posted
Biological differences among races do not exist, WU research shows By Tony Fitzpatrick --------------------------------------------------------------------------------
Race doesn't matter.
In fact, it doesn't even exist in humans.
While that may sound like the idealistic decree of a minister or rabbi, it's actually the conclusion of an evolutionary and population biologist at Washington University.
Alan R. Templeton, Ph.D., professor of biology in Arts and Sciences, has analyzed DNA from global human populations that reveal the patterns of human evolution over the past one million years. He shows that while there is plenty of genetic variation in humans, most of the variation is individual variation. While between-population variation exists, it is either too small, which is a quantitative variation, or it is not the right type of qualitative variation -- it does not mark historical sublineages of humanity.
Using the latest molecular biology techniques, Templeton has analyzed millions of genetic sequences found in three distinct types of human DNA and concludes that, in the scientific sense, there is no such thing as race.
"Race is a real cultural, political and economic concept in society, but it is not a biological concept, and that unfortunately is what many people wrongfully consider to be the essence of race in humans -- genetic differences," Templeton said. "Evolutionary history is the key to understanding race, and new molecular biology techniques offer so much on recent evolutionary history. I wanted to bring some objectivity to the topic. This very objective analysis shows the outcome is not even a close call: There's nothing even like a really distinct subdivision of humanity."
Templeton used the same strategy to try to identify race in human populations that evolutionary and population biologists use for non-human species, from salamanders to chimpanzees. He treated human populations as if they were non-human populations.
"I'm not saying these results don't recognize genetic differences among human populations," he cautioned. "There are differences, but they don't define historical lineages that have persisted for a long time."
Templeton's paper, "Human Races: A Genetic and Evolutionary Perspective," is published in the fall 1998 issue of the American Anthropologist, an issue almost exclusively devoted to race. The new editor-in-chief of the American Anthropologist is Robert W. Sussman, Ph.D., professor of anthropology in Arts and Sciences.
"The folk concept of race in America is so ingrained as being biologically based and scientific that it is difficult to make people see otherwise," said Sussman, a biological anthropologist. "We live on the one-drop racial division --if you have one drop of black or Native American blood, you are considered black or Native American, but that doesn't cover one's physical characteristics.
"Templeton's paper," Sussman continued, "shows that if we were forced to divide people into groups using biological traits, we'd be in real trouble. Simple divisions are next to impossible to make scientifically, yet we have developed simplistic ways of dividing people socially."
Single lineage Templeton analyzed genetic data from mitochondrial DNA, a form inherited only from the maternal side; Y chromosome DNA, paternally inherited DNA; and nuclear DNA, inherited from both sexes. His results showed that 85 percent of genetic variation in the human DNA was due to individual variation. A mere 15 percent could be traced to what could be interpreted as "racial" differences. "The 15 percent is well below the threshold that is used to recognize race in other species," Templeton said. "In many other large mammalian species, we see rates of differentiation two or three times that of humans before the lineages are even recognized as races. Humans are one of the most genetically homogenous species we know of. There's lots of genetic variation in humanity, but it's basically at the individual level. The between-population variation is very, very minor."
Among Templeton's conclusions: There is more genetic similarity between Europeans and sub-Saharan Africans and between Europeans and Melanesians, inhabitants of islands northeast of Australia, than there is between Africans and Melanesians. Yet, sub-Saharan Africans and Melanesians share dark skin, hair texture and cranial-facial features, traits commonly used to classify people into races. According to Templeton, this example shows that "racial traits" are grossly incompatible with overall genetic differences between human populations.
"The pattern of overall genetic differences instead tells us that genetic lineages rapidly spread out to all of humanity, indicating that human populations have always had a degree of genetic contact with one another, and thus historically don't show any distinct evolutionary lineages within humanity," Templeton said. "Rather, all of humanity is a single long-term evolutionary lineage."
Among Templeton's conclusions: There is more genetic similarity between Europeans and sub-Saharan Africans and between Europeans and Melanesians, inhabitants of islands northeast of Australia, than there is between Africans and Melanesians. Yet, sub-Saharan Africans and Melanesians share dark skin, hair texture and cranial-facial features, traits commonly used to classify people into races. According to Templeton, this example shows that "racial traits" are grossly incompatible with overall genetic differences between human populations.
Why?...because most recent African ancestry is prevalent among Europeans than Melanesians - something which you fail to comprehend, but presents itself time and again, as in this case - while Europeans are also genetically a subset of Eurasians - whose gene pools in turn derive from a subset of African gene pools.
Posts: 5964 | Registered: Jan 2005
| IP: Logged |
Among Templeton's conclusions: There is more genetic similarity between Europeans and sub-Saharan Africans and between Europeans and Melanesians, inhabitants of islands northeast of Australia, than there is between Africans and Melanesians. Yet, sub-Saharan Africans and Melanesians share dark skin, hair texture and cranial-facial features, traits commonly used to classify people into races. According to Templeton, this example shows that "racial traits" are grossly incompatible with overall genetic differences between human populations.
Why?...because most recent African ancestry is prevalent among Europeans than Melanesians - something which you fail to comprehend, but presents itself time and again, as in this case - while Europeans are also genetically a subset of Eurasians - whose gene pools in turn derive from a subset of African gene pools.
That has nothing to do with the closer relationship, don't even attempt to try and interpret Templeton. From what I did^read of Templeton's study Melanesians descend from a subset of^Eurasians, the study mentioned nothing about recent African ancestry in Europeans a the reason for Europeans and Africans being closer to one another.
Posts: 2595 | From: Vicksburg | Registered: Feb 2006
| IP: Logged |
That has nothing to do with the closer relationship, don't even attempt to try and interpret Templeton.
What then does? Feel free to interpret Templeton's explanation for this phenomenon, that doesn't boil down to what I had already spelt out.
quote: Charles:
From what I did^read of Templeton's study Melanesians descend from a subset of^Eurasians, the study mentioned nothing about recent African ancestry in Europeans a the reason for Europeans and Africans being closer to one another.
Since when does somebody have to say something before you can get it - what ever happened to the idea of accumulation of knowledge from earlier learning? Your approach to knowledge-gathering is bizarre indeed.
BOTH Melanesian and European gene pools are a subset of Eurasian gene pool [which again, derived from a subset of African gene pool]; Given this, again, why then do we have this situation?...
There is more genetic similarity between Europeans and sub-Saharan Africans and between Europeans and Melanesians, inhabitants of islands northeast of Australia, than there is between Africans and Melanesians.
quote:Originally posted by *Topdog*:
Stop hijacking this thread with rambling about African ancestry in Europeans, confine to the other threads that talk about that issue.
You mean like how you've highjacked other threads where this issue came up. I agree with you on one thing; it is pointless to keep bringing up a matter that you obviously have no comprehension of, even if something to the effect is mentioned time and again in the material that you've just posted.
Posts: 5964 | Registered: Jan 2005
| IP: Logged |
posted
Profesor Winters, if you still believe race exists, what about this:
Human Races: A Genetic and Evolutionary Perspective Alan R. Templeton
Race is generally used as a synonym for subspecies, which traditionally is a geographically circumscribed, genetically differentiated population. Sometimes traits show independent patterns of geographical variation such that some combination will distinguish most populations from all others. To avoid making "race" the equivalent of a local population, minimal thresholds of differentiation are imposed. Human "races" are below the thresholds used in other species, so valid traditional subspecies do not exist in humans. A "subspecies" can also be defined as a distinct evolutionary lineage within a species. Genetic surveys and the analyses of DNA haplotype trees show that human "races" are not distinct lineages, and that this is not due to recent admixture; human "races" are not and never were "pure." Instead, human evolution has been and is characterized by many locally differentiated populations coexisting at any given time, but with sufficient genetic contact to make all of humanity a single lineage sharing a common evolutionary fate. [race, subspecies, lineage, haplotype tree, genetic differentiation]
American Anthropologist Volume 100, Number 3, September 1998
Posts: 2595 | From: Vicksburg | Registered: Feb 2006
| IP: Logged |
"I am more accurate at assessing race from skeletal remains that from looking at living people standing before me," Gill says.
Slightly over half of all biological/physical anthropologists today believe in the traditional view that human races are biologically valid and real. Furthermore, they tend to see nothing wrong in defining and naming the different populations of Homo sapiens. The other half of the biological anthropology community believes either that the traditional racial categories for humankind are arbitrary and meaningless, or that at a minimum there are better ways to look at human variation than through the "racial lens."
Are there differences in the research concentrations of these two groups of experts? Yes, most decidedly there are. As pointed out in a recent 2000 edition of a popular physical anthropology textbook, forensic anthropologists (those who do skeletal identification for law-enforcement agencies) are overwhelmingly in support of the idea of the basic biological reality of human races, and yet those who work with blood-group data, for instance, tend to reject the biological reality of racial categories.
The "reality of race" therefore depends more on the definition of reality than on the definition of race. If we choose to accept the system of racial taxonomy that physical anthropologists have traditionally established—major races: black, white, etc.—then one can classify human skeletons within it just as well as one can living humans. The bony traits of the nose, mouth, femur, and cranium are just as revealing to a good osteologist as skin color, hair form, nose form, and lips to the perceptive observer of living humanity. I have been able to prove to myself over the years, in actual legal cases, that I am more accurate at assessing race from skeletal remains than from looking at living people standing before me. So those of us in forensic anthropology know that the skeleton reflects race, whether "real" or not, just as well if not better than superficial soft tissue does. The idea that race is "only skin deep" is simply not true, as any experienced forensic anthropologist will affirm.
posted
^ Dr. Winters. Have you ever read any studies or work by George Gill?
If no, what impresses you about his dodgy semantics: The "reality of race" therefore depends more on the definition of reality than on the definition of race. -George Gill.
Definition of reality?
Fine:
The reality is, his definition of race is based on circular reasoning - that we can look at a skull and classify it by 'race', and be correct...based upon prevailing, social, and therefore variable definitions of 'race', which have no intrinsic scientific value to begin with.
The reality is, this proves nothing.
In order to validate race- we need to put it to some kind of objective verifiable test.
Many anthropologists have, and they *do not agree* with George Gill:
All of the crania in this Spanish sample originated from a 16th to 17th-century community associated with a church in northwestern Spain. Although specific information on the ancestry of any particular individual in the sample is not available, generally all individuals should be considered examples of this group.
Table 3 presents the race classification of all individuals in this sample using the Forensic Data Bank option.
Of the 95 individuals, 42 (44 percent) were classified as white, 35 percent as black, 9 percent as Hispanic, 4 percent as Japanese, 4 percent as American Indian, and the remaining three individuals as Chinese and Vietnamese. Using the sex estimates made by the authors at the time of examination as Sex Known and classifying the crania by race within the specific sex category using the Forensic Data Bank option, the greatest percentage classified this time into the black category.
Some crania were classified into groups with no clear geographic or ancestral relationship with the Spanish sample.
Gill's only response to this, is to vouch for himself "I am more accurate examining skeletans than I am when looking at the actual person".
Terrific.
I wouldn't put that on my resume' if I were Gill.
Posts: 15202 | Registered: Jun 2004
| IP: Logged |
quote:Originally posted by Clyde Winters: George Gill
quote: quote:
"I am more accurate at assessing race from skeletal remains that from looking at living people standing before me," Gill says.
Slightly over half of all biological/physical anthropologists today believe in the traditional view that human races are biologically valid and real. Furthermore, they tend to see nothing wrong in defining and naming the different populations of Homo sapiens. The other half of the biological anthropology community believes either that the traditional racial categories for humankind are arbitrary and meaningless, or that at a minimum there are better ways to look at human variation than through the "racial lens."
Are there differences in the research concentrations of these two groups of experts? Yes, most decidedly there are. As pointed out in a recent 2000 edition of a popular physical anthropology textbook, forensic anthropologists (those who do skeletal identification for law-enforcement agencies) are overwhelmingly in support of the idea of the basic biological reality of human races, and yet those who work with blood-group data, for instance, tend to reject the biological reality of racial categories.
The "reality of race" therefore depends more on the definition of reality than on the definition of race. If we choose to accept the system of racial taxonomy that physical anthropologists have traditionally established—major races: black, white, etc.—then one can classify human skeletons within it just as well as one can living humans. The bony traits of the nose, mouth, femur, and cranium are just as revealing to a good osteologist as skin color, hair form, nose form, and lips to the perceptive observer of living humanity. I have been able to prove to myself over the years, in actual legal cases, that I am more accurate at assessing race from skeletal remains than from looking at living people standing before me. So those of us in forensic anthropology know that the skeleton reflects race, whether "real" or not, just as well if not better than superficial soft tissue does. The idea that race is "only skin deep" is simply not true, as any experienced forensic anthropologist will affirm.
Clyde, in view of the *FACT* that bioanthropologists and geneticists are increasingly duscarding racial classification, wouldn't it seem that he(Gill) is a bit of an anomally? Forensic anthropologists scrwe it rountinely, here's the danger in using typological criteria(ie, what a sterotypical "Negro" and "Caucasian" looks like) to classify crania:
UGHAN, ONT. - York Regional Police have released drawings of an unidentified woman whose badly burned body was found in an industrial park more than 10 years ago.
A police officer made the gruesome discovery on Sept. 1, 1994, after noticing a fire behind a building on Bradwick Drive near Highway 7 in Vaughan.
When the fire was put out, the body of a young woman was found in the remains of a suitcase. Gasoline and tires had been used to fuel the fire.
On Tuesday, investigators released drawings of a clay reconstruction of the victim's face, along with previously unpublished information that they hope may help someone identify her.
Forensic testing indicates that the victim was likely a dark-skinned Caucasian from a North African country such as Sudan, Ethiopia, Somalia or Egypt. Her estimated age was 17 to 18.
She stood five feet, four inches, and had a very slim build, weighing between 85 and 100 pounds. She had dark curly hair, which may have been dyed a reddish colour, and protruding front teeth, which were in good condition.
Police say the victim had suffered broken bones in her back and lower limbs that had been left to heal untreated. As a result, they say she was likely immobile and in constant pain.
Forensic anthropologists said the woman was a "dark skin Caucasian" from Sudan, Somalia, Ethiopia or Egypt, none of those peoples are "dark skinned" Caucasians. I wouildn't be surprised if Gill came to the same conclusion about that woman's skull. Foresnic anthropologists strictly adhere to an extreme brand of typological thinking, if they didn't they would be out of a job.
