Biological differences among races do not exist, WU research shows By Tony Fitzpatrick --------------------------------------------------------------------------------
Race doesn't matter.
In fact, it doesn't even exist in humans.
While that may sound like the idealistic decree of a minister or rabbi, it's actually the conclusion of an evolutionary and population biologist at Washington University.
Alan R. Templeton, Ph.D., professor of biology in Arts and Sciences, has analyzed DNA from global human populations that reveal the patterns of human evolution over the past one million years. He shows that while there is plenty of genetic variation in humans, most of the variation is individual variation. While between-population variation exists, it is either too small, which is a quantitative variation, or it is not the right type of qualitative variation -- it does not mark historical sublineages of humanity.
Using the latest molecular biology techniques, Templeton has analyzed millions of genetic sequences found in three distinct types of human DNA and concludes that, in the scientific sense, there is no such thing as race.
"Race is a real cultural, political and economic concept in society, but it is not a biological concept, and that unfortunately is what many people wrongfully consider to be the essence of race in humans -- genetic differences," Templeton said. "Evolutionary history is the key to understanding race, and new molecular biology techniques offer so much on recent evolutionary history. I wanted to bring some objectivity to the topic. This very objective analysis shows the outcome is not even a close call: There's nothing even like a really distinct subdivision of humanity."
Templeton used the same strategy to try to identify race in human populations that evolutionary and population biologists use for non-human species, from salamanders to chimpanzees. He treated human populations as if they were non-human populations.
"I'm not saying these results don't recognize genetic differences among human populations," he cautioned. "There are differences, but they don't define historical lineages that have persisted for a long time."
Templeton's paper, "Human Races: A Genetic and Evolutionary Perspective," is published in the fall 1998 issue of the American Anthropologist, an issue almost exclusively devoted to race. The new editor-in-chief of the American Anthropologist is Robert W. Sussman, Ph.D., professor of anthropology in Arts and Sciences.
"The folk concept of race in America is so ingrained as being biologically based and scientific that it is difficult to make people see otherwise," said Sussman, a biological anthropologist. "We live on the one-drop racial division --if you have one drop of black or Native American blood, you are considered black or Native American, but that doesn't cover one's physical characteristics.
"Templeton's paper," Sussman continued, "shows that if we were forced to divide people into groups using biological traits, we'd be in real trouble. Simple divisions are next to impossible to make scientifically, yet we have developed simplistic ways of dividing people socially."
Single lineage Templeton analyzed genetic data from mitochondrial DNA, a form inherited only from the maternal side; Y chromosome DNA, paternally inherited DNA; and nuclear DNA, inherited from both sexes. His results showed that 85 percent of genetic variation in the human DNA was due to individual variation. A mere 15 percent could be traced to what could be interpreted as "racial" differences. "The 15 percent is well below the threshold that is used to recognize race in other species," Templeton said. "In many other large mammalian species, we see rates of differentiation two or three times that of humans before the lineages are even recognized as races. Humans are one of the most genetically homogenous species we know of. There's lots of genetic variation in humanity, but it's basically at the individual level. The between-population variation is very, very minor."
Among Templeton's conclusions: There is more genetic similarity between Europeans and sub-Saharan Africans and between Europeans and Melanesians, inhabitants of islands northeast of Australia, than there is between Africans and Melanesians. Yet, sub-Saharan Africans and Melanesians share dark skin, hair texture and cranial-facial features, traits commonly used to classify people into races. According to Templeton, this example shows that "racial traits" are grossly incompatible with overall genetic differences between human populations.
"The pattern of overall genetic differences instead tells us that genetic lineages rapidly spread out to all of humanity, indicating that human populations have always had a degree of genetic contact with one another, and thus historically don't show any distinct evolutionary lineages within humanity," Templeton said. "Rather, all of humanity is a single long-term evolutionary lineage."
Among Templeton's conclusions: There is more genetic similarity between Europeans and sub-Saharan Africans and between Europeans and Melanesians, inhabitants of islands northeast of Australia, than there is between Africans and Melanesians. Yet, sub-Saharan Africans and Melanesians share dark skin, hair texture and cranial-facial features, traits commonly used to classify people into races. According to Templeton, this example shows that "racial traits" are grossly incompatible with overall genetic differences between human populations.
Why?...because most recent African ancestry is prevalent among Europeans than Melanesians - something which you fail to comprehend, but presents itself time and again, as in this case - while Europeans are also genetically a subset of Eurasians - whose gene pools in turn derive from a subset of African gene pools.
