African populations or even much older haplotypes would have been expected in East Asia, which was not observed in our data.
However, this observation does not necessarily preclude the possibility of selection sweep that could erase archaic Y chromosomes of modern humans in East Asia. On the other hand, a minor contribution from a female lineage of local origin cannot be excluded either, which should be further studied with the use of mitochondrial DNA (mtDNA) markers. Because the Y chromosome has a relatively small effective population size, it is subject to stochastic process, e.g., genetic drift, which could also lead to extinction of archaic lineages. However, in our study, with 163 populations from different regions of Asia, it is hard to imagine that all of the 163 populations should drift in the same direction.
Inconsistency of age estimations for a common ancestor with the use of mitochondrial/Y chromosome and autosome/X chromosome markers, however, creates confusion. The age estimated with the use of autosome/X chromosome genes ranges from 535,000 to 1,860,000 years (26-29), much older than those for mtDNA and Y chromosome. However, this difference in age estimation might only reflect the difference in the effective population sizes between Y chromosome/mtDNA and X chromosome/autosome (three to four times as many as the former) in the presence of bottleneck events associated with the outbound migrations from Africa, therefore disqualifying the utility of the latter in distinguishing the competing hypotheses (24, 30).
REFERENCES AND NOTES 1. R. L. Cann, M. Stoneking, A. C. Wilson, Nature 325, 31 (1987) [Medline]. 2. L. Vigilant, M. Stoneking, H. Harpending, K. Hawkes, A. C. Wilson, Science 253, 1503 (1991) [Medline]. 3. C. B. Stringer and P. Andrew, Science 239, 1263 (1988) [Medline]. 4. A. M. Bowcock, et al., Nature 368, 455 (1994) [Medline]. 5. M. F. Hammer, Nature 378, 376 (1995) [Medline]. 6. S. A. Tishkoff, et al., Science 271, 1380 (1996) . 7. J. Y. Chu, et al., Proc. Natl. Acad. Sci. U.S.A. 95, 11763 (1998) [Abstract/Full Text]. 8. L. Quintana-Murci, et al., Nature Genet. 23, 437 (1999) [Medline]. 9. B. Su, et al., Am. J. Hum. Genet. 65, 1718 (1999) [Medline]. 10. M. Krings, et al., Cell 90, 19 (1997) [Medline]. 11. V. O. Igor, et al., Nature 404, 490 (2000) [Medline]. 12. A. S. Brooks and B. Wood, Nature 344, 288 (1990) [Medline]. 13. T. Li and D. A. Etler, Nature 357, 404 (1992) [Medline]. 14. X. Z. Wu, F. E. Poirier, Human Evolution in China (Oxford Univ. Press, Oxford, 1995). 15. D. A. Etler, Annu. Rev. Anthropol. 25, 275 (1996) . 16. C. C. Swisher, et al., Science 274, 1870 (1996) [Abstract/Full Text]. 17. A total of 163 populations were sampled from Central Asia (Crimean Tatar, Iranian, Dungan, Tajik, Turkmen, Karakalpak, Eastern Uzbek, Sinte Romani, Khorezmian Uzbek, Uighur, Kazak, Bukharan Arab, and Kyrgyz); Central Siberia (Tuvan, Tofalar, Yenisey Evenk, Buryat-1, and Buryat-2); Okhotsk/Amur (Okhotsk Evenk, Ulchi/Nanai, Upriver Negidal, Downriver Negidal, Udegey, and Nivkh); Kamchatka/Chukotka (Koryak, Itelman, Chukchi, and Siberian Eskimo); northern East Asia (Ewenki, Manchurian-1, Manchurian-2, Korean, Japanese, Hui-1, Hui-2, Jingpo, Tu, Sala, Mongolian-1, Mongolian-2, Tibetan-Qinghai, Tibetan-Tibet, Tibetan-Yunnan, Kazak-Xinjiang, and Uyghur); northern Han Chinese (Heilongjiang, Liaoning, Hebei, Beijing, Tianjin, Shandong, Shanxi, Gansu, Xinjiang, Henan, Inner-Mongolia, Qinghai, Shaanxi, and Jilin); southern Han Chinese (Anhui, Zhejiang, Jiangsu, Shanghai, Hubei, Sichuan, Jiangxi, Hunan, Fujian, Yunnan, Guangxi, Guangdong, and Guizhou); Taiwan (Bunun, Atayal, Yami, Paiwan, and Ami); Southeast Asia (Tujia, Yao-Nandan, Yao-Jinxiu, Zhuang, Dong, Wa-1, Wa-2, Wa-3, Aini, Blang-1, Blang-2, Lahu-1, Lahu-2, Lahu-3, Lahu-4, Deang, Yi, She, Li, Cambodian, Dai-1, Dai-2, Akha, Karen, Lisu, Jino, Hmong, Yao, Kinh, Muong, Naxi, Ahom, So, Northern Thailand, Northeast Thailand, Bai-1, and Bai-2); Indonesia/Malaysia [Malay CB, Malay KM, Orang Asli, Batak, Malay (Pakanbaru), Minangkabau, Palembang, Bangka, Nias, Dayak, Java, Tengger, Bali, Sasak, Sumbawa, Sumba, Alor, Makassar, Bugis, Torajan, Kaili, Manado, Irian, Kota Kinabalu, and Sakai]; Polynesia/Micronesia (Truk, Guam, Palau, Majuro, Kribati, Pohnpei, Nauru, Kapingamarangi, Tonga, American Somoan, and West Somoan); Papuan and New Guinean Highland (Australian Aborigine, Nasioi-Melanesian, New Guinean-1, New Guinean-2, Bankes and Torres, Santo, and Maewo); and Northeastern India [Adi, Nishi, Assam, Apatani, Rabha(Assam), and Naga]. The numbered populations of the same ethnicity were sampled independently. 18. Genotyping was conducted by a polymerase chain reaction restriction fragment length polymorphism assay. The restriction sites were engineered for M130 (Bsl I) and M89 (Nla III) by designing mismatch primers. The primer sequences are ACAGAAGGATGCTGCTCAGCTT/GCAACTCAGGCAAAGTGAGACAT (M89) and TATCTCCTCTTCTATTGCAG/CCACAAGGGGGAAAAAACAC (M130). The typing of YAP follows previous reports (5, 9). Genotyping was repeated to clarify any equivocal typing results. 19. M. A. Jobling, et al., Trends Genet. 11, 449 (1995) [Medline]. 20. P. A. Underhill, et al., Ann. Hum. Genet. 65, 43 (2001) . 21. P. A. Underhill, et al., Nature Genet. 26, 358 (2000) [Medline]. 22. A. W. Bergen, et al., Ann. Hum. Genet. 63, 63 (1999) [Medline]. 23. M. H. Wolpoff, J. Hawks, R. Caspari, Am. J. Phys. Anthropol. 112, 129 (2000) [Medline]. 24. L. Jin and B. Su, Nature Rev. Genet. 1, 126 (2000) . 25. M. Stoneking, et al., Curr. Opin. Genet. Dev. 6, 731 (1996) [Medline]. 26. R. M. Harding, et al., Am. J. Hum. Genet. 60, 772 (1997) [Medline]. 27. H. Kaessmann, F. Heissig, A. Haeseler, S. Paabo, Nature Genet. 22, 78 (1999) [Medline]. 28. E. Harris and J. Hey, Proc. Natl. Acad. Sci. U.S.A. 96, 3320 (1999) [Abstract/Full Text]. 29. Z. M. Zhao, et al., Proc. Natl. Acad. Sci. U.S.A. 97, 11354 (2000) [Abstract/Full Text]. 30. J. C. Fay and C. I. Wu, Mol. Biol. Evol. 16, 1003 (1999) [Medline]. 31. We thank all the 12,127 men who donated DNA for this study. This study was supported by the China Natural Science Foundation. B.S., R.C., and L.J. were supported by NIH grants. R.D. was supported by the Center for Environmental Genetics at the University of Cincinnati. 20 February 2001; accepted 20 March 2001 10.1126/science.1060011 Include this information when citing this paper.
Related articles in Science:
HUMAN ANTHROPOLOGY: Modern Men Trace Ancestry to African Migrants.
. .
-------------------- The nature of homelife is the fate of the nation. Posts: 2334 | Registered: May 2006
| IP: Logged |
UBBFriend: Email this page to someone!
![[Smile]](smile.gif)
Printer-friendly view of this topic