Posts: 2595 | From: Vicksburg | Registered: Feb 2006
| IP: Logged |
posted
Jean Hiernaux, "The People of Africa", 1975, p.91
"....there are approximately one thousand populations in sub-Saharan Africa; and the number of human populations in the world is, of course, several times this figure. Confronted with such large numbers, the human mind tends to reduce them to a lower number of classes. If attainable, the resulting classification would make the presentation and memorization of the characteristics of the populations much easier. By itself, however, it would not bring any understanding of the observed diversity. In particular, it would not necessarily reflect phylogeny(relationship by descent)."
A perfect example of the bolded sentence is this, stated by Templeton:
"Among Templeton's conclusions: There is more genetic similarity between Europeans and sub-Saharan Africans and between Europeans and Melanesians, inhabitants of islands northeast of Australia, than there is between Africans and Melanesians. Yet, sub-Saharan Africans and Melanesians share dark skin, hair texture and cranial-facial features, traits commonly used to classify people into races.Posts: 2595 | From: Vicksburg | Registered: Feb 2006
| IP: Logged |
posted
The fact is that some men are more rational than others, and presently the illusion of race is more valuable than its rality. The socio-political constructs, if it were to be re-assessed, its present promotors will surely suffer because myth and deception will be exposed and whatevr one sows, the same he shall reap.
There is an impetus to maintain the 'race' reality because it carries a power quotient that will be destroyed and there are those who wish that it remain in force for control to persist!
Posts: 1290 | From: usa | Registered: May 2005
| IP: Logged |
quote: Clyde, in view of the *FACT* that bioanthropologists and geneticists are increasingly duscarding racial classification, wouldn't it seem that he(Gill) is a bit of an anomally?
Not really, forensic anthropologists are helping police determine the identity of many murder victims everyday successfully.
.
-------------------- C. A. Winters Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
quote: The fact is that some men are more rational than others, and presently the illusion of race is more valuable than its rality. The socio-political constructs, if it were to be re-assessed, its present promotors will surely suffer because myth and deception will be exposed and whatevr one sows, the same he shall reap.
There is an impetus to maintain the 'race' reality because it carries a power quotient that will be destroyed and there are those who wish that it remain in force for control to persist!
You are wrong using race allows scientists to be specific in their identification of individuals and populations.
This why many Geneticist continue to use race in their research.
: Hum Immunol. 2006 Jan-Feb;67(1-2):73-84. Epub 2006 Apr 5. Related Articles, Links The haplotype structure of the human major histocompatibility complex.Alper CA, Larsen CE, Dubey DP, Awdeh ZL, Fici DA, Yunis EJ.CBR Institute for Biomedical Research, Boston, MA 02115, USA; Department of Pediatrics, Harvard Medical School, Boston, MA 02115, USA.There is great interest in the use of single-nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) analysis to localize human disease genes. The results suggest that the human genome, including the major histocompatibility complex (MHC), consists largely of 5- to 200-kb blocks of sequence fixity between which random recombination occurs. Direct determination of MHC haplotypes from family studies also demonstrates similar-sized blocks, but otherwise gives a very different picture, with a third to a half of Caucasian haplotypes fixed from HLA-B to HLA-DR/DQ (at least 1 Mb) as conserved extended haplotypes (CEHs), some of which encompass more than 3 Mb. These fixed haplotypes differ in frequency both in different Caucasian subpopulations and in Caucasian patients with HLA-associated diseases, complicating disease susceptibility gene localization. The inherent inability of LD analysis to "see" DNA fixity beyond three markers contributes to the failure of SNP/LD analysis to define in detail or even detect CEHs in the MHC and probably elsewhere in the genome. More importantly, the use of statistical analysis, rather than direct haplotype determination and counting, fails to reveal the details of haplotype structure essential for gene localization. Given the oversimplified picture of the MHC (and probably the rest of the genome) provided only by SNP/LD-defined blocks, it is questionable whether this approach will be of great help in disease susceptibility gene localization or identification.
Br J Haematol. 1997 Aug;98(2):356-64. Related Articles, Links
Specificity and sensitivity of RHD genotyping methods by PCR-based DNA amplification.
Aubin JT, Le Van Kim C, Mouro I, Colin Y, Bignozzi C, Brossard Y, Cartron JP.
Centre d'Hemobiologie Perinale, Paris, France.
We have compared the sensitivity and specificity of four PCR methods of RHD gene detection using different sets of primers located in the regions of highest divergence between the RHD and RHCE genes, notably exon 10 (method I), exon 7 (method II), exon 4 (method III) and intron 4 (method IV). Methods I-III were the most sensitive and gave a detectable signal with D-pos/D-neg mixtures containing only 0.001% D-positive cells. Moreover, method II could detect the equivalent DNA amount present in only three nucleated cells in the assay without hybridization of PCR products, whereas the sensitivity of the other methods was 10-50 times less. Investigation of D variants indicated that false-negative results were obtained with method II (D(IVb) variant), method III (D(VI) and DFR variants) and method IV (D(VI) variants), but not method I. Weak D (D(u)) was correctly detected as D-positive by all methods, but most cases of Rh(null) appeared as false-positives, as they carry normal RH genes that are not phenotypically expressed. Some false-positive results were obtained with method I in a few Caucasian DNA samples serotyped as RhD-neg but carrying a C- or E-allele, whereas a high incidence of false-positives was found among non-Caucasian Rh-negative samples by all methods. In the Caucasian population, however, we found a full correlation between the predicted genotype and observed phenotype at birth of 92 infants. Although we routinely use the four methods for RHD genotyping, a PCR strategy based on at least two methods is recommended.
Hum Immunol. 2006 Jan-Feb;67(1-2):125-39. Epub 2005 Nov 4. Related Articles, Links
Disease Relevant HLA Class II Alleles Isolated by Genotypic, Haplotypic, and Sequence Analysis in North American Caucasians With Pemphigus Vulgaris.
Lee E, Lendas KA, Chow S, Pirani Y, Gordon D, Dionisio R, Nguyen D, Spizuoco A, Fotino M, Zhang Y, Sinha AA.
Department of Dermatology, Weill Medical College of Cornell University, New York, NY.
Early studies of genetic susceptibility to pemphigus vulgaris (PV) showed associations between human leukocyte antigen (HLA) DR4 and DR6 and disease. The emergence of DNA sequencing techniques has implicated numerous DRB1 and DQB1 loci in various populations, leading to confusion regarding which exact alleles confer susceptibility. The strong linkage disequilibrium among DR and DQ HLA alleles further complicates the investigation of the true susceptibility loci. In this study, we report genotyping data for the largest sampling of North American Caucasian non-Jewish and Ashkenazi Jewish PV patients studied to date and compare our data with other population studies. To pinpoint true susceptibility, alleles among overrepresented sequences, we applied a step-wise reductionist analysis through (1) determination of the degree of linkage disequilibrium (LD) between purportedly associated alleles, (2) haplotype frequencies comparisons, and (3) primary sequence comparisons of disease-associated versus non-disease-associated alleles to identify crucial differences in amino acid residues in putative peptide binding pockets. Collectively, our data provide extended support for the hypothesis that the HLA associations in Caucasian PV patients map to DRB1*0402 and DQB1*0503 alone. Further structure-function studies will be required to define the exact mechanisms of HLA-mediated control of susceptibility and resistance to disease.
PMID: 16698434 [PubMed - in process]
Ann Hum Genet. 2006 May;70(Pt 3):350-9. Related Articles, Links
A comparison of individual genotyping and pooled DNA analysis for polymorphism validation prior to large-scale genetic studies.
Yang HC, Lin CH, Hung SI, Fann CS.
Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan 115.
Polymorphism validation is an important issue in genetic studies because only polymorphic markers provide useful information. We analyzed genetic data for 180 SNPs in the human major histocompatibility complex region in Caucasian and Taiwanese populations, and evaluated ethnic heterogeneity between these populations to illustrate the importance of polymorphism validation. An initial individual genotyping experiment (IGE) with 95 samples was compared with a DNA pooling allele-typing experiment (PAE) of 630 individuals for polymorphism validation based on authentic data sets. Afterwards, all samples were genotyped individually in a confirmation study. Under narrow (broad) polymorphism criteria, 24 (41) polymorphic SNPs in Caucasians could not be validated in the Taiwanese population, suggesting a 13% (23%) inconsistency rate and revealing a strong discrepancy between genetic backgrounds, probably due to ethnic heterogeneity. IGE yielded high sensitivity and specificity for polymorphism validation, but may be sensitive to sampling variation. PAE showed high sensitivity (97%) and specificity (100%) using a narrow polymorphism criterion, but reduced specificity (83%) using a broad criterion. Public domain polymorphism databases should therefore be used with caution and polymorphism validation should be performed routinely prior to conducting large-scale genetic studies. PAE is a cost-saving, reliable alternative to IGE for polymorphism validation, especially for a stringent polymorphism criterion.
quote:Not really, forensic anthropologists are helping police determine the identity of many murder victims everyday successfully.
^ For your supposition to be valid - forensics should ONLY be successful when populations can be structured racially, and should *fail* without social race catagories.
But that is not the case, of course.
In fact, Forensics are just as successful in homogeneous countries like Japan were murder victims would not be classified into distinct social races, BUT CAN JUST AS EASILY BE INDIVIDUALLY IDENTIFIED by forensics as in heterogeneous society.
Forensic identification of murder victims doesn't prove the existence of race.
Posts: 15202 | Registered: Jun 2004
| IP: Logged |
quote:You are wrong using race allows scientists to be specific in their identification of individuals
^ See above. Falsified by the ability of scientists to identify indviduals without catagorising them racially.
If you do not accept this as falsification of your theory - then your theory is non-falsifiable and therefore non-scientific to begin with.
Posts: 15202 | Registered: Jun 2004
| IP: Logged |
quote:Not really, forensic anthropologists are helping police determine the identity of many murder victims everyday successfully.
^ For your supposition to be valid - forensics should ONLY be successful when populations can be structured racially, and should *fail* without social race catagories.
But that is not the case, of course.
In fact, Forensics are just as successful in homogeneous countries like Japan were murder victims would not be classified into distinct social races, BUT CAN JUST AS EASILY BE INDIVIDUALLY IDENTIFIED by forensics as in heterogeneous society.
Forensic identification of murder victims doesn't prove the existence of race.
This is false. The fact that it can be used in multiracial societies to identify "races" support the idea that races exist. The fact that scientist still use the term to identify the race of their patients also validates the reality of race. This is supported by the use of race by geneticists to identify populations.
: Hum Immunol. 2006 Jan-Feb;67(1-2):73-84. Epub 2006 Apr 5. Related Articles, Links The haplotype structure of the human major histocompatibility complex.Alper CA, Larsen CE, Dubey DP, Awdeh ZL, Fici DA, Yunis EJ.CBR Institute for Biomedical Research, Boston, MA 02115, USA; Department of Pediatrics, Harvard Medical School, Boston, MA 02115, USA.There is great interest in the use of single-nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) analysis to localize human disease genes. The results suggest that the human genome, including the major histocompatibility complex (MHC), consists largely of 5- to 200-kb blocks of sequence fixity between which random recombination occurs. Direct determination of MHC haplotypes from family studies also demonstrates similar-sized blocks, but otherwise gives a very different picture, with a third to a half of Caucasian haplotypes fixed from HLA-B to HLA-DR/DQ (at least 1 Mb) as conserved extended haplotypes (CEHs), some of which encompass more than 3 Mb. These fixed haplotypes differ in frequency both in different Caucasian subpopulations and in Caucasian patients with HLA-associated diseases, complicating disease susceptibility gene localization. The inherent inability of LD analysis to "see" DNA fixity beyond three markers contributes to the failure of SNP/LD analysis to define in detail or even detect CEHs in the MHC and probably elsewhere in the genome. More importantly, the use of statistical analysis, rather than direct haplotype determination and counting, fails to reveal the details of haplotype structure essential for gene localization. Given the oversimplified picture of the MHC (and probably the rest of the genome) provided only by SNP/LD-defined blocks, it is questionable whether this approach will be of great help in disease susceptibility gene localization or identification.
Br J Haematol. 1997 Aug;98(2):356-64. Related Articles, Links
Specificity and sensitivity of RHD genotyping methods by PCR-based DNA amplification.
Aubin JT, Le Van Kim C, Mouro I, Colin Y, Bignozzi C, Brossard Y, Cartron JP.
Centre d'Hemobiologie Perinale, Paris, France.
We have compared the sensitivity and specificity of four PCR methods of RHD gene detection using different sets of primers located in the regions of highest divergence between the RHD and RHCE genes, notably exon 10 (method I), exon 7 (method II), exon 4 (method III) and intron 4 (method IV). Methods I-III were the most sensitive and gave a detectable signal with D-pos/D-neg mixtures containing only 0.001% D-positive cells. Moreover, method II could detect the equivalent DNA amount present in only three nucleated cells in the assay without hybridization of PCR products, whereas the sensitivity of the other methods was 10-50 times less. Investigation of D variants indicated that false-negative results were obtained with method II (D(IVb) variant), method III (D(VI) and DFR variants) and method IV (D(VI) variants), but not method I. Weak D (D(u)) was correctly detected as D-positive by all methods, but most cases of Rh(null) appeared as false-positives, as they carry normal RH genes that are not phenotypically expressed. Some false-positive results were obtained with method I in a few Caucasian DNA samples serotyped as RhD-neg but carrying a C- or E-allele, whereas a high incidence of false-positives was found among non-Caucasian Rh-negative samples by all methods. In the Caucasian population, however, we found a full correlation between the predicted genotype and observed phenotype at birth of 92 infants. Although we routinely use the four methods for RHD genotyping, a PCR strategy based on at least two methods is recommended.
Hum Immunol. 2006 Jan-Feb;67(1-2):125-39. Epub 2005 Nov 4. Related Articles, Links
Disease Relevant HLA Class II Alleles Isolated by Genotypic, Haplotypic, and Sequence Analysis in North American Caucasians With Pemphigus Vulgaris.
Lee E, Lendas KA, Chow S, Pirani Y, Gordon D, Dionisio R, Nguyen D, Spizuoco A, Fotino M, Zhang Y, Sinha AA.
Department of Dermatology, Weill Medical College of Cornell University, New York, NY.