Posted by *Topdog* (Member # 10328) on :
quote:Originally posted by Supercar:
quote:
Among Templeton's conclusions: There is more genetic similarity between Europeans and sub-Saharan Africans and between Europeans and Melanesians, inhabitants of islands northeast of Australia, than there is between Africans and Melanesians. Yet, sub-Saharan Africans and Melanesians share dark skin, hair texture and cranial-facial features, traits commonly used to classify people into races. According to Templeton, this example shows that "racial traits" are grossly incompatible with overall genetic differences between human populations.
Why?...because most recent African ancestry is prevalent among Europeans than Melanesians - something which you fail to comprehend, but presents itself time and again, as in this case - while Europeans are also genetically a subset of Eurasians - whose gene pools in turn derive from a subset of African gene pools.
That has nothing to do with the closer relationship, don't even attempt to try and interpret Templeton. From what I did^read of Templeton's study Melanesians descend from a subset of^Eurasians, the study mentioned nothing about recent African ancestry in Europeans a the reason for Europeans and Africans being closer to one another.
Posted by Supercar (Member # 6477) on :
quote:Charles:
That has nothing to do with the closer relationship, don't even attempt to try and interpret Templeton.
What then does? Feel free to interpret Templeton's explanation for this phenomenon, that doesn't boil down to what I had already spelt out.
quote: Charles:
From what I did^read of Templeton's study Melanesians descend from a subset of^Eurasians, the study mentioned nothing about recent African ancestry in Europeans a the reason for Europeans and Africans being closer to one another.
Since when does somebody have to say something before you can get it - what ever happened to the idea of accumulation of knowledge from earlier learning? Your approach to knowledge-gathering is bizarre indeed.
BOTH Melanesian and European gene pools are a subset of Eurasian gene pool [which again, derived from a subset of African gene pool]; Given this, again, why then do we have this situation?...
There is more genetic similarity between Europeans and sub-Saharan Africans and between Europeans and Melanesians, inhabitants of islands northeast of Australia, than there is between Africans and Melanesians.
quote:Originally posted by *Topdog*:
Stop hijacking this thread with rambling about African ancestry in Europeans, confine to the other threads that talk about that issue.
You mean like how you've highjacked other threads where this issue came up. I agree with you on one thing; it is pointless to keep bringing up a matter that you obviously have no comprehension of, even if something to the effect is mentioned time and again in the material that you've just posted.
Posted by *Topdog* (Member # 10328) on :
Profesor Winters, if you still believe race exists, what about this:
Human Races: A Genetic and Evolutionary Perspective Alan R. Templeton
Race is generally used as a synonym for subspecies, which traditionally is a geographically circumscribed, genetically differentiated population. Sometimes traits show independent patterns of geographical variation such that some combination will distinguish most populations from all others. To avoid making "race" the equivalent of a local population, minimal thresholds of differentiation are imposed. Human "races" are below the thresholds used in other species, so valid traditional subspecies do not exist in humans. A "subspecies" can also be defined as a distinct evolutionary lineage within a species. Genetic surveys and the analyses of DNA haplotype trees show that human "races" are not distinct lineages, and that this is not due to recent admixture; human "races" are not and never were "pure." Instead, human evolution has been and is characterized by many locally differentiated populations coexisting at any given time, but with sufficient genetic contact to make all of humanity a single lineage sharing a common evolutionary fate. [race, subspecies, lineage, haplotype tree, genetic differentiation]
American Anthropologist Volume 100, Number 3, September 1998
Posted by Clyde Winters (Member # 10129) on :
George Gill
quote: quote:
"I am more accurate at assessing race from skeletal remains that from looking at living people standing before me," Gill says.
Slightly over half of all biological/physical anthropologists today believe in the traditional view that human races are biologically valid and real. Furthermore, they tend to see nothing wrong in defining and naming the different populations of Homo sapiens. The other half of the biological anthropology community believes either that the traditional racial categories for humankind are arbitrary and meaningless, or that at a minimum there are better ways to look at human variation than through the "racial lens."
Are there differences in the research concentrations of these two groups of experts? Yes, most decidedly there are. As pointed out in a recent 2000 edition of a popular physical anthropology textbook, forensic anthropologists (those who do skeletal identification for law-enforcement agencies) are overwhelmingly in support of the idea of the basic biological reality of human races, and yet those who work with blood-group data, for instance, tend to reject the biological reality of racial categories.
The "reality of race" therefore depends more on the definition of reality than on the definition of race. If we choose to accept the system of racial taxonomy that physical anthropologists have traditionally established—major races: black, white, etc.—then one can classify human skeletons within it just as well as one can living humans. The bony traits of the nose, mouth, femur, and cranium are just as revealing to a good osteologist as skin color, hair form, nose form, and lips to the perceptive observer of living humanity. I have been able to prove to myself over the years, in actual legal cases, that I am more accurate at assessing race from skeletal remains than from looking at living people standing before me. So those of us in forensic anthropology know that the skeleton reflects race, whether "real" or not, just as well if not better than superficial soft tissue does. The idea that race is "only skin deep" is simply not true, as any experienced forensic anthropologist will affirm.