Early studies of genetic susceptibility to pemphigus vulgaris (PV) showed associations between human leukocyte antigen (HLA) DR4 and DR6 and disease. The emergence of DNA sequencing techniques has implicated numerous DRB1 and DQB1 loci in various populations, leading to confusion regarding which exact alleles confer susceptibility. The strong linkage disequilibrium among DR and DQ HLA alleles further complicates the investigation of the true susceptibility loci. In this study, we report genotyping data for the largest sampling of North American Caucasian non-Jewish and Ashkenazi Jewish PV patients studied to date and compare our data with other population studies. To pinpoint true susceptibility, alleles among overrepresented sequences, we applied a step-wise reductionist analysis through (1) determination of the degree of linkage disequilibrium (LD) between purportedly associated alleles, (2) haplotype frequencies comparisons, and (3) primary sequence comparisons of disease-associated versus non-disease-associated alleles to identify crucial differences in amino acid residues in putative peptide binding pockets. Collectively, our data provide extended support for the hypothesis that the HLA associations in Caucasian PV patients map to DRB1*0402 and DQB1*0503 alone. Further structure-function studies will be required to define the exact mechanisms of HLA-mediated control of susceptibility and resistance to disease.
PMID: 16698434 [PubMed - in process]
Ann Hum Genet. 2006 May;70(Pt 3):350-9. Related Articles, Links
A comparison of individual genotyping and pooled DNA analysis for polymorphism validation prior to large-scale genetic studies.
Yang HC, Lin CH, Hung SI, Fann CS.
Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan 115.
Polymorphism validation is an important issue in genetic studies because only polymorphic markers provide useful information. We analyzed genetic data for 180 SNPs in the human major histocompatibility complex region in Caucasian and Taiwanese populations, and evaluated ethnic heterogeneity between these populations to illustrate the importance of polymorphism validation. An initial individual genotyping experiment (IGE) with 95 samples was compared with a DNA pooling allele-typing experiment (PAE) of 630 individuals for polymorphism validation based on authentic data sets. Afterwards, all samples were genotyped individually in a confirmation study. Under narrow (broad) polymorphism criteria, 24 (41) polymorphic SNPs in Caucasians could not be validated in the Taiwanese population, suggesting a 13% (23%) inconsistency rate and revealing a strong discrepancy between genetic backgrounds, probably due to ethnic heterogeneity. IGE yielded high sensitivity and specificity for polymorphism validation, but may be sensitive to sampling variation. PAE showed high sensitivity (97%) and specificity (100%) using a narrow polymorphism criterion, but reduced specificity (83%) using a broad criterion. Public domain polymorphism databases should therefore be used with caution and polymorphism validation should be performed routinely prior to conducting large-scale genetic studies. PAE is a cost-saving, reliable alternative to IGE for polymorphism validation, especially for a stringent polymorphism criterion.
-------------------- C. A. Winters Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
Not really, forensic anthropologists are helping police determine the identity of many murder victims everyday successfully.
^ For your supposition to be valid - forensics should ONLY be successful when populations can be structured racially, and should *fail* without social race catagories.
But that is not the case, of course.
In fact, Forensics are just as successful in homogeneous countries like Japan were murder victims would not be classified into distinct social races, BUT CAN JUST AS EASILY BE INDIVIDUALLY IDENTIFIED by forensics as in heterogeneous society.
Forensic identification of murder victims doesn't prove the existence of race.
quote:Winters: This is false. The fact that it can be used in multiracial societies to identify "races" support the idea that races exist.
Incorrect. That is a circular argument not a form of proof.
The fact that the forensics can identify individuals - it's principal function - without resorting to race falsifies this argument.
Most anthropologists have abandoned the concept of race as a research tool and as a valid representation of human biological diversity.
Yet, race identification continues to be one of the central foci of forensic anthropological casework and research.
It is maintained in this paper that the successful assignment of race to a skeletal specimen is not a vindication of the race concept, but merely a prediction that an individual, while alive was assigned to a particular socially constructed 'racial' category.
A specimen may display features that point to African ancestry.
In this country that person is likely to have been labeled Black *regardless of whether or not such a race actually exists in nature.*
Forensic classification into race is not per se proof of anything.
Moreover we have shown you examples of studies wherein forensic anthropology is objectively tested - and falsly assigns homogeneous groups into provably false racial catagories such as classifying Spanish as San Bushman, and Nubians as Japanese.
You have not responded to any of these studies, and the studies you do post, neither refute them, or prove the existence of races....or even CLAIM to prove the existence of races.
Posts: 15202 | Registered: Jun 2004
| IP: Logged |
quote:Polymorphism validation is an important issue in genetic studies because only polymorphic markers provide useful information. We analyzed genetic data for 180 SNPs in the human major histocompatibility complex region in Caucasian and Taiwanese populations, and evaluated ethnic heterogeneity between these populations to illustrate the importance of polymorphism validation
I take it you reposted this because you want us to believe that different lineages in "Caucasians" and Taiwanese prove the existence of race?
To test this theory all populations with different lineages would have to be classified into different races.
For example - Dravidians and Africans have *COMPLETELY DIFFERENT LINEAGES* and are more distant from one another genetically than are Chinese and Europeans.
So according to you - Dravidians and Africans are two different races? Correct?
Posts: 15202 | Registered: Jun 2004
| IP: Logged |
quote: I take it you reposted this because you want us to believe that different lineages in "Caucasians" and Taiwanese prove the existence of race?
To test this theory all populations with different lineages would have to be classified into different races.
For example - Dravidians and Africans have *COMPLETELY DIFFERENT LINEAGES* and are more distant from one another genetically than are Chinese and Europeans.
So according to you - Dravidians and Africans are two different races? Correct?
No Dravidians and Africans are of the same race. I have never read where the geneticists have claimed that the Dravidians were Caucasian. The literature makes it clear that they are also not classified as Eurasian.
So what race does the literature claim the Dravidians belong too?
Let's get back to the topic of this thread. You guys claim that racial terms are not used in the genetics literature. But I have presented papers to show that the concept of race is still being used by geneticists to define populations and individuals based on their haplotype and haplogroup. This research makes it clear that race is still a dominant research term used by geneticists, like other scientists.
If they continue to use the term caucasian, they are still discussing race.
posted
You want to see how accurate Forensic methodology is, see:
"Variation in racial classification represents the lack of a Spanish sample within the FORDISC 2.0 databases as well as the human variation inherent within them. Individual crania were classified according to the best fit with the existing samples of the database, but the samples clearly were inadequate to elucidate the specific geographical origin of the overall Spanish sample…some crania were classified into groups with no clear geographic or ancestral relationship with the Spanish sample…
The authors also agree that additional and more complete samples from different geographical regions and groups are needed to augment the existing databases."
quote:No Dravidians and Africans are of the same race.
..this claim contradicts your interpreation of the study you just posted twice now, since Dravidians have completely different SNP markers from Africans.
quote:I have never read where the geneticists have claimed that the Dravidians were Caucasian.
Cavelli Sforza has claimed this. But the point is they have completely different SNP markers than Africans - so you *must* classify them into different races according to your own 'reasoning'.....
Or admit that such classifications are invalid.
Choose one or the other, please.
quote:Let's get back to the topic of this thread.
I'm discussing the study on SNP markers that you posted twice, and how it inconsistent with your claims of races denoted by differentiated snp markers.
Now you want to change the subject.
Is that out of recognition of your own internal contradictions with regards to it?
quote:But I have presented papers to show that the concept of race is still being used
No you haven't. You presented papers that had terms in them that are associated with race. Most studies directly refuting the validity of race, have racial terms in them. I posted a study on racial classification on Spanish Crania filled with racial terms - and yet providing a devastating critique of the notion of classifying crania by race - which you have not refuted.
In contrast you have not posted any study directly claiming to prove the existence of race.
quote:If they continue to use the term caucasian, they are still discussing race.
No, because the valid ethnic term caucasian like mongolian predates the ideology of race typology, but more importantly...mere discussion of topic cannot be used as a form of proof of point.
There are scientific study on psychic healing, on dowsing, on UFo's and ESP...most of them discrediting the above.
Posts: 15202 | Registered: Jun 2004
| IP: Logged |
quote: o you haven't. You presented papers that had terms in them that are associated with race. Most studies directly refuting the validity of race, have racial terms in them. I posted a study on racial classification on Spanish Crania filled with racial terms - and yet providing a devastating critique of the notion of classifying crania by race - which you have not refuted.
In contrast you have not posted any study directly claiming to prove the existence of race.
quote:I have never read where the geneticists have claimed that the Dravidians were Caucasian.
Cavelli Sforza has claimed this. But the point is they have completely different SNP markers than Africans - so you *must* classify them into different races according to your own 'reasoning'.....
This is double speech. Use of the term caucasian means the authors of these articles believe different races exist, including Cavelli, if he said the Dravidians were caucasian. This falsifies your theory that scientist, especially geneticist no longer believe in race.
.
-------------------- C. A. Winters Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
This is double speech. Use of the term caucasian means the authors of these articles believe different races exist, including Cavelli, if he said the Dravidians were caucasian. This falsifies your theory that scientist, especially geneticist no longer believe in race.
It isn't the question of what an individual geneticist supposedly thinks, much less his/her double talk, but it is more of a question of what that individual can prove by arguing for the existence of discrete biological "races" in humans; it hasn't been done! If somebody has done so - let me know. I'll get on their case right away. Posts: 5964 | Registered: Jan 2005
| IP: Logged |
quote:Use of the term caucasian means the authors of these articles believe different races exist.
Not necessarily, but this comment is also irrelevant, since, as Supercar rightly noted, a proper assessment of scientific studies denotes what is or is not proven. Not your opinion of what somebody believes, which has no scientific value.
quote:Cavelli, if he said the Dravidians were caucasian. This falsifies your theory that scientist, especially geneticist no longer believe in race.
If I had such a theory pertaining to what all scientists 'believe in', it would certainly falsify it. But I don't. So your comment is moot.
As for Cavelli Sforza - he states correctly:
"Classification into race has proven to be a futile exercise".
Dr. Winters, your views of race provide a case in point:
You post a study intending to show us that differences in SNP markers in Caucasians and Taiwanese proves the existence of race [note: not actually what the study itself asserts],
You then completely contradict yourself by denying that difference in SNP markers between Africans and Dravidians can be used to prove they belong to different "races".
This is a clear contradiction in your discourse and it lends credence to Sforza's statement on the futility of said classifications.
And no, your opinion of Sforza's beliefs - in race - in religion - in politics, etc.. doesn't matter.
What matters is that his statement was factual, and you confirmed it.
Posts: 15202 | Registered: Jun 2004
| IP: Logged |
quote:Originally posted by Supercar: You want to see how accurate Forensic methodology is, see:
"Variation in racial classification represents the lack of a Spanish sample within the FORDISC 2.0 databases as well as the human variation inherent within them. Individual crania were classified according to the best fit with the existing samples of the database, but the samples clearly were inadequate to elucidate the specific geographical origin of the overall Spanish sample…some crania were classified into groups with no clear geographic or ancestral relationship with the Spanish sample…
The authors also agree that additional and more complete samples from different geographical regions and groups are needed to augment the existing databases."
^ Dr. Winters, rather than talk around the above, if you disagree with it please refute it directly in the following manner.
1) show us that different SNP markers can be used to systematically classify populations into races.
2) list the geneticist who support this theory with direct, clear statements to the effect that this is so.
3) present a study classifying Dravidians and Africans into a distinct race based upon specific SNP markers.
The subject of this thread is does race exist. It was originally claimed that race does not exist based on Templeton:
quote:
"Race is a real cultural, political and economic concept in society, but it is not a biological concept, and that unfortunately is what many people wrongfully consider to be the essence of race in humans -- genetic differences," Templeton said. "Evolutionary history is the key to understanding race, and new molecular biology techniques offer so much on recent evolutionary history. I wanted to bring some objectivity to the topic. This very objective analysis shows the outcome is not even a close call: There's nothing even like a really distinct subdivision of humanity."
1)I have shown that this is untrue. I presented evidence that Forensic scientists continue to use "race" as a way to classify humans
2) I have presented evidence that even geneticist use race when discussing the haplotype and haplogroup of individuals and populations.
These facts indicate that Templeton is wrong scientist still recognize a distinct subdivision of humanity.
In your post on the Templeton statement that guides this thread you claim that it can only be refuted by answering the following questions:
Rasol
quote: 1) show us that different SNP markers can be used to systematically classify populations into races.
2) list the geneticist who support this theory with direct, clear statements to the effect that this is so.
3) present a study classifying Dravidians and Africans into a distinct race based upon specific SNP markers.
[/B]
But this is uncessary because they were not part of Templeton's statement. Bu I will answer them anyway.
1) show us that different SNP markers can be used to systematically classify populations into races.
It is not necessary to provide any specific SNP markers used to systematically classify populations into races. Research studies published by geneticists clearly indicate that they continue to use race to describe poulations in the research literature as I have pointed out in previous post that I will repose below.
[/b]
: Hum Immunol. 2006 Jan-Feb;67(1-2):73-84. Epub 2006 Apr 5. Related Articles, Links The haplotype structure of the human major histocompatibility complex.Alper CA, Larsen CE, Dubey DP, Awdeh ZL, Fici DA, Yunis EJ.CBR Institute for Biomedical Research, Boston, MA 02115, USA; Department of Pediatrics, Harvard Medical School, Boston, MA 02115, USA.There is great interest in the use of single-nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) analysis to localize human disease genes. The results suggest that the human genome, including the major histocompatibility complex (MHC), consists largely of 5- to 200-kb blocks of sequence fixity between which random recombination occurs. Direct determination of MHC haplotypes from family studies also demonstrates similar-sized blocks, but otherwise gives a very different picture, with a third to a half of Caucasian haplotypes fixed from HLA-B to HLA-DR/DQ (at least 1 Mb) as conserved extended haplotypes (CEHs), some of which encompass more than 3 Mb. These fixed haplotypes differ in frequency both in different Caucasian subpopulations and in Caucasian patients with HLA-associated diseases, complicating disease susceptibility gene localization. The inherent inability of LD analysis to "see" DNA fixity beyond three markers contributes to the failure of SNP/LD analysis to define in detail or even detect CEHs in the MHC and probably elsewhere in the genome. More importantly, the use of statistical analysis, rather than direct haplotype determination and counting, fails to reveal the details of haplotype structure essential for gene localization. Given the oversimplified picture of the MHC (and probably the rest of the genome) provided only by SNP/LD-defined blocks, it is questionable whether this approach will be of great help in disease susceptibility gene localization or identification.