^ Dr. Winters. Have you ever read any studies or work by George Gill?
If no, what impresses you about his dodgy semantics: The "reality of race" therefore depends more on the definition of reality than on the definition of race. -George Gill.
Definition of reality?
Fine:
The reality is, his definition of race is based on circular reasoning - that we can look at a skull and classify it by 'race', and be correct...based upon prevailing, social, and therefore variable definitions of 'race', which have no intrinsic scientific value to begin with.
The reality is, this proves nothing.
In order to validate race- we need to put it to some kind of objective verifiable test.
Many anthropologists have, and they *do not agree* with George Gill:
All of the crania in this Spanish sample originated from a 16th to 17th-century community associated with a church in northwestern Spain. Although specific information on the ancestry of any particular individual in the sample is not available, generally all individuals should be considered examples of this group.
Table 3 presents the race classification of all individuals in this sample using the Forensic Data Bank option.
Of the 95 individuals, 42 (44 percent) were classified as white, 35 percent as black, 9 percent as Hispanic, 4 percent as Japanese, 4 percent as American Indian, and the remaining three individuals as Chinese and Vietnamese. Using the sex estimates made by the authors at the time of examination as Sex Known and classifying the crania by race within the specific sex category using the Forensic Data Bank option, the greatest percentage classified this time into the black category.
Some crania were classified into groups with no clear geographic or ancestral relationship with the Spanish sample.
Gill's only response to this, is to vouch for himself "I am more accurate examining skeletans than I am when looking at the actual person".
Terrific.
I wouldn't put that on my resume' if I were Gill.
Posted by *Topdog* (Member # 10328) on :
quote:Originally posted by Clyde Winters: George Gill
quote: quote:
"I am more accurate at assessing race from skeletal remains that from looking at living people standing before me," Gill says.
Slightly over half of all biological/physical anthropologists today believe in the traditional view that human races are biologically valid and real. Furthermore, they tend to see nothing wrong in defining and naming the different populations of Homo sapiens. The other half of the biological anthropology community believes either that the traditional racial categories for humankind are arbitrary and meaningless, or that at a minimum there are better ways to look at human variation than through the "racial lens."
Are there differences in the research concentrations of these two groups of experts? Yes, most decidedly there are. As pointed out in a recent 2000 edition of a popular physical anthropology textbook, forensic anthropologists (those who do skeletal identification for law-enforcement agencies) are overwhelmingly in support of the idea of the basic biological reality of human races, and yet those who work with blood-group data, for instance, tend to reject the biological reality of racial categories.
The "reality of race" therefore depends more on the definition of reality than on the definition of race. If we choose to accept the system of racial taxonomy that physical anthropologists have traditionally established—major races: black, white, etc.—then one can classify human skeletons within it just as well as one can living humans. The bony traits of the nose, mouth, femur, and cranium are just as revealing to a good osteologist as skin color, hair form, nose form, and lips to the perceptive observer of living humanity. I have been able to prove to myself over the years, in actual legal cases, that I am more accurate at assessing race from skeletal remains than from looking at living people standing before me. So those of us in forensic anthropology know that the skeleton reflects race, whether "real" or not, just as well if not better than superficial soft tissue does. The idea that race is "only skin deep" is simply not true, as any experienced forensic anthropologist will affirm.
Clyde, in view of the *FACT* that bioanthropologists and geneticists are increasingly duscarding racial classification, wouldn't it seem that he(Gill) is a bit of an anomally? Forensic anthropologists scrwe it rountinely, here's the danger in using typological criteria(ie, what a sterotypical "Negro" and "Caucasian" looks like) to classify crania:
UGHAN, ONT. - York Regional Police have released drawings of an unidentified woman whose badly burned body was found in an industrial park more than 10 years ago.
A police officer made the gruesome discovery on Sept. 1, 1994, after noticing a fire behind a building on Bradwick Drive near Highway 7 in Vaughan.
When the fire was put out, the body of a young woman was found in the remains of a suitcase. Gasoline and tires had been used to fuel the fire.
On Tuesday, investigators released drawings of a clay reconstruction of the victim's face, along with previously unpublished information that they hope may help someone identify her.
Forensic testing indicates that the victim was likely a dark-skinned Caucasian from a North African country such as Sudan, Ethiopia, Somalia or Egypt. Her estimated age was 17 to 18.
She stood five feet, four inches, and had a very slim build, weighing between 85 and 100 pounds. She had dark curly hair, which may have been dyed a reddish colour, and protruding front teeth, which were in good condition.