Br J Haematol. 1997 Aug;98(2):356-64. Related Articles, Links
Specificity and sensitivity of RHD genotyping methods by PCR-based DNA amplification.
Aubin JT, Le Van Kim C, Mouro I, Colin Y, Bignozzi C, Brossard Y, Cartron JP.
Centre d'Hemobiologie Perinale, Paris, France.
We have compared the sensitivity and specificity of four PCR methods of RHD gene detection using different sets of primers located in the regions of highest divergence between the RHD and RHCE genes, notably exon 10 (method I), exon 7 (method II), exon 4 (method III) and intron 4 (method IV). Methods I-III were the most sensitive and gave a detectable signal with D-pos/D-neg mixtures containing only 0.001% D-positive cells. Moreover, method II could detect the equivalent DNA amount present in only three nucleated cells in the assay without hybridization of PCR products, whereas the sensitivity of the other methods was 10-50 times less. Investigation of D variants indicated that false-negative results were obtained with method II (D(IVb) variant), method III (D(VI) and DFR variants) and method IV (D(VI) variants), but not method I. Weak D (D(u)) was correctly detected as D-positive by all methods, but most cases of Rh(null) appeared as false-positives, as they carry normal RH genes that are not phenotypically expressed. Some false-positive results were obtained with method I in a few Caucasian DNA samples serotyped as RhD-neg but carrying a C- or E-allele, whereas a high incidence of false-positives was found among non-Caucasian Rh-negative samples by all methods. In the Caucasian population, however, we found a full correlation between the predicted genotype and observed phenotype at birth of 92 infants. Although we routinely use the four methods for RHD genotyping, a PCR strategy based on at least two methods is recommended.
Hum Immunol. 2006 Jan-Feb;67(1-2):125-39. Epub 2005 Nov 4. Related Articles, Links
Disease Relevant HLA Class II Alleles Isolated by Genotypic, Haplotypic, and Sequence Analysis in North American Caucasians With Pemphigus Vulgaris.
Lee E, Lendas KA, Chow S, Pirani Y, Gordon D, Dionisio R, Nguyen D, Spizuoco A, Fotino M, Zhang Y, Sinha AA.
Department of Dermatology, Weill Medical College of Cornell University, New York, NY.
Early studies of genetic susceptibility to pemphigus vulgaris (PV) showed associations between human leukocyte antigen (HLA) DR4 and DR6 and disease. The emergence of DNA sequencing techniques has implicated numerous DRB1 and DQB1 loci in various populations, leading to confusion regarding which exact alleles confer susceptibility. The strong linkage disequilibrium among DR and DQ HLA alleles further complicates the investigation of the true susceptibility loci. In this study, we report genotyping data for the largest sampling of North American Caucasian non-Jewish and Ashkenazi Jewish PV patients studied to date and compare our data with other population studies. To pinpoint true susceptibility, alleles among overrepresented sequences, we applied a step-wise reductionist analysis through (1) determination of the degree of linkage disequilibrium (LD) between purportedly associated alleles, (2) haplotype frequencies comparisons, and (3) primary sequence comparisons of disease-associated versus non-disease-associated alleles to identify crucial differences in amino acid residues in putative peptide binding pockets. Collectively, our data provide extended support for the hypothesis that the HLA associations in Caucasian PV patients map to DRB1*0402 and DQB1*0503 alone. Further structure-function studies will be required to define the exact mechanisms of HLA-mediated control of susceptibility and resistance to disease.
PMID: 16698434 [PubMed - in process]
Ann Hum Genet. 2006 May;70(Pt 3):350-9. Related Articles, Links
A comparison of individual genotyping and pooled DNA analysis for polymorphism validation prior to large-scale genetic studies.
Yang HC, Lin CH, Hung SI, Fann CS.
Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan 115.
Polymorphism validation is an important issue in genetic studies because only polymorphic markers provide useful information. We analyzed genetic data for 180 SNPs in the human major histocompatibility complex region in Caucasian and Taiwanese populations, and evaluated ethnic heterogeneity between these populations to illustrate the importance of polymorphism validation. An initial individual genotyping experiment (IGE) with 95 samples was compared with a DNA pooling allele-typing experiment (PAE) of 630 individuals for polymorphism validation based on authentic data sets. Afterwards, all samples were genotyped individually in a confirmation study. Under narrow (broad) polymorphism criteria, 24 (41) polymorphic SNPs in Caucasians could not be validated in the Taiwanese population, suggesting a 13% (23%) inconsistency rate and revealing a strong discrepancy between genetic backgrounds, probably due to ethnic heterogeneity. IGE yielded high sensitivity and specificity for polymorphism validation, but may be sensitive to sampling variation. PAE showed high sensitivity (97%) and specificity (100%) using a narrow polymorphism criterion, but reduced specificity (83%) using a broad criterion. Public domain polymorphism databases should therefore be used with caution and polymorphism validation should be performed routinely prior to conducting large-scale genetic studies. PAE is a cost-saving, reliable alternative to IGE for polymorphism validation, especially for a stringent polymorphism criterion.
2) list the geneticist who support this theory with direct, clear statements to the effect that this is so.
This question was already answered above when I provided the published papers where racial terms such as caucasian is frequently used for the "white'" race. Use of the term caucasian is a clear statement to the effect race continues to play a role in the research of geneticists as proven by the papers discussed above.
3) present a study classifying Dravidians and Africans into a distinct race based upon specific SNP markers.
You already mentioned one the Cavelli Sforza study.
Clyde Winters [quote]:I have never read where the geneticists have claimed that the Dravidians were Caucasian.
Rasol
quote: Cavelli Sforza has claimed this.
Since Sforza classifies the Dravidians as caucasian proves that geneticists use racial terms to describe populations. It refutes Templeton's claim that
quote:
"Race is a real cultural, political and economic concept in society, but it is not a biological concept, and that unfortunately is what many people wrongfully consider to be the essence of race in humans -- genetic differences," Templeton said. "Evolutionary history is the key to understanding race, and new molecular biology techniques offer so much on recent evolutionary history. I wanted to bring some objectivity to the topic. This very objective analysis shows the outcome is not even a close call: There's nothing even like a really distinct subdivision of humanity."
If their is no distinct subdivision of humanity why do geneticists continue to use racial terms in their research and even Sforza call the Dravidians caucasians?
.
-------------------- C. A. Winters Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
quote:Originally posted by Clyde Winters: The subject of this thread is does race exist. It was originally claimed that race does not exist based on Templeton:
quote:
Templeton: "Race is a real cultural, political and economic concept in society, it is not a biological concept, and that unfortunately is what many people wrongfully consider to be the essence of race in humans -- genetic differences," Templeton said. "Evolutionary history is the key to understanding race, and new molecular biology techniques offer so much on recent evolutionary history. I wanted to bring some objectivity to the topic. This very objective analysis shows the outcome is not even a close call: There's nothing even like a really distinct subdivision of humanity."
Yes geneticist Templeton's statement is correct.
quote:1)Winters: I have shown that this is untrue.
No you have not addessed it in anyway.
quote:Winters: I presented evidence that Forensic scientists continue to use "race" as a way to classify humans
1) Templeton does not claim otherwise so that does not refute him.
2) We've shown you three different studies from Forensic scientists falsifying your claim that classification into races can be validated thru forensics. You have not addresses these studies; presented any studies refuting them, or presenting any studies directly supporting your position.
quote: These facts indicate that Templeton is wrong scientist still recognize a distinct subdivision of humanity.
Incorrect - biology recognises only 1 division of humanity - homo sapiens, there are no sub-divisions. You have presented no scientific study claiming sub-divisions of humanity.
Templeton is correct, and you have presented no evidence of anything, and refute nothing.
Posts: 15202 | Registered: Jun 2004
| IP: Logged |
quote:Rasol asks: 1) show us that different SNP markers can be used to systematically classify populations into races.
2) list the geneticist who support this theory with direct, clear statements to the effect that this is so.
3) present a study classifying Dravidians and Africans into a distinct race based upon specific SNP markers.
quote:Winters: But this is uncessary because they were not part of Templeton's statement.
It is necessary because the study on SNP markers is part of *your statement.*
quote:It is not necessary to provide any specific SNP markers used to systematically classify populations into races.
I asked you to prove that you could do so, because you presented a study on SNP markers as 'evidence.'
Instead you make excuses for why you cannot.
But if you can't or won't do so - then the study you presented on SNP markers cannot be used to support your argument.
Strike 1.
quote:Winters: Research studies published by geneticists clearly indicate that they continue to use race to describe populations
Again: Mere use of folk ethnic or racial labels does not scientifically validate race.
Such labels are ** used ** specifically in studies that conclude that race is invalid, and most importantly - this statement by you does not address my question about SNP markers.
Strike 2.
quote: in the research literature as I have pointed out in previous post that I will repose below.
Reposting the material that led to my question is not answering the question.
Strike 3.
Moving on....
quote:rasol: 2) list the geneticist who support this theory with direct, clear statements to the effect that this is so.
quote:This question was already answered above when I provided the published papers where racial terms such as caucasian is frequently used for the "white'" race.
False statement - as there is no clear direct statement supporting race by any geneticist in those studies.
I use the term caucasian and white - that is not proof that SNP markers define races...a non-sequitur conclusion. Strike 1
quote:Winters: Use of the term caucasian is a clear statement to the effect race
Redundant and non-sequitur, strike 2.
quote: continues to play a role in the research of geneticists as proven by the papers discussed above.
Let's remind everyone of the question you are supposidly answering: show us that different SNP markers can be used to systematically classify populations into races.
Have you shown us this, no you haven't. Strike 3.
quote:rasol 3) present a study classifying Dravidians and Africans into a distinct race based upon specific SNP markers.
quote:Winters: You already mentioned one the Cavelli Sforza study.
No - Sforza does not classify Dravidians and Africans into the same race.
quote:Since Sforza classifies the Dravidians as caucasian proves that geneticists use racial terms to describe populations. It refutes Templeton's claim.
Sforza also refers to Afro-Asiatic language as caucasian. Whatever it says about Sforza, it is completely irrelevant to what Templeton stated, and it is equally irrelevant to my three questions - none of which you ever did get around to answering.
Posts: 15202 | Registered: Jun 2004
| IP: Logged |
Sforza also refers to Afro-Asiatic language as caucasian. Whatever it says about Sforza, it is completely irrelevant to what Templeton stated, and it is equally irrelevant to my three questions - none of which you ever did get around to answering.
Here you are wrong. The comments of Sforza are relevant to this discussion.It was Sforza who first began the association of genetics with population movements.
If Sforza is mainly concerned with "race", and he is the originator of the use of this science in anthropology, it is clear that Templetons statement about the absence of race on a genetic level is pure hogwash. Templeton is refuted by Sforza and other geneticists who use racial terms in their research.
[/b]
: Hum Immunol. 2006 Jan-Feb;67(1-2):73-84. Epub 2006 Apr 5. Related Articles, Links The haplotype structure of the human major histocompatibility complex.Alper CA, Larsen CE, Dubey DP, Awdeh ZL, Fici DA, Yunis EJ.CBR Institute for Biomedical Research, Boston, MA 02115, USA; Department of Pediatrics, Harvard Medical School, Boston, MA 02115, USA.There is great interest in the use of single-nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) analysis to localize human disease genes. The results suggest that the human genome, including the major histocompatibility complex (MHC), consists largely of 5- to 200-kb blocks of sequence fixity between which random recombination occurs. Direct determination of MHC haplotypes from family studies also demonstrates similar-sized blocks, but otherwise gives a very different picture, with a third to a half of Caucasian haplotypes fixed from HLA-B to HLA-DR/DQ (at least 1 Mb) as conserved extended haplotypes (CEHs), some of which encompass more than 3 Mb. These fixed haplotypes differ in frequency both in different Caucasian subpopulations and in Caucasian patients with HLA-associated diseases, complicating disease susceptibility gene localization. The inherent inability of LD analysis to "see" DNA fixity beyond three markers contributes to the failure of SNP/LD analysis to define in detail or even detect CEHs in the MHC and probably elsewhere in the genome. More importantly, the use of statistical analysis, rather than direct haplotype determination and counting, fails to reveal the details of haplotype structure essential for gene localization. Given the oversimplified picture of the MHC (and probably the rest of the genome) provided only by SNP/LD-defined blocks, it is questionable whether this approach will be of great help in disease susceptibility gene localization or identification.
Br J Haematol. 1997 Aug;98(2):356-64. Related Articles, Links
Specificity and sensitivity of RHD genotyping methods by PCR-based DNA amplification.
Aubin JT, Le Van Kim C, Mouro I, Colin Y, Bignozzi C, Brossard Y, Cartron JP.
Centre d'Hemobiologie Perinale, Paris, France.
We have compared the sensitivity and specificity of four PCR methods of RHD gene detection using different sets of primers located in the regions of highest divergence between the RHD and RHCE genes, notably exon 10 (method I), exon 7 (method II), exon 4 (method III) and intron 4 (method IV). Methods I-III were the most sensitive and gave a detectable signal with D-pos/D-neg mixtures containing only 0.001% D-positive cells. Moreover, method II could detect the equivalent DNA amount present in only three nucleated cells in the assay without hybridization of PCR products, whereas the sensitivity of the other methods was 10-50 times less. Investigation of D variants indicated that false-negative results were obtained with method II (D(IVb) variant), method III (D(VI) and DFR variants) and method IV (D(VI) variants), but not method I. Weak D (D(u)) was correctly detected as D-positive by all methods, but most cases of Rh(null) appeared as false-positives, as they carry normal RH genes that are not phenotypically expressed. Some false-positive results were obtained with method I in a few Caucasian DNA samples serotyped as RhD-neg but carrying a C- or E-allele, whereas a high incidence of false-positives was found among non-Caucasian Rh-negative samples by all methods. In the Caucasian population, however, we found a full correlation between the predicted genotype and observed phenotype at birth of 92 infants. Although we routinely use the four methods for RHD genotyping, a PCR strategy based on at least two methods is recommended.
Hum Immunol. 2006 Jan-Feb;67(1-2):125-39. Epub 2005 Nov 4. Related Articles, Links
Disease Relevant HLA Class II Alleles Isolated by Genotypic, Haplotypic, and Sequence Analysis in North American Caucasians With Pemphigus Vulgaris.
Lee E, Lendas KA, Chow S, Pirani Y, Gordon D, Dionisio R, Nguyen D, Spizuoco A, Fotino M, Zhang Y, Sinha AA.
Department of Dermatology, Weill Medical College of Cornell University, New York, NY.