Police say the victim had suffered broken bones in her back and lower limbs that had been left to heal untreated. As a result, they say she was likely immobile and in constant pain.
Forensic anthropologists said the woman was a "dark skin Caucasian" from Sudan, Somalia, Ethiopia or Egypt, none of those peoples are "dark skinned" Caucasians. I wouildn't be surprised if Gill came to the same conclusion about that woman's skull. Foresnic anthropologists strictly adhere to an extreme brand of typological thinking, if they didn't they would be out of a job.
Posted by *Topdog* (Member # 10328) on :
Jean Hiernaux, "The People of Africa", 1975, p.91
"....there are approximately one thousand populations in sub-Saharan Africa; and the number of human populations in the world is, of course, several times this figure. Confronted with such large numbers, the human mind tends to reduce them to a lower number of classes. If attainable, the resulting classification would make the presentation and memorization of the characteristics of the populations much easier. By itself, however, it would not bring any understanding of the observed diversity. In particular, it would not necessarily reflect phylogeny(relationship by descent)."
A perfect example of the bolded sentence is this, stated by Templeton:
"Among Templeton's conclusions: There is more genetic similarity between Europeans and sub-Saharan Africans and between Europeans and Melanesians, inhabitants of islands northeast of Australia, than there is between Africans and Melanesians. Yet, sub-Saharan Africans and Melanesians share dark skin, hair texture and cranial-facial features, traits commonly used to classify people into races. Posted by yazid904 (Member # 7708) on :
The fact is that some men are more rational than others, and presently the illusion of race is more valuable than its rality. The socio-political constructs, if it were to be re-assessed, its present promotors will surely suffer because myth and deception will be exposed and whatevr one sows, the same he shall reap.
There is an impetus to maintain the 'race' reality because it carries a power quotient that will be destroyed and there are those who wish that it remain in force for control to persist!
Posted by Clyde Winters (Member # 10129) on :
Topdog
quote: Clyde, in view of the *FACT* that bioanthropologists and geneticists are increasingly duscarding racial classification, wouldn't it seem that he(Gill) is a bit of an anomally?
Not really, forensic anthropologists are helping police determine the identity of many murder victims everyday successfully.
.
Posted by Clyde Winters (Member # 10129) on :
Yezid924
quote: The fact is that some men are more rational than others, and presently the illusion of race is more valuable than its rality. The socio-political constructs, if it were to be re-assessed, its present promotors will surely suffer because myth and deception will be exposed and whatevr one sows, the same he shall reap.
There is an impetus to maintain the 'race' reality because it carries a power quotient that will be destroyed and there are those who wish that it remain in force for control to persist!
You are wrong using race allows scientists to be specific in their identification of individuals and populations.
This why many Geneticist continue to use race in their research.
: Hum Immunol. 2006 Jan-Feb;67(1-2):73-84. Epub 2006 Apr 5. Related Articles, Links The haplotype structure of the human major histocompatibility complex.Alper CA, Larsen CE, Dubey DP, Awdeh ZL, Fici DA, Yunis EJ.CBR Institute for Biomedical Research, Boston, MA 02115, USA; Department of Pediatrics, Harvard Medical School, Boston, MA 02115, USA.There is great interest in the use of single-nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) analysis to localize human disease genes. The results suggest that the human genome, including the major histocompatibility complex (MHC), consists largely of 5- to 200-kb blocks of sequence fixity between which random recombination occurs. Direct determination of MHC haplotypes from family studies also demonstrates similar-sized blocks, but otherwise gives a very different picture, with a third to a half of Caucasian haplotypes fixed from HLA-B to HLA-DR/DQ (at least 1 Mb) as conserved extended haplotypes (CEHs), some of which encompass more than 3 Mb. These fixed haplotypes differ in frequency both in different Caucasian subpopulations and in Caucasian patients with HLA-associated diseases, complicating disease susceptibility gene localization. The inherent inability of LD analysis to "see" DNA fixity beyond three markers contributes to the failure of SNP/LD analysis to define in detail or even detect CEHs in the MHC and probably elsewhere in the genome. More importantly, the use of statistical analysis, rather than direct haplotype determination and counting, fails to reveal the details of haplotype structure essential for gene localization. Given the oversimplified picture of the MHC (and probably the rest of the genome) provided only by SNP/LD-defined blocks, it is questionable whether this approach will be of great help in disease susceptibility gene localization or identification.
Br J Haematol. 1997 Aug;98(2):356-64. Related Articles, Links
Specificity and sensitivity of RHD genotyping methods by PCR-based DNA amplification.
Aubin JT, Le Van Kim C, Mouro I, Colin Y, Bignozzi C, Brossard Y, Cartron JP.
Centre d'Hemobiologie Perinale, Paris, France.
We have compared the sensitivity and specificity of four PCR methods of RHD gene detection using different sets of primers located in the regions of highest divergence between the RHD and RHCE genes, notably exon 10 (method I), exon 7 (method II), exon 4 (method III) and intron 4 (method IV). Methods I-III were the most sensitive and gave a detectable signal with D-pos/D-neg mixtures containing only 0.001% D-positive cells. Moreover, method II could detect the equivalent DNA amount present in only three nucleated cells in the assay without hybridization of PCR products, whereas the sensitivity of the other methods was 10-50 times less. Investigation of D variants indicated that false-negative results were obtained with method II (D(IVb) variant), method III (D(VI) and DFR variants) and method IV (D(VI) variants), but not method I. Weak D (D(u)) was correctly detected as D-positive by all methods, but most cases of Rh(null) appeared as false-positives, as they carry normal RH genes that are not phenotypically expressed. Some false-positive results were obtained with method I in a few Caucasian DNA samples serotyped as RhD-neg but carrying a C- or E-allele, whereas a high incidence of false-positives was found among non-Caucasian Rh-negative samples by all methods. In the Caucasian population, however, we found a full correlation between the predicted genotype and observed phenotype at birth of 92 infants. Although we routinely use the four methods for RHD genotyping, a PCR strategy based on at least two methods is recommended.
Hum Immunol. 2006 Jan-Feb;67(1-2):125-39. Epub 2005 Nov 4. Related Articles, Links
Disease Relevant HLA Class II Alleles Isolated by Genotypic, Haplotypic, and Sequence Analysis in North American Caucasians With Pemphigus Vulgaris.
Lee E, Lendas KA, Chow S, Pirani Y, Gordon D, Dionisio R, Nguyen D, Spizuoco A, Fotino M, Zhang Y, Sinha AA.
Department of Dermatology, Weill Medical College of Cornell University, New York, NY.
Early studies of genetic susceptibility to pemphigus vulgaris (PV) showed associations between human leukocyte antigen (HLA) DR4 and DR6 and disease. The emergence of DNA sequencing techniques has implicated numerous DRB1 and DQB1 loci in various populations, leading to confusion regarding which exact alleles confer susceptibility. The strong linkage disequilibrium among DR and DQ HLA alleles further complicates the investigation of the true susceptibility loci. In this study, we report genotyping data for the largest sampling of North American Caucasian non-Jewish and Ashkenazi Jewish PV patients studied to date and compare our data with other population studies. To pinpoint true susceptibility, alleles among overrepresented sequences, we applied a step-wise reductionist analysis through (1) determination of the degree of linkage disequilibrium (LD) between purportedly associated alleles, (2) haplotype frequencies comparisons, and (3) primary sequence comparisons of disease-associated versus non-disease-associated alleles to identify crucial differences in amino acid residues in putative peptide binding pockets. Collectively, our data provide extended support for the hypothesis that the HLA associations in Caucasian PV patients map to DRB1*0402 and DQB1*0503 alone. Further structure-function studies will be required to define the exact mechanisms of HLA-mediated control of susceptibility and resistance to disease.
PMID: 16698434 [PubMed - in process]
Ann Hum Genet. 2006 May;70(Pt 3):350-9. Related Articles, Links
A comparison of individual genotyping and pooled DNA analysis for polymorphism validation prior to large-scale genetic studies.
Yang HC, Lin CH, Hung SI, Fann CS.
Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan 115.
Polymorphism validation is an important issue in genetic studies because only polymorphic markers provide useful information. We analyzed genetic data for 180 SNPs in the human major histocompatibility complex region in Caucasian and Taiwanese populations, and evaluated ethnic heterogeneity between these populations to illustrate the importance of polymorphism validation. An initial individual genotyping experiment (IGE) with 95 samples was compared with a DNA pooling allele-typing experiment (PAE) of 630 individuals for polymorphism validation based on authentic data sets. Afterwards, all samples were genotyped individually in a confirmation study. Under narrow (broad) polymorphism criteria, 24 (41) polymorphic SNPs in Caucasians could not be validated in the Taiwanese population, suggesting a 13% (23%) inconsistency rate and revealing a strong discrepancy between genetic backgrounds, probably due to ethnic heterogeneity. IGE yielded high sensitivity and specificity for polymorphism validation, but may be sensitive to sampling variation. PAE showed high sensitivity (97%) and specificity (100%) using a narrow polymorphism criterion, but reduced specificity (83%) using a broad criterion. Public domain polymorphism databases should therefore be used with caution and polymorphism validation should be performed routinely prior to conducting large-scale genetic studies. PAE is a cost-saving, reliable alternative to IGE for polymorphism validation, especially for a stringent polymorphism criterion.
.
Posted by rasol (Member # 4592) on :
quote:Not really, forensic anthropologists are helping police determine the identity of many murder victims everyday successfully.