Early studies of genetic susceptibility to pemphigus vulgaris (PV) showed associations between human leukocyte antigen (HLA) DR4 and DR6 and disease. The emergence of DNA sequencing techniques has implicated numerous DRB1 and DQB1 loci in various populations, leading to confusion regarding which exact alleles confer susceptibility. The strong linkage disequilibrium among DR and DQ HLA alleles further complicates the investigation of the true susceptibility loci. In this study, we report genotyping data for the largest sampling of North American Caucasian non-Jewish and Ashkenazi Jewish PV patients studied to date and compare our data with other population studies. To pinpoint true susceptibility, alleles among overrepresented sequences, we applied a step-wise reductionist analysis through (1) determination of the degree of linkage disequilibrium (LD) between purportedly associated alleles, (2) haplotype frequencies comparisons, and (3) primary sequence comparisons of disease-associated versus non-disease-associated alleles to identify crucial differences in amino acid residues in putative peptide binding pockets. Collectively, our data provide extended support for the hypothesis that the HLA associations in Caucasian PV patients map to DRB1*0402 and DQB1*0503 alone. Further structure-function studies will be required to define the exact mechanisms of HLA-mediated control of susceptibility and resistance to disease.
PMID: 16698434 [PubMed - in process]
Ann Hum Genet. 2006 May;70(Pt 3):350-9. Related Articles, Links
A comparison of individual genotyping and pooled DNA analysis for polymorphism validation prior to large-scale genetic studies.
Yang HC, Lin CH, Hung SI, Fann CS.
Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan 115.
Polymorphism validation is an important issue in genetic studies because only polymorphic markers provide useful information. We analyzed genetic data for 180 SNPs in the human major histocompatibility complex region in Caucasian and Taiwanese populations, and evaluated ethnic heterogeneity between these populations to illustrate the importance of polymorphism validation. An initial individual genotyping experiment (IGE) with 95 samples was compared with a DNA pooling allele-typing experiment (PAE) of 630 individuals for polymorphism validation based on authentic data sets. Afterwards, all samples were genotyped individually in a confirmation study. Under narrow (broad) polymorphism criteria, 24 (41) polymorphic SNPs in Caucasians could not be validated in the Taiwanese population, suggesting a 13% (23%) inconsistency rate and revealing a strong discrepancy between genetic backgrounds, probably due to ethnic heterogeneity. IGE yielded high sensitivity and specificity for polymorphism validation, but may be sensitive to sampling variation. PAE showed high sensitivity (97%) and specificity (100%) using a narrow polymorphism criterion, but reduced specificity (83%) using a broad criterion. Public domain polymorphism databases should therefore be used with caution and polymorphism validation should be performed routinely prior to conducting large-scale genetic studies. PAE is a cost-saving, reliable alternative to IGE for polymorphism validation, especially for a stringent polymorphism criterion.
.
-------------------- C. A. Winters Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
Re-spamming the posts on SNP studies that I asked you the questions about, is also not answering the questions.
I'm still waiting......
I answered the questions earlier. The issue is not SNP studies. The thread theme is "Race dosen't exist. It is clear that race does exist as a concept in genetic studies. Below they are repeated.
1) show us that different SNP markers can be used to systematically classify populations into races. [/b]
It is not necessary to provide any specific SNP markers used to systematically classify populations into races. Research studies published by geneticists clearly indicate that they continue to use race to describe poulations in the research literature as I have pointed out in previous post that I will repose below.
[/b]
: Hum Immunol. 2006 Jan-Feb;67(1-2):73-84. Epub 2006 Apr 5. Related Articles, Links The haplotype structure of the human major histocompatibility complex.Alper CA, Larsen CE, Dubey DP, Awdeh ZL, Fici DA, Yunis EJ.CBR Institute for Biomedical Research, Boston, MA 02115, USA; Department of Pediatrics, Harvard Medical School, Boston, MA 02115, USA.There is great interest in the use of single-nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) analysis to localize human disease genes. The results suggest that the human genome, including the major histocompatibility complex (MHC), consists largely of 5- to 200-kb blocks of sequence fixity between which random recombination occurs. Direct determination of MHC haplotypes from family studies also demonstrates similar-sized blocks, but otherwise gives a very different picture, with a third to a half of Caucasian haplotypes fixed from HLA-B to HLA-DR/DQ (at least 1 Mb) as conserved extended haplotypes (CEHs), some of which encompass more than 3 Mb. These fixed haplotypes differ in frequency both in different Caucasian subpopulations and in Caucasian patients with HLA-associated diseases, complicating disease susceptibility gene localization. The inherent inability of LD analysis to "see" DNA fixity beyond three markers contributes to the failure of SNP/LD analysis to define in detail or even detect CEHs in the MHC and probably elsewhere in the genome. More importantly, the use of statistical analysis, rather than direct haplotype determination and counting, fails to reveal the details of haplotype structure essential for gene localization. Given the oversimplified picture of the MHC (and probably the rest of the genome) provided only by SNP/LD-defined blocks, it is questionable whether this approach will be of great help in disease susceptibility gene localization or identification.
Br J Haematol. 1997 Aug;98(2):356-64. Related Articles, Links
Specificity and sensitivity of RHD genotyping methods by PCR-based DNA amplification.
Aubin JT, Le Van Kim C, Mouro I, Colin Y, Bignozzi C, Brossard Y, Cartron JP.
Centre d'Hemobiologie Perinale, Paris, France.
We have compared the sensitivity and specificity of four PCR methods of RHD gene detection using different sets of primers located in the regions of highest divergence between the RHD and RHCE genes, notably exon 10 (method I), exon 7 (method II), exon 4 (method III) and intron 4 (method IV). Methods I-III were the most sensitive and gave a detectable signal with D-pos/D-neg mixtures containing only 0.001% D-positive cells. Moreover, method II could detect the equivalent DNA amount present in only three nucleated cells in the assay without hybridization of PCR products, whereas the sensitivity of the other methods was 10-50 times less. Investigation of D variants indicated that false-negative results were obtained with method II (D(IVb) variant), method III (D(VI) and DFR variants) and method IV (D(VI) variants), but not method I. Weak D (D(u)) was correctly detected as D-positive by all methods, but most cases of Rh(null) appeared as false-positives, as they carry normal RH genes that are not phenotypically expressed. Some false-positive results were obtained with method I in a few Caucasian DNA samples serotyped as RhD-neg but carrying a C- or E-allele, whereas a high incidence of false-positives was found among non-Caucasian Rh-negative samples by all methods. In the Caucasian population, however, we found a full correlation between the predicted genotype and observed phenotype at birth of 92 infants. Although we routinely use the four methods for RHD genotyping, a PCR strategy based on at least two methods is recommended.
Hum Immunol. 2006 Jan-Feb;67(1-2):125-39. Epub 2005 Nov 4. Related Articles, Links
Disease Relevant HLA Class II Alleles Isolated by Genotypic, Haplotypic, and Sequence Analysis in North American Caucasians With Pemphigus Vulgaris.
Lee E, Lendas KA, Chow S, Pirani Y, Gordon D, Dionisio R, Nguyen D, Spizuoco A, Fotino M, Zhang Y, Sinha AA.
Department of Dermatology, Weill Medical College of Cornell University, New York, NY.
Early studies of genetic susceptibility to pemphigus vulgaris (PV) showed associations between human leukocyte antigen (HLA) DR4 and DR6 and disease. The emergence of DNA sequencing techniques has implicated numerous DRB1 and DQB1 loci in various populations, leading to confusion regarding which exact alleles confer susceptibility. The strong linkage disequilibrium among DR and DQ HLA alleles further complicates the investigation of the true susceptibility loci. In this study, we report genotyping data for the largest sampling of North American Caucasian non-Jewish and Ashkenazi Jewish PV patients studied to date and compare our data with other population studies. To pinpoint true susceptibility, alleles among overrepresented sequences, we applied a step-wise reductionist analysis through (1) determination of the degree of linkage disequilibrium (LD) between purportedly associated alleles, (2) haplotype frequencies comparisons, and (3) primary sequence comparisons of disease-associated versus non-disease-associated alleles to identify crucial differences in amino acid residues in putative peptide binding pockets. Collectively, our data provide extended support for the hypothesis that the HLA associations in Caucasian PV patients map to DRB1*0402 and DQB1*0503 alone. Further structure-function studies will be required to define the exact mechanisms of HLA-mediated control of susceptibility and resistance to disease.
PMID: 16698434 [PubMed - in process]
Ann Hum Genet. 2006 May;70(Pt 3):350-9. Related Articles, Links
A comparison of individual genotyping and pooled DNA analysis for polymorphism validation prior to large-scale genetic studies.
Yang HC, Lin CH, Hung SI, Fann CS.
Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan 115.
Polymorphism validation is an important issue in genetic studies because only polymorphic markers provide useful information. We analyzed genetic data for 180 SNPs in the human major histocompatibility complex region in Caucasian and Taiwanese populations, and evaluated ethnic heterogeneity between these populations to illustrate the importance of polymorphism validation. An initial individual genotyping experiment (IGE) with 95 samples was compared with a DNA pooling allele-typing experiment (PAE) of 630 individuals for polymorphism validation based on authentic data sets. Afterwards, all samples were genotyped individually in a confirmation study. Under narrow (broad) polymorphism criteria, 24 (41) polymorphic SNPs in Caucasians could not be validated in the Taiwanese population, suggesting a 13% (23%) inconsistency rate and revealing a strong discrepancy between genetic backgrounds, probably due to ethnic heterogeneity. IGE yielded high sensitivity and specificity for polymorphism validation, but may be sensitive to sampling variation. PAE showed high sensitivity (97%) and specificity (100%) using a narrow polymorphism criterion, but reduced specificity (83%) using a broad criterion. Public domain polymorphism databases should therefore be used with caution and polymorphism validation should be performed routinely prior to conducting large-scale genetic studies. PAE is a cost-saving, reliable alternative to IGE for polymorphism validation, especially for a stringent polymorphism criterion.
2) list the geneticist who support this theory with direct, clear statements to the effect that this is so.
This question was already answered above when I provided the published papers where racial terms such as caucasian is frequently used for the "white'" race. Use of the term caucasian is a clear statement to the effect race continues to play a role in the research of geneticists as proven by the papers discussed above.
3) present a study classifying Dravidians and Africans into a distinct race based upon specific SNP markers.
You already mentioned one the Cavelli Sforza study.
Clyde Winters
quote::I have never read where the geneticists have claimed that the Dravidians were Caucasian.
Rasol
quote: Cavelli Sforza has claimed this.
Since Sforza classifies the Dravidians as caucasian proves that geneticists use racial terms to describe populations. It refutes Templeton's claim that
quote:
"Race is a real cultural, political and economic concept in society, but it is not a biological concept, and that unfortunately is what many people wrongfully consider to be the essence of race in humans -- genetic differences," Templeton said. "Evolutionary history is the key to understanding race, and new molecular biology techniques offer so much on recent evolutionary history. I wanted to bring some objectivity to the topic. This very objective analysis shows the outcome is not even a close call: There's nothing even like a really distinct subdivision of humanity."
If their is no distinct subdivision of humanity why do geneticists continue to use racial terms in their research and even Sforza call the Dravidians and Afro-Asian speakers caucasians?
posted
^ My opinion of Sforza's non-scientific and inappropriate use of the term caucasian, properly a folk ethnicity define as follows -
Of or relating to the Caucasus region or its peoples, languages, or cultures. Of or relating to a group of three language families spoken in the region of the Caucasus mountains, including Chechen, Abkhaz, and the Kartvelian languages.
...is that it reflects his ideological need to keep Europeans united via racial euphemisms.
Sforza does not define caucasian, culturally, or linguistically and certainly not genetically.
He also does not use the term Negro.
Sforza has been criticised by other scholars in this respect for being somewhat biased conceptually, and even [it is implied], hypocritical.
However - whether Sforza is or is not a hypocrite, or biased, or personally does or does not believe in race or devil worship- is irrelevant to what he claims is proven via genetics.
Sforza does not claim that populations can be sub-divided into races. He specifically concurs with Templeton in this regard.
They both agree with each other here, and they both refute you.
So you have no support for your views from any geneticist.
Posts: 15202 | Registered: Jun 2004
| IP: Logged |
-------------------------------------------------------------------------------- ^ My opinion of Sforza's non-scientific and inappropriate use of the term caucasian, properly a folk ethnicity define as follows -
Of or relating to the Caucasus region or its peoples, languages, or cultures. Of or relating to a group of three language families spoken in the region of the Caucasus mountains, including Chechen, Abkhaz, and the Kartvelian languages.
...is that it reflects his ideological need to keep Europeans united via racial euphemisms.
Sforza does not define caucasian, culturally, or linguistically and certainly not genetically.
He also does not use the term Negro.
Sforza has been criticised by other scholars in this respect for being somewhat biased conceptually, and even [it is implied], hypocritical.
However - whether Sforza is or is not a hypocrite, or biased, or personally does or does not believe in race or devil worship- is irrelevant to what he claims is proven via genetics.
Sforza does not claim that populations can be sub-divided into races. He specifically concurs with Templeton in this regard.
This is double speech. Sforza can not be said to avoid the division of mankind into races, when he specifically says the Afro-Asiatic speakers and Dravidian speakers are caucasian.
Use of these terms by Sforza, show that the founder of genetic-anthropology was a major proponent of race. Theis makes it clear that my proposition has not been refuted.
[Quote]
-------------------------------------------------------------------------------- Rasol asks: 1) show us that different SNP markers can be used to systematically classify populations into races.
Forensic value of the multicopy Y-STR marker DYS464
John M. Butler * , Richard Schoske 1 Biotechnology Division, National Institute of Standards and Technology, Gaithersburg, MD, USA Abstract. The tetranucleotide Y-chromosome short tandem repeat (Y-STR) marker, DYS464, first reported by Redd et al. [Forensic Sci. Int. 130 (2002) 97] appears to be the most polymorphic Y-STR marker discovered to date. A single primer pair can generate up to four distinct peaks over an allele range of 9–20 repeats. Allele calls can be made based on peaks that are present (conservative approach; C-type) or a combination of alleles and peak height ratios (expanded typing method; E- type). We have observed 113 C-types and 179 E-types in 679 males from three US populations. D 2003 Elsevier B.V. All rights reserved. Keywords: Y-STR; Y-chromosome; DYS464; Multicopy loci; DNA typing 1. Introduction DYS464 occurs at least four times in the highly palindromic region near the center of the long arm of the Y-chromosome [1–3]. In forensic casework applications where the amount of typable DNA material may be limited, the use of highly polymorphic markers is advantageous in order to limit the number of markers needed to distinguish unrelated individuals. 2. Materials and methods A total of 679 unique male DNA samples from three different US populations [4] were typed with DYS464 along with 21 additional Y-chromosome short tandem repeat (Y-STR) markers [3]. Only the DYS464 results are described in this report. Two novel DYS464 primer pairs, which differ from those originally described by Redd et al. [2], were used. 0531-5131/ D 2003 Elsevier B.V. All rights reserved. doi:10.1016/S0531-5131(03)01713-8 $ Points of view are those of the authors and do not necessarily represent the position of the US Departments of Justice or Defense. Certain commercial equipment, instruments, and materials are identified in order to specify experimental procedures as completely as possible. In no case does such identification imply a recommendation or endorsement by the National Institute of Standards and Technology, nor does it imply that any of the materials, instruments, or equipment identified are necessarily the best available for the purpose. * Corresponding author. Tel.: +1-301-975-4049; fax: +1-301-975-8505. E-mail address: john.butler@nist.gov (J.M. Butler). 1 Current address: Armed Forces Institute of Pathology, Washington, DC, USA. www.ics-elsevier.com International Congress Series 1261 (2004) 278–280
Page 2 The primers VIC-CTTTGGGCTATGCCTCAGTTT and GCCATACCTGGGTAACAGA- GAGAC produce green-labeled amplicons in the size range of 242–286 bp for DYS464 alleles 9–20, while the primers 6FAM-AGTTTACGAGCTTTGGGCTATG and GTGGCAAGATCTCATTTCTTCAA generate blue dye-labeled polymerase chain reac- tion (PCR) products that are 327–367 bp in size. PCR conditions are as previously described for the Y-STR 20plex [5]. An allelic ladder was created for DYS464 (Fig. 1), which contains all of the major alleles as well as single-base variants observed in our population study [3]. 3. Results and discussion We observed 179 expanded types with DYS464 in 679 male samples from three different US population sets: 265 African–Americans, 262 Caucasians, and 152 His- panics. The addition of peak height information (E-type) to just allele calls (C-type) can result in an expansion in the number of types observed (e.g., Fig. 2). The most common types are 15,15,17,17, which occurs in 10.6% of this data set, and 15,15,16,17, which occurs in 7.5%. All other DYS464 types are found at less than the 5% level, with over half of the observed types occurring only once (92 of 179 observed). If the DYS464 data are collapsed to C-types (conservative typing method), then 113 allele calls are observed in these 679 males. By way of comparison to other DNA typing markers in the same data set, DYS385 exhibited only 56 different types and FGA, the single best autosomal STR examined, had only 78 different genotypes. Furthermore, the four single-copy Y-STRs DYS19, DYS391, DYS392, and DYS393, when combined, only produced 93 different Fig. 1. NIST allelic ladder for DYS464 produced from eight different DNA samples. The variant alleles 14.3, 15.1, and 15.3 are helpful as a tool for measuring single-base resolution in electrophoretic systems. Fig. 2. Example of four samples with the same conservative DYS464 type, 14,15,18, which can be separated from one another by considering their expanded type through peak height variation. J.M. Butler, R. Schoske / International Congress Series 1261 (2004) 278–280 279
Page 3 haplotypes. Thus, DYS464 is more polymorphic than DYS385, the previously considered best multicopy Y-STR, and four single-copy Y-STRs in combination. A human Y- chromosome DNA profiling standard, NIST Standard Reference Material (SRM) 2395, is available and contains DYS464 information on its five male samples (see http:// www.nist.gov/srm). This SRM will enable laboratories worldwide to accurately calibrate their DYS464 typing results. Acknowledgements This work was supported by research funds from the US National Institute of Justice through Interagency Agreement 1999-IJ-R-094 with the NIST Office of Law Enforcement Standards. Much of this work was performed while R.S. was a graduate student at the NIST and the American University through funding from the US Air Force. The technical assistance and suggestions of Peter Vallone, David Duewer, Margaret Kline, and Jan Redman from our group at the NIST and Alan Redd from the University of Arizona are gratefully acknowledged. References [1] J.M. Butler, Recent developments in Y-short tandem repeat and Y-single nucleotide polymorphism analysis, Forensic Sci. Rev. 15 (2003) 91–111. [2] A.J. Redd, A.B. Agellon, V.A. Kearney, T. Karafet, P. de Knijff, H. Park, J.M. Butler, M.F. Hammer, Forensic value of fourteen novel STRs on the human Y chromosome, Forensic Sci. Int. 130 (2002) 97–111. [3] R. Schoske, P.M. Vallone, M.C. Kline, J.W. Redman, J.M. Butler, High-throughput Y-STR typing of U.S. populations with 27 regions of the Y chromosome using two multiplex PCR assays, Forensic Sci. Int. (In press). [4] J.M. Butler, R. Schoske, P.M. Vallone, J.W. Redman, M.C. Kline, Allele frequencies for 15 autosomal STR loci on U.S. Caucasian, African American, and Hispanic populations, J. Forensic Sci. 48 (4) (2003) 908–911. [5] J.M. Butler, R. Schoske, P.M. Vallone, M.C. Kline, A.J. Redd, M.F. Hammer, A novel multiplex for simultaneous amplification of 20 Y chromosome STR markers, Forensic Sci. Int. 129 (2002) 10–24. J.M. Butler, R. Schoske / International Congress Series 1261 (2004) 278–280 280
J Forensic Sci, July 2004, Vol. 49, No. 4 Paper ID JFS2003303 Available online at: www.astm.org Peter M. Vallone,1 Ph.D. and John M. Butler,1 Ph.D. Y-SNP Typing of U.S. African American and Caucasian Samples Using Allele-Specific Hybridization and Primer Extension∗ ABSTRACT: Multiplex analysis of genetic markers has become increasingly important in a number of fields, including DNA diagnostics and human identity testing. Two methods for examination of single nucleotide polymorphisms (SNPs) with a potential for a high degree of multiplex analysis of markers are primer extension with fluorescence detection, and allele-specific hybridization using flow cytometry. In this paper, we examined 50 different SNPs on the Y-chromosome using three primer extension multiplexes and five hybridization multiplex assays. For certain loci, the allele-specific hybridization method exhibited sizable background signal from the absent alternate allele. However, 100% concordance (>2000 alleles) was observed in ten markers that were typed using both methods. A total of 18 unique haplogroups out of a possible 45 were observed in a group of 229 U.S. African American and Caucasian males with the majority of samples being assigned into 2 of the 18 haplogroups. KEYWORDS: forensic science, Y-chromosome, single nucleotide polymorphism, SNP typing, Y-SNPs, SNaPshot, primer extension, Luminex, allele-specific hybridization In recent years, single nucleotide polymorphisms (SNPs) have become more widely used in a variety of applications, including medical diagnostics, population genetics, and human identity testing (1,2). The ability to analyze a number of SNP markers in parallel relies on multiplex amplification and detection formats (3). Two SNP detection formats capable of multiplex analysis are allelespecific primer extension (ASPE) and allele-specific hybridization (ASH), which we use here to examine variation along the Y-chromosome. The lack of recombination along most of the Y-chromosome makes it a useful tool in human evolutionary studies and assessing male migration patterns (4–10). Y-chromosome markers have also been used in attempts to address some interesting historical questions (11,12). Analysis of Y-SNP markers has typically been done with manual techniques such as restriction digestion of PCR products (10,13) or by procedures that can only examine one or two markers simultaneously such as allele-specific PCR (7), denaturing high performance liquid chromatography (5), melting curve analysis (14), and real-time PCR (15). More recently, microarrays (16), time-of-flight mass spectrometry (17), and fluorescent primer extension (10,18) have been applied to Y-SNP analysis in order to type multiple markers in parallel. In an effort to evaluate the usefulness of Y-chromosome SNP markers for human identity applications, we constructed several novel multiplex ASPE assays and utilized a new commercial ASH 1 Biotechnology Division, National Institute of Standards and Technology, Gaithersburg, MD 20899-8311. ∗ Contribution of the U.S. National Institute of Standards and Technology. Certain commercial equipment, instruments, and materials are identified in order to specify experimental procedures as completely as possible. In no case does such identification imply a recommendation or endorsement by the National Institute of Standards and Technology nor does it imply that any of the materials, instruments, or equipment identified are necessarily the best available for the purpose. Received 6 Sept. 2003; and in revised form 21 Dec. 2003, 6 March 2004. accepted 6 March 2004; published XXXX. kit to type 50 Y-SNP markers in more than 200 individuals. In addition, by examining ten of the Y-SNPs with both methods, we were able to assess concordance in more than 2000 allele calls between primer extension and hybridization approaches. Methods U.S. African American and Caucasian DNA Samples Anonymous liquid blood samples with self-identified ethnicities were purchased from Interstate Blood Bank, Inc. (Memphis, TN) and Millennium Biotech, Inc. (Ft. Lauderdale, FL) and extracted using a modified salting out procedure (19). Carll Ladd from the Connecticut Forensic Laboratory (Meriden, CT) kindly provided extracted DNA for 20 U.S. Caucasian and 20 African American samples usedas part of this study. TheextractedDNAwas quantified using ultraviolet (UV) spectrophotometry followed by a PicoGreen assay (20) to adjust concentrations to approximately 1 ng/µL. All samples were examined with 15 autosomal short tandem repeats and the amelogenin sex-typing marker using the AmpF_STR Identifiler Kit to verify that each sample was unique (21). A total of 229 male samples were typed (115 African Americans and 114 Caucasians). Y-SNP Markers A total of 50 Y-chromosome biallelic markers were used to cover all 18 major haplogroups (A-R) recognized by the Y-chromosome consortium (YCC) (22,23). Table 1 contains a summary of the YSNP markers used in this study according to their physical position along theY-chromosome. These positions were identified using amplicon sequences for the 50 Y-SNPs with the BLAST-Like Alignment Tool (BLAT): http://genome.ucsc.edu/cgi-bin/hgBlat. Of the 50 Y-SNPs, 18 was typed by three hexaplex allele specific primer extension assays. An additional set of 42 Y-SNP loci was typed by an ASH assay described below. Ten of the Y-SNP loci probed were redundant between the two sets. Copyright C_ 2004 by ASTM International, 100 Barr Harbor Drive, PO Box C700, West Conshohocken, PA 19428-2959. 723
J Forensic Sci, Mar. 2005, Vol. 50, No. 2 Paper ID JFS2004293 Available online at: www.astm.org TECHNICAL NOTE Margaret C. Kline,1 M.S.; Peter M. Vallone,1 Ph.D.; Janette W. Redman;1 David L. Duewer,2 Ph.D.; Cassandra D. Calloway,3,4 M.S.; and John M. Butler,1 Ph.D. Mitochondrial DNA Typing Screens with Control Region and Coding Region SNPs∗
ABSTRACT: Mitochondrial DNA (mtDNA) analysis has found an important niche in forensic DNA typing. It is used with highly degraded samples or low-copy number materials such as might be found from shed hair or bones exposed to severe environmental conditions. The primary advantage of mtDNA is that it is present in high copy number within cells and therefore more likely to be recovered from highly degraded specimens. A major disadvantage to traditional forensic mtDNA analysis is that it is time-consuming and labor-intensive to generate and review the 610 nucleotides of sequence information commonly targeted in hypervariable regions I and II (HVI and HVII) of the control region. In addition, common haplotypes exist in HVI/HVII mtDNA sequences that can reduce the ability to differentiate two unrelated samples. In this report we describe the utility of two newly available screening assays for rapid exclusion of non-matching samples. The LINEAR ARRAY mtDNA HVI/HVII Region-Sequencing Typing Kit (Roche Applied Science, Indianapolis, IN) was used to type 666 individuals from U.S. Caucasian, African American, and Hispanic groups. Processing of the LINEAR ARRAY probe panels “mito strips” was automated on a ProfiBlot workstation. Observable variation in 666 individuals is reported and frequencies of the mitotypes within and between populations are presented. Samples exhibiting the most common Caucasian mitotype were subdivided with a multiplexed amplification and detection assay using eleven single nucleotide polymorphisms in the mitochondrial genome. These types of screening assays should enable more rapid evaluation of forensic casework samples such that only samples not excluded would be subjected to further characterization through full HVI/HVII mtDNA sequence analysis. KEYWORDS: forensic science, DNA typing, mtDNA, SSO probes, mitochondrial DNA coding region, primer extension For the past decade, DNA sequencing of hypervariable regions I (HVI) and II (HVII) in the control region of mitochondrial DNA (mtDNA) has been useful in forensic casework for the analysis of human remains when nuclear DNA systems fail due to low amounts of DNA or highly degraded specimens (1–3). However, considerable effort and expense are required to develop a full HVI and HVII mtDNA sequence (typically positions 16024–16365 and 1 Biotechnology Division, National Institute of Standards and Technology, Gaithersburg, MD 20899. 2 Analytical Chemistry Division, National Institute of Standards and Technology, Gaithersburg, MD 20899. 3 Department of Human Genetics, Roche Molecular Systems, Alameda, CA 94501. 4 Comparative Biochemistry Group, University of California, Berkeley, CA. ∗ Contribution of the U.S. National Institute of Standards and Technology. Not subject to copyright. Certain commercial equipment, instruments and materials are identified in order to specify experimental procedures as completely as possible. In no case does such identification imply a recommendation or endorsement by the National Institute of Standards and Technology nor does it imply that any of the materials, instruments or equipment identified are necessarily the best available for the purpose. † Parts of this work were presented at the 2003 International Symposium on Human Identification, Phoenix, Arizona, and at the 2004 Annual Meeting of the American Academy of Forensic Sciences, Dallas, Texas. ‡ National Institute of Justice (NIJ) funded this work in part through an interagency agreement with the NIST Office of Law Enforcement Standards and NIJ grant 95-IJ-CX-0014 to Roche Molecular Systems. Received 31 July 2004; and in revised form 16 Oct. 2004; accepted 16 Oct. 2004; published 2 Feb. 2005. 73–340 are examined). Hence, several mtDNA screening methods have been developed (4–9). These screening methods permit rapid resolution of non-matching samples allowing a laboratory to focus more attention on full-sequencing of samples that cannot be resolved from one another with the screening method. Alternatively, laboratories without DNA sequencing capabilities or expertise can perform mtDNAtyping with a screening method and then send only those samples that are not excluded to a private or public laboratory for full HVI/HVII sequencing. This report details a number of inter-related technologies associated with the use of the newly available Linear Array Mitochondrial DNA HVI/HVII Region-Sequence Typing Kit (Roche Applied Science, Indianapolis, IN). The utility of a new microchip CE method for quantifying PCR products that are then hybridized to immobilized sequence specific oligonucleotide (SSO) probes is demonstrated. A semi-automated sample processing method for the Linear Arrays was developed and is demonstrated. The utility of this mtDNA typing kit is demonstrated by differentiating several hundred unrelated individuals from U.S. Caucasian, African American, and Hispanic groups. These results are compared to previous work with similar mtDNA SSO typing probes. The presence of multiple signals within a probe region resulting from sequence heteroplasmy is described as is the absence of signal within a probe region resulting from failed hybridization of PCR products due to additional destabilizing polymorphisms. In addition, a new coding region single nucleotide polymorphism (SNP) assay was employed to help subdivide 51 individuals possessing the most common Caucasian mtDNA haplotype (10,11). Copyright C_ 2005 by ASTM International, 100 Barr Harbor Drive, PO Box C700, West Conshohocken, PA 19428-2959. 377