^ For your supposition to be valid - forensics should ONLY be successful when populations can be structured racially, and should *fail* without social race catagories.
But that is not the case, of course.
In fact, Forensics are just as successful in homogeneous countries like Japan were murder victims would not be classified into distinct social races, BUT CAN JUST AS EASILY BE INDIVIDUALLY IDENTIFIED by forensics as in heterogeneous society.
Forensic identification of murder victims doesn't prove the existence of race.
Posted by rasol (Member # 4592) on :
quote:You are wrong using race allows scientists to be specific in their identification of individuals
^ See above. Falsified by the ability of scientists to identify indviduals without catagorising them racially.
If you do not accept this as falsification of your theory - then your theory is non-falsifiable and therefore non-scientific to begin with.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
quote:Not really, forensic anthropologists are helping police determine the identity of many murder victims everyday successfully.
^ For your supposition to be valid - forensics should ONLY be successful when populations can be structured racially, and should *fail* without social race catagories.
But that is not the case, of course.
In fact, Forensics are just as successful in homogeneous countries like Japan were murder victims would not be classified into distinct social races, BUT CAN JUST AS EASILY BE INDIVIDUALLY IDENTIFIED by forensics as in heterogeneous society.
Forensic identification of murder victims doesn't prove the existence of race.
This is false. The fact that it can be used in multiracial societies to identify "races" support the idea that races exist. The fact that scientist still use the term to identify the race of their patients also validates the reality of race. This is supported by the use of race by geneticists to identify populations.
: Hum Immunol. 2006 Jan-Feb;67(1-2):73-84. Epub 2006 Apr 5. Related Articles, Links The haplotype structure of the human major histocompatibility complex.Alper CA, Larsen CE, Dubey DP, Awdeh ZL, Fici DA, Yunis EJ.CBR Institute for Biomedical Research, Boston, MA 02115, USA; Department of Pediatrics, Harvard Medical School, Boston, MA 02115, USA.There is great interest in the use of single-nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) analysis to localize human disease genes. The results suggest that the human genome, including the major histocompatibility complex (MHC), consists largely of 5- to 200-kb blocks of sequence fixity between which random recombination occurs. Direct determination of MHC haplotypes from family studies also demonstrates similar-sized blocks, but otherwise gives a very different picture, with a third to a half of Caucasian haplotypes fixed from HLA-B to HLA-DR/DQ (at least 1 Mb) as conserved extended haplotypes (CEHs), some of which encompass more than 3 Mb. These fixed haplotypes differ in frequency both in different Caucasian subpopulations and in Caucasian patients with HLA-associated diseases, complicating disease susceptibility gene localization. The inherent inability of LD analysis to "see" DNA fixity beyond three markers contributes to the failure of SNP/LD analysis to define in detail or even detect CEHs in the MHC and probably elsewhere in the genome. More importantly, the use of statistical analysis, rather than direct haplotype determination and counting, fails to reveal the details of haplotype structure essential for gene localization. Given the oversimplified picture of the MHC (and probably the rest of the genome) provided only by SNP/LD-defined blocks, it is questionable whether this approach will be of great help in disease susceptibility gene localization or identification.
Br J Haematol. 1997 Aug;98(2):356-64. Related Articles, Links
Specificity and sensitivity of RHD genotyping methods by PCR-based DNA amplification.
Aubin JT, Le Van Kim C, Mouro I, Colin Y, Bignozzi C, Brossard Y, Cartron JP.
Centre d'Hemobiologie Perinale, Paris, France.
We have compared the sensitivity and specificity of four PCR methods of RHD gene detection using different sets of primers located in the regions of highest divergence between the RHD and RHCE genes, notably exon 10 (method I), exon 7 (method II), exon 4 (method III) and intron 4 (method IV). Methods I-III were the most sensitive and gave a detectable signal with D-pos/D-neg mixtures containing only 0.001% D-positive cells. Moreover, method II could detect the equivalent DNA amount present in only three nucleated cells in the assay without hybridization of PCR products, whereas the sensitivity of the other methods was 10-50 times less. Investigation of D variants indicated that false-negative results were obtained with method II (D(IVb) variant), method III (D(VI) and DFR variants) and method IV (D(VI) variants), but not method I. Weak D (D(u)) was correctly detected as D-positive by all methods, but most cases of Rh(null) appeared as false-positives, as they carry normal RH genes that are not phenotypically expressed. Some false-positive results were obtained with method I in a few Caucasian DNA samples serotyped as RhD-neg but carrying a C- or E-allele, whereas a high incidence of false-positives was found among non-Caucasian Rh-negative samples by all methods. In the Caucasian population, however, we found a full correlation between the predicted genotype and observed phenotype at birth of 92 infants. Although we routinely use the four methods for RHD genotyping, a PCR strategy based on at least two methods is recommended.