378 JOURNAL OF FORENSIC SCIENCES Materials and Methods The steps involved in typing the control region SNPs with the mtDNA Linear Arrays are: DNA extraction/quantification, PCR amplification, PCR product quantification, hybridization of the PCR products to the Linear Arrays, detection with colored precipitate, interpretation of results for each sample, comparison of Linear Array results to other samples, and subdividing into groupings. Those samples possessing the most common Caucasian type were also processed with an additional coding region SNP assay as described below. DNA Samples A total of 666 DNA samples that had previously been extracted from whole blood were evaluated in this study. These samples, purchased from Interstate Blood Bank Inc. (Memphis, TN), are assumed to be unrelated and were classified into U.S. Caucasian (N =286), African American (N =252), or Hispanic (N =128) groups based on self-declaration. All samples possess unique STR profiles as determined previously with the AmpF_STR Identifier STR kit (Applied Biosystems, Foster City, CA) (12). Bloods were extracted by a modified “saltout” procedure (13). Portions of the genomic extracts were quantified by UV measurement on a Cary Bio 100 double-beam spectrophotometer (Varian Analytical Instruments, Walnut Creek, CA). Based on the UV/260 quantification, the samples were diluted to a nominal 1 ng/µL (14,15). The concentration of the diluted sample was verified by Pico Green quantitation to be between 0.5 ng/µL and 1.5 ng/µL (16). PCR Amplification One µL of each sample extract (≈1 ng/µL) was amplified using the mtDNA HVI/HVII Primer mix and mtDNA PCR Reaction Mix supplied by Roche Molecular Systems (Alameda, CA) as part of a beta-test of the Linear Array Mitochondrial DNA HVI/HVII Region-Sequence Typing kit. This kit is now available from Roche Applied Sciences (Indianapolis, IN) in the same format as described in this work (catalog number 03-527-867-001). Samples are amplified in a duplex PCR that simultaneously generates PCR products for HVI (positions 15975-16418) and HVII (positions 15–429). The HVI primers amplify an approximately 444 bp PCR product using the following primers: Forward (F15975-15993B) 5_-biotin-CTCCACCATTAGCACCCAA-3_ Reverse (R16418-16401B) 5_-biotin-ATTTCACGGAGGATGGTG-3_ The HVII primers amplify an approximately 416 bp PCR product using the following primers: Forward (F15-34B) 5_-biotin-CACCCTATTAACCACTCACG-3_ Reverse (R429-410B) 5_-biotin-CTGTTAAAAGTGCATACCGC-3_ Since 1 ng of genomic DNA was used rather than the “Kit” recommended 5 pg (based on nuclear DNA quantification), the number of amplification cycles was reduced from the recommended protocol. Whereas the standard protocol calls for 34–38 cycles, only 28 cycles were run in order to yield PCR products in the desired concentration range (see below). The PCR parameters used with a GeneAmp 9700 thermal cycler (Applied Biosystems) were: 94◦C for 14 min, 28 cycles of {92◦C for 15 s, 59◦C for 30 s, and 72◦C for 30 s}, final extension 72◦C for 10 min, and hold at 10◦C until the products could be removed from the thermal cycler. Amplification and typing of 11 SNP sites outside the HVI/HVII Region was performed using the multiplex amplification and allelespecific primer extension assay as previously published (11). These sites include SNPs at positions 3010, 4580, 4793, 5004, 7028, 7202, 10211, 12858, 14470 in the coding region and at positions 477 and 16519 in theVariable Regions (control region outside of HVI/HVII) that help differentiate the most common Caucasian Haplotype (10). Post-PCR Quantification Forty of the PCR products were quantified by loading 4 µL on to an agarose (3% mass NuSieve, 1% mass SeaKem GTG, Cambrex Bio Science Rockland, Inc., Rockland, ME) yield gel stained with ethidium bromide and imaged/analyzed with a FMBIO III plus (MiraiBio Inc., Alameda, CA). A yield gel quantification standard was supplied from Roche Molecular Systems as part of the beta-site test, which is the same as the DNA Molecular Weight Marker XIV 100 bp ladder available from Roche Applied Sciences (catalog number 1-721-933). A DNA Low Mass Ladder (catalog number 10068-013, Invitrogen, Carlsbad, CA) was also used for PCR product size estimation and quantification. All 666 HVI/HVII PCR products were quantified using the Agilent 2100 Bioanalyzer Lab Chip system (Agilent Technologies, Palo Alto, CA) and 1 µL of each PCR product according to the manufacturer’s protocols. The Agilent 2100 standard ladder calibrates for base pair (bp) sizing, and quantification for up to 12 samples per run (17). Two DNA fragments, 15 bp and 1500 bp, are added in each tested sample as internal standards to quantify PCR product amounts. Quantitation results were imported to an Excel spreadsheet in order to calculate the appropriate quantity of the PCR product to add to each Linear Array probe panel. Typically addition of ≈50 ng total amplified product to each probe panel was targeted. Control Region SNP Typing Manufacturer protocols for the Linear Arrays were followed in processing the HVI/HVII PCR products through hybridization to a nylon membrane containing specific probe sequences (Fig. 1). Allele-specific hybridization of the amplified DNA is detected using an enzymatic conversion of a soluble, colorless substrate to a blue-colored precipitate with the detection chemistry originally described by Saiki et al. (18). Cambridge Reference Sequence (19, 20) positions 16093, 16126, 16129, 16270, 16278, 16304, 16309, 16311, and 16362 from HVI and positions 73, 146, 150, 152, 189, 195, 198, 200, and 247 from HVII are probed in this assay. Samples were processed both manually (120 samples) and using a SLT ProfiBlot workstation (Tecan US, Research Triangle Park, NC) (remaining 446 samples). Steps in the developed Profiblot protocol are listed in Table 1. All reagents required for processing are pre-loaded onto the Tecan Profiblot. Up to 24 probe panels can be processed simultaneously in a 2 h run. The wash solution is placed in a heated/stirred heat block to maintain the required 55◦C temperature for hybridization. After the Linear Array probe panels are added to the tray, the Profiblot SLT instrument dispenses the
2) list the geneticist who support this theory with direct, clear statements to the effect that this is so.
Mitochondrial DNA: Coding Region SNP Assay Development
Participants: Peter M. Vallone, Michael D. Coble, Margaret C. Kline, and John M. Butler (AFDIL participants: Rebecca Just and Thomas Parsons)
Project Timeframe: 2001 to present
Purpose: The development of multiplex primer extension assays to probe coding region mitochondrial SNPs to help resolve common mitotypes.
Progress: The typing of single nucleotide polymorphisms (SNPs) located throughout the mitochondrial genome (mtGenome) allows for differentiation between individuals possessing an identical HV1/HV2 sequence. A set of 11 SNPs selected for distinguishing individuals of the most common Caucasian HV1/HV2 mitotype were incorporated in an allele-specific primer extension assay. The 11-plex assay probed SNPs located at positions 477, 3010, 4580, 4793, 5004, 7028, 7202, 10211, 12858, 14470 and 16519 in the mtGenome. The assay was optimized for multiplex detection of these SNPs. Primers were designed to allow for the simultaneous polymerase chain reaction (PCR) amplification of 11 unique regions in the mtGenome. Locus specific primers of varying lengths were employed in multiplex primer extension reactions. Extension primers binding 5’ adjacent to the SNP site of interest were enzymatically extended using fluorescently labeled dideoxynucleotides (ddNTPs). Resolution and detection of each extended fragment were achieved by analysis on a capillary-based electrophoresis (CE) platform. The electrophoretic mobility for the extension primers was compared in denaturing POP4 and POP6 CE running buffers. Empirical adjustment of extension primer concentrations resulted in even signal intensity for the 11 loci probed. The development of the mtSNP 11-plex assay has resulted in an accurate method for typing sequence variant mtSNPs on a platform common to forensic laboratories.
We are currently developing additional multiplex SNP panels to resolve other common mitotypes (Caucasian, Hispanic, and African American).
Publications Resulting From This Project: Kline, M.C., Vallone, P.M., Redman, J.W., Duewer, D.L., Calloway, C.D., and Butler, J.M. (2005) Mitochondrial DNA typing screens with control region and coding region SNPs. J. Forensic Sci. 50(2): 377-385.
Just, R.S., Irwin, J.A., O'Callaghan, J.E., Saunier, J.L., Coble, M.D., Vallone, P.M., Butler, J.M., Barritt, S.M., and Parsons, T.J. (2004) Toward increased utility of mtDNA in forensic identifications. Forensic Sci. Int. 146S: S147-S149.
Vallone, P.M., Just, R.S., Coble, M.D., Butler, J.M., and Parsons, T.J. (2004) A multiplex allele-specific primer extension assay for forensically informative SNPs distributed throughout the mitochondrial genome. Int. J. Legal Med. 118: 147-157.
Coble, M.D., Just, R.S., O'Callaghan, J.E., Letmanyi, I.H., Peterson, C.T., Irwin, J.A., Parsons, T.J. (2004) Single nucleotide polymorphisms over the entire mtDNA genome that increase the power of forensic testing in Caucasians. Int. J. Legal Med. 118: 137-146.
3) present a study classifying Dravidians and Africans into a distinct race based upon specific SNP markers.
The study of Sforza where he claims that Afro-Asiatic and Dravidian speakers are caucasian answers this question.
The forensic studies and comments by Sforza and other geneticists indicate that race does exist.
.
-------------------- C. A. Winters Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
quote:study of Sforza where he claims that Afro-Asiatic and Dravidian speakers are caucasian answers this question.
No it does not - Sforza does not consider Dravidian and AfroAsiatic language, nor does he consider Africans caucasians, nor does he consider Dravidians and Africans to be genetically close, nor does he claim Dravidians and Africans are the same race.
He simply misdefines AfroAsiatic languages as caucasian. This shows his ignorance of linguistics. But does not help you answer my question.
Posts: 15202 | Registered: Jun 2004
| IP: Logged |
quote: Forensic Sci, July 2004, Vol. 49, No. 4 Paper ID JFS2003303 Available online at: www.astm.org Peter M. Vallone,1 Ph.D. and John M. Butler,1 Ph.D. Y-SNP Typing of U.S. African American and Caucasian Samples Using Allele-Specific Hybridization and Primer Extension
This one *is* a study of SNP markers, but nowhere within it does it claim that SNP markers classify races. Same with the others you posted.
Disagree?
You may prove your point - simply tell us exactly which SNP marker classify which 'race' based upon any study you posted?
Posts: 15202 | Registered: Jun 2004
| IP: Logged |
quote: quote: -------------------------------------------------------------------------------- Forensic Sci, July 2004, Vol. 49, No. 4 Paper ID JFS2003303 Available online at: www.astm.org Peter M. Vallone,1 Ph.D. and John M. Butler,1 Ph.D. Y-SNP Typing of U.S. African American and Caucasian Samples Using Allele-Specific Hybridization and Primer Extension --------------------------------------------------------------------------------
This one *is* a study of SNP markers, but nowhere within it does it claim that SNP markers classify races. Same with the others you posted.
Disagree?
You may prove your point - simply tell us exactly which SNP marker classify which 'race' based upon any study you posted?
The authors describe the population as caucasian this means they were using race in their discussion of a population. This means that to these scientists race exist.
J Forensic Sci, July 2004, Vol. 49, No. 4 Paper ID JFS2003303 Available online at: www.astm.org Peter M. Vallone,1 Ph.D. and John M. Butler,1 Ph.D. Y-SNP Typing of U.S. African American and Caucasian Samples Using Allele-Specific Hybridization and Primer Extension∗ ABSTRACT: Multiplex analysis of genetic markers has become increasingly important in a number of fields, including DNA diagnostics and human identity testing. Two methods for examination of single nucleotide polymorphisms (SNPs) with a potential for a high degree of multiplex analysis of markers are primer extension with fluorescence detection, and allele-specific hybridization using flow cytometry. In this paper, we examined 50 different SNPs on the Y-chromosome using three primer extension multiplexes and five hybridization multiplex assays. For certain loci, the allele-specific hybridization method exhibited sizable background signal from the absent alternate allele. However, 100% concordance (>2000 alleles) was observed in ten markers that were typed using both methods. A total of 18 unique haplogroups out of a possible 45 were observed in a group of 229 U.S. African American and Caucasian males with the majority of samples being assigned into 2 of the 18 haplogroup...." .
Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
quote: quote: -------------------------------------------------------------------------------- Dr. Winters writes: The authors describe the population as caucasian --------------------------------------------------------------------------------
The socially defined discriptions - African American and Caucasian in that study in no way scientifically validate race.
And your response is a non-sequitur which does not answer my question:
quote: -------------------------------------------------------------------------------- rasol asks: Simply tell us exactly which SNP marker classify which 'race' based upon any study you posted? --------------------------------------------------------------------------------
We'll happily credit you with evidence if you provide and answer.
However no answer = no evidence earning you no credit.
Last chance....
Your math is wrong. The sources I presented prove that scientist use the terms in their studies. If they did not use the terms you could claim that race is not a valid scientific term.
quote:
J Forensic Sci, July 2004, Vol. 49, No. 4 Paper ID JFS2003303 Available online at: www.astm.org Peter M. Vallone,1 Ph.D. and John M. Butler,1 Ph.D. Y-SNP Typing of U.S. African American and Caucasian Samples Using Allele-Specific Hybridization and Primer Extension∗ ABSTRACT: Multiplex analysis of genetic markers has become increasingly important in a number of fields, including DNA diagnostics and human identity testing. Two methods for examination of single nucleotide polymorphisms (SNPs) with a potential for a high degree of multiplex analysis of markers are primer extension with fluorescence detection, and allele-specific hybridization using flow cytometry. In this paper, we examined 50 different SNPs on the Y-chromosome using three primer extension multiplexes and five hybridization multiplex assays. For certain loci, the allele-specific hybridization method exhibited sizable background signal from the absent alternate allele. However, 100% concordance (>2000 alleles) was observed in ten markers that were typed using both methods. A total of 18 unique haplogroups out of a possible 45 were observed in a group of 229 U.S. African American and Caucasian males with the majority of samples being assigned into 2 of the 18 haplogroup...."
.
Use of racial terms implies race as a scientific reality in identifying populations.
-------------------- C. A. Winters Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
posted
Rasol I am sorry that you fail to accept the refutation of Templeton's idea that race no longer exist. Your question has nothing to do with this thread. Maybe you should start your own thread.
But any thread that claims race dosen't exist, when scientists continue to use the term is doomed to falsification. Because some geneticist, like forensic anthropologists employ racial terms in their research. To employ racial terms in their work implies their support of the view races exist.
The subject of this thread is race doesn't exist. It was originally claimed that race does not exist based on Templeton:
quote: "Race is a real cultural, political and economic concept in society, but it is not a biological concept, and that unfortunately is what many people wrongfully consider to be the essence of race in humans -- genetic differences," Templeton said. "Evolutionary history is the key to understanding race, and new molecular biology techniques offer so much on recent evolutionary history. I wanted to bring some objectivity to the topic. This very objective analysis shows the outcome is not even a close call: There's nothing even like a really distinct subdivision of humanity."
I have refuted the contention that scientist do not recognize distinct subdivisions of humanity.
1)I have shown that this is untrue. I presented evidence that Forensic scientists continue to use "race" as a way to classify humans
2) I have presented evidence that even geneticist use race when discussing the haplotype and haplogroup of individuals and populations.
These facts indicate that Templeton is wrong scientist still recognize a distinct subdivision of humanity. Race does exist.
"But any thread that claims race dosen't exist, when scientists continue to use the term is doomed to falsification. Because some geneticist, like forensic anthropologists employ racial terms in their research. To employ racial terms in their work implies their support of the view races exist."
Thats like saying:
"But any thread that claims the Easter Bunny dosen't exist, when people continue to use the term is doomed to falsification. Because some people, like little children talk about the Easter Bunny during Easter holiday. To talk about the Easter Bunny during Easter Holiday in implies their support of the view that the Easter Bunny exists."
Posts: 2595 | From: Vicksburg | Registered: Feb 2006
| IP: Logged |
Your question has nothing to do with this thread. Maybe you should start your own thread.
Of course, it does; but you have to understand how so, before you realize this.
quote:Clyde Winters:
But any thread that claims race dosen't exist, when scientists continue to use the term is doomed to falsification. Because some geneticist, like forensic anthropologists employ racial terms in their research. To employ racial terms in their work implies their support of the view races exist.
Which "geneticist" uses the "term" that signifies "race". How has this use proven the existence of discrete biological "races" in humans?
You have been shown, as Rasol mentioned, different studies showing just how "Forensics" operate, all the while claiming to "predicting" socially constructed "racial" types. The shortcomings inherent in such approach to typological thinking in science, has been spelt out in the aforementioned studies on the issue of Forensics; you haven't yet addressed those points.
Posts: 5964 | Registered: Jan 2005
| IP: Logged |
"Forensic anthropology has been much more reluctant to divorce itself from the premodern partitioning of human biological variation into races (Smay and Armelagos 2000), despite the fact that human biological variation in genetic markers (Lewontin 1972, Stoneking 1993) and cranial morphology (Relethford 1994) is quantitatively greater within than between major geographic regions or races. Pressure from local law enforcement officials who insist on “knowing” the social race of unknowns may prompt some forensic anthropologists to designate racial affinity (provided that the sex of the individual can be determined), producing classifications that some have called “bureaucratic races.” However, the use of forensic tools to determine ancestry must assume that a given cranium is more similar to those of the ascribed population than to those of any other (e.g., Byers 2002). The fact that populations are variably defined as geographic regions, islands, countries, reproductive isolates, languages, cultures, or race categories may severely limit the reliability of such diagnoses.
Reports of Fordisc 2.0 analyses in the primary literature are scarce, suggesting that practitioners of this program are using a tool that has not been systematically tested for validity. Fordisc 2.0 produced poor results in Ubelaker, Ross, and Graver’s (2002) study of sixteenthand seventeenth-century Spanish crania, with half the crania being attributed to non-European/North African samples using one of its data sets, Howells’s (1973, 1995) cranial series, and less than half attributed to the white category using its other data set, the Forensic Data Bank (Ousley and Jantz 1996). Ubelaker et al. (2002) nevertheless call it “a powerful tool in forensic analysis that is routinely employed in most North American forensic laboratories” and generally support its use provided that care is taken when the samples are not represented in either of its databases (see also Ousley and Jantz 1996). Other researchers are less convinced of Fordisc’s practical use. Fukuzawa and Maish (1997) sought to ascribe ancestry to Native Canadians without success, and Leathers, Edwards, and Armelagos (2002) and Belcher, Williams, and Armelagos (2002) found that the program failed to classify populations as expected. We used both of its data sets to identify cranial remains from an ancient Meroitic Nubian population and found that it accurately classified very few of these remains.
"But any thread that claims race dosen't exist, when scientists continue to use the term is doomed to falsification. Because some geneticist, like forensic anthropologists employ racial terms in their research. To employ racial terms in their work implies their support of the view races exist."
Thats like saying:
"But any thread that claims the Easter Bunny dosen't exist, when people continue to use the term is doomed to falsification. Because some people, like little children talk about the Easter Bunny during Easter holiday. To talk about the Easter Bunny during Easter Holiday in implies their support of the view that the Easter Bunny exists."
This is illogical. I have presented evidence that geneticists use racial terms in their papers. This includes Sforza the father of genetic anthropology. How can they use racial terms in their research papers and claim races don't exist?
Below is a list of studies discussing race using DNA to denote differences.
: Hum Immunol. 2006 Jan-Feb;67(1-2):73-84. Epub 2006 Apr 5. Related Articles, Links The haplotype structure of the human major histocompatibility complex.Alper CA, Larsen CE, Dubey DP, Awdeh ZL, Fici DA, Yunis EJ.CBR Institute for Biomedical Research, Boston, MA 02115, USA; Department of Pediatrics, Harvard Medical School, Boston, MA 02115, USA.There is great interest in the use of single-nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) analysis to localize human disease genes. The results suggest that the human genome, including the major histocompatibility complex (MHC), consists largely of 5- to 200-kb blocks of sequence fixity between which random recombination occurs. Direct determination of MHC haplotypes from family studies also demonstrates similar-sized blocks, but otherwise gives a very different picture, with a third to a half of Caucasian haplotypes fixed from HLA-B to HLA-DR/DQ (at least 1 Mb) as conserved extended haplotypes (CEHs), some of which encompass more than 3 Mb. These fixed haplotypes differ in frequency both in different Caucasian subpopulations and in Caucasian patients with HLA-associated diseases, complicating disease susceptibility gene localization. The inherent inability of LD analysis to "see" DNA fixity beyond three markers contributes to the failure of SNP/LD analysis to define in detail or even detect CEHs in the MHC and probably elsewhere in the genome. More importantly, the use of statistical analysis, rather than direct haplotype determination and counting, fails to reveal the details of haplotype structure essential for gene localization. Given the oversimplified picture of the MHC (and probably the rest of the genome) provided only by SNP/LD-defined blocks, it is questionable whether this approach will be of great help in disease susceptibility gene localization or identification.
Br J Haematol. 1997 Aug;98(2):356-64. Related Articles, Links
Specificity and sensitivity of RHD genotyping methods by PCR-based DNA amplification.
Aubin JT, Le Van Kim C, Mouro I, Colin Y, Bignozzi C, Brossard Y, Cartron JP.
Centre d'Hemobiologie Perinale, Paris, France.
We have compared the sensitivity and specificity of four PCR methods of RHD gene detection using different sets of primers located in the regions of highest divergence between the RHD and RHCE genes, notably exon 10 (method I), exon 7 (method II), exon 4 (method III) and intron 4 (method IV). Methods I-III were the most sensitive and gave a detectable signal with D-pos/D-neg mixtures containing only 0.001% D-positive cells. Moreover, method II could detect the equivalent DNA amount present in only three nucleated cells in the assay without hybridization of PCR products, whereas the sensitivity of the other methods was 10-50 times less. Investigation of D variants indicated that false-negative results were obtained with method II (D(IVb) variant), method III (D(VI) and DFR variants) and method IV (D(VI) variants), but not method I. Weak D (D(u)) was correctly detected as D-positive by all methods, but most cases of Rh(null) appeared as false-positives, as they carry normal RH genes that are not phenotypically expressed. Some false-positive results were obtained with method I in a few Caucasian DNA samples serotyped as RhD-neg but carrying a C- or E-allele, whereas a high incidence of false-positives was found among non-Caucasian Rh-negative samples by all methods. In the Caucasian population, however, we found a full correlation between the predicted genotype and observed phenotype at birth of 92 infants. Although we routinely use the four methods for RHD genotyping, a PCR strategy based on at least two methods is recommended.
Hum Immunol. 2006 Jan-Feb;67(1-2):125-39. Epub 2005 Nov 4. Related Articles, Links
Disease Relevant HLA Class II Alleles Isolated by Genotypic, Haplotypic, and Sequence Analysis in North American Caucasians With Pemphigus Vulgaris.
Lee E, Lendas KA, Chow S, Pirani Y, Gordon D, Dionisio R, Nguyen D, Spizuoco A, Fotino M, Zhang Y, Sinha AA.
Department of Dermatology, Weill Medical College of Cornell University, New York, NY.
Early studies of genetic susceptibility to pemphigus vulgaris (PV) showed associations between human leukocyte antigen (HLA) DR4 and DR6 and disease. The emergence of DNA sequencing techniques has implicated numerous DRB1 and DQB1 loci in various populations, leading to confusion regarding which exact alleles confer susceptibility. The strong linkage disequilibrium among DR and DQ HLA alleles further complicates the investigation of the true susceptibility loci. In this study, we report genotyping data for the largest sampling of North American Caucasian non-Jewish and Ashkenazi Jewish PV patients studied to date and compare our data with other population studies. To pinpoint true susceptibility, alleles among overrepresented sequences, we applied a step-wise reductionist analysis through (1) determination of the degree of linkage disequilibrium (LD) between purportedly associated alleles, (2) haplotype frequencies comparisons, and (3) primary sequence comparisons of disease-associated versus non-disease-associated alleles to identify crucial differences in amino acid residues in putative peptide binding pockets. Collectively, our data provide extended support for the hypothesis that the HLA associations in Caucasian PV patients map to DRB1*0402 and DQB1*0503 alone. Further structure-function studies will be required to define the exact mechanisms of HLA-mediated control of susceptibility and resistance to disease.
PMID: 16698434 [PubMed - in process]
Ann Hum Genet. 2006 May;70(Pt 3):350-9. Related Articles, Links
A comparison of individual genotyping and pooled DNA analysis for polymorphism validation prior to large-scale genetic studies.
Yang HC, Lin CH, Hung SI, Fann CS.
Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan 115.
Polymorphism validation is an important issue in genetic studies because only polymorphic markers provide useful information. We analyzed genetic data for 180 SNPs in the human major histocompatibility complex region in Caucasian and Taiwanese populations, and evaluated ethnic heterogeneity between these populations to illustrate the importance of polymorphism validation. An initial individual genotyping experiment (IGE) with 95 samples was compared with a DNA pooling allele-typing experiment (PAE) of 630 individuals for polymorphism validation based on authentic data sets. Afterwards, all samples were genotyped individually in a confirmation study. Under narrow (broad) polymorphism criteria, 24 (41) polymorphic SNPs in Caucasians could not be validated in the Taiwanese population, suggesting a 13% (23%) inconsistency rate and revealing a strong discrepancy between genetic backgrounds, probably due to ethnic heterogeneity. IGE yielded high sensitivity and specificity for polymorphism validation, but may be sensitive to sampling variation. PAE showed high sensitivity (97%) and specificity (100%) using a narrow polymorphism criterion, but reduced specificity (83%) using a broad criterion. Public domain polymorphism databases should therefore be used with caution and polymorphism validation should be performed routinely prior to conducting large-scale genetic studies. PAE is a cost-saving, reliable alternative to IGE for polymorphism validation, especially for a stringent polymorphism criterion.
.
-------------------- C. A. Winters Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
You have been shown, as Rasol mentioned, different studies showing just how "Forensics" operate, all the while claiming to "predicting" socially constructed "racial" types. The shortcomings inherent in such approach to typological thinking in science, has been spelt out in the aforementioned studies on the issue of Forensics; you haven't yet addressed those points.
Where have you been I have already discussed these points by illustrating that race is a key aspect of forensic science.
The subject of this thread is race doesn't exist. It was originally claimed that race does not exist based on Templeton:
quote: "Race is a real cultural, political and economic concept in society, but it is not a biological concept, and that unfortunately is what many people wrongfully consider to be the essence of race in humans -- genetic differences," Templeton said. "Evolutionary history is the key to understanding race, and new molecular biology techniques offer so much on recent evolutionary history. I wanted to bring some objectivity to the topic. This very objective analysis shows the outcome is not even a close call: There's nothing even like a really distinct subdivision of humanity."
I have refuted the contention that scientist do not recognize distinct subdivisions of humanity.
1)I have shown that this is untrue. I presented evidence that Forensic scientists continue to use "race" as a way to classify humans
2) I have presented evidence that even geneticist use race when discussing the haplotype and haplogroup of individuals and populations.
These facts indicate that Templeton is wrong scientist still recognize a distinct subdivision of humanity. Race does exist.
.
-------------------- C. A. Winters Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
UBBFriend: Email this page to someone!
![[Wink]](wink.gif)
![[Smile]](smile.gif)
Printer-friendly view of this topic