Hum Immunol. 2006 Jan-Feb;67(1-2):125-39. Epub 2005 Nov 4. Related Articles, Links
Disease Relevant HLA Class II Alleles Isolated by Genotypic, Haplotypic, and Sequence Analysis in North American Caucasians With Pemphigus Vulgaris.
Lee E, Lendas KA, Chow S, Pirani Y, Gordon D, Dionisio R, Nguyen D, Spizuoco A, Fotino M, Zhang Y, Sinha AA.
Department of Dermatology, Weill Medical College of Cornell University, New York, NY.
Early studies of genetic susceptibility to pemphigus vulgaris (PV) showed associations between human leukocyte antigen (HLA) DR4 and DR6 and disease. The emergence of DNA sequencing techniques has implicated numerous DRB1 and DQB1 loci in various populations, leading to confusion regarding which exact alleles confer susceptibility. The strong linkage disequilibrium among DR and DQ HLA alleles further complicates the investigation of the true susceptibility loci. In this study, we report genotyping data for the largest sampling of North American Caucasian non-Jewish and Ashkenazi Jewish PV patients studied to date and compare our data with other population studies. To pinpoint true susceptibility, alleles among overrepresented sequences, we applied a step-wise reductionist analysis through (1) determination of the degree of linkage disequilibrium (LD) between purportedly associated alleles, (2) haplotype frequencies comparisons, and (3) primary sequence comparisons of disease-associated versus non-disease-associated alleles to identify crucial differences in amino acid residues in putative peptide binding pockets. Collectively, our data provide extended support for the hypothesis that the HLA associations in Caucasian PV patients map to DRB1*0402 and DQB1*0503 alone. Further structure-function studies will be required to define the exact mechanisms of HLA-mediated control of susceptibility and resistance to disease.
PMID: 16698434 [PubMed - in process]
Ann Hum Genet. 2006 May;70(Pt 3):350-9. Related Articles, Links
A comparison of individual genotyping and pooled DNA analysis for polymorphism validation prior to large-scale genetic studies.
Yang HC, Lin CH, Hung SI, Fann CS.
Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan 115.
Polymorphism validation is an important issue in genetic studies because only polymorphic markers provide useful information. We analyzed genetic data for 180 SNPs in the human major histocompatibility complex region in Caucasian and Taiwanese populations, and evaluated ethnic heterogeneity between these populations to illustrate the importance of polymorphism validation. An initial individual genotyping experiment (IGE) with 95 samples was compared with a DNA pooling allele-typing experiment (PAE) of 630 individuals for polymorphism validation based on authentic data sets. Afterwards, all samples were genotyped individually in a confirmation study. Under narrow (broad) polymorphism criteria, 24 (41) polymorphic SNPs in Caucasians could not be validated in the Taiwanese population, suggesting a 13% (23%) inconsistency rate and revealing a strong discrepancy between genetic backgrounds, probably due to ethnic heterogeneity. IGE yielded high sensitivity and specificity for polymorphism validation, but may be sensitive to sampling variation. PAE showed high sensitivity (97%) and specificity (100%) using a narrow polymorphism criterion, but reduced specificity (83%) using a broad criterion. Public domain polymorphism databases should therefore be used with caution and polymorphism validation should be performed routinely prior to conducting large-scale genetic studies. PAE is a cost-saving, reliable alternative to IGE for polymorphism validation, especially for a stringent polymorphism criterion.
Posted by rasol (Member # 4592) on :
quote:
Rasol
Not really, forensic anthropologists are helping police determine the identity of many murder victims everyday successfully.
^ For your supposition to be valid - forensics should ONLY be successful when populations can be structured racially, and should *fail* without social race catagories.
But that is not the case, of course.
In fact, Forensics are just as successful in homogeneous countries like Japan were murder victims would not be classified into distinct social races, BUT CAN JUST AS EASILY BE INDIVIDUALLY IDENTIFIED by forensics as in heterogeneous society.
Forensic identification of murder victims doesn't prove the existence of race.
quote:Winters: This is false. The fact that it can be used in multiracial societies to identify "races" support the idea that races exist.
Incorrect. That is a circular argument not a form of proof.
The fact that the forensics can identify individuals - it's principal function - without resorting to race falsifies this argument.
Most anthropologists have abandoned the concept of race as a research tool and as a valid representation of human biological diversity.
Yet, race identification continues to be one of the central foci of forensic anthropological casework and research.
It is maintained in this paper that the successful assignment of race to a skeletal specimen is not a vindication of the race concept, but merely a prediction that an individual, while alive was assigned to a particular socially constructed 'racial' category.
A specimen may display features that point to African ancestry.
In this country that person is likely to have been labeled Black *regardless of whether or not such a race actually exists in nature.*
Forensic classification into race is not per se proof of anything.
Moreover we have shown you examples of studies wherein forensic anthropology is objectively tested - and falsly assigns homogeneous groups into provably false racial catagories such as classifying Spanish as San Bushman, and Nubians as Japanese.
You have not responded to any of these studies, and the studies you do post, neither refute them, or prove the existence of races....or even CLAIM to prove the existence of races.
Posted by rasol (Member # 4592) on :
quote:Polymorphism validation is an important issue in genetic studies because only polymorphic markers provide useful information. We analyzed genetic data for 180 SNPs in the human major histocompatibility complex region in Caucasian and Taiwanese populations, and evaluated ethnic heterogeneity between these populations to illustrate the importance of polymorphism validation
I take it you reposted this because you want us to believe that different lineages in "Caucasians" and Taiwanese prove the existence of race?
To test this theory all populations with different lineages would have to be classified into different races.
For example - Dravidians and Africans have *COMPLETELY DIFFERENT LINEAGES* and are more distant from one another genetically than are Chinese and Europeans.
So according to you - Dravidians and Africans are two different races? Correct?
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote: I take it you reposted this because you want us to believe that different lineages in "Caucasians" and Taiwanese prove the existence of race?
To test this theory all populations with different lineages would have to be classified into different races.
For example - Dravidians and Africans have *COMPLETELY DIFFERENT LINEAGES* and are more distant from one another genetically than are Chinese and Europeans.
So according to you - Dravidians and Africans are two different races? Correct?
No Dravidians and Africans are of the same race. I have never read where the geneticists have claimed that the Dravidians were Caucasian. The literature makes it clear that they are also not classified as Eurasian.
So what race does the literature claim the Dravidians belong too?
Let's get back to the topic of this thread. You guys claim that racial terms are not used in the genetics literature. But I have presented papers to show that the concept of race is still being used by geneticists to define populations and individuals based on their haplotype and haplogroup. This research makes it clear that race is still a dominant research term used by geneticists, like other scientists.
If they continue to use the term caucasian, they are still discussing race.
.
Posted by Supercar (Member # 6477) on :
You want to see how accurate Forensic methodology is, see:
"Variation in racial classification represents the lack of a Spanish sample within the FORDISC 2.0 databases as well as the human variation inherent within them. Individual crania were classified according to the best fit with the existing samples of the database, but the samples clearly were inadequate to elucidate the specific geographical origin of the overall Spanish sample…some crania were classified into groups with no clear geographic or ancestral relationship with the Spanish sample…
The authors also agree that additional and more complete samples from different geographical regions and groups are needed to augment the existing databases."
quote:No Dravidians and Africans are of the same race.
..this claim contradicts your interpreation of the study you just posted twice now, since Dravidians have completely different SNP markers from Africans.
quote:I have never read where the geneticists have claimed that the Dravidians were Caucasian.
Cavelli Sforza has claimed this. But the point is they have completely different SNP markers than Africans - so you *must* classify them into different races according to your own 'reasoning'.....
Or admit that such classifications are invalid.
Choose one or the other, please.
quote:Let's get back to the topic of this thread.
I'm discussing the study on SNP markers that you posted twice, and how it inconsistent with your claims of races denoted by differentiated snp markers.
Now you want to change the subject.
Is that out of recognition of your own internal contradictions with regards to it?
quote:But I have presented papers to show that the concept of race is still being used
No you haven't. You presented papers that had terms in them that are associated with race. Most studies directly refuting the validity of race, have racial terms in them. I posted a study on racial classification on Spanish Crania filled with racial terms - and yet providing a devastating critique of the notion of classifying crania by race - which you have not refuted.
In contrast you have not posted any study directly claiming to prove the existence of race.
quote:If they continue to use the term caucasian, they are still discussing race.
No, because the valid ethnic term caucasian like mongolian predates the ideology of race typology, but more importantly...mere discussion of topic cannot be used as a form of proof of point.
There are scientific study on psychic healing, on dowsing, on UFo's and ESP...most of them discrediting the above.
Posted by Supercar (Member # 6477) on :
There is more; this one Myra Wysinger posted on the Nile Valley forum:
quote: o you haven't. You presented papers that had terms in them that are associated with race. Most studies directly refuting the validity of race, have racial terms in them. I posted a study on racial classification on Spanish Crania filled with racial terms - and yet providing a devastating critique of the notion of classifying crania by race - which you have not refuted.
In contrast you have not posted any study directly claiming to prove the existence of race.
quote:I have never read where the geneticists have claimed that the Dravidians were Caucasian.
Cavelli Sforza has claimed this. But the point is they have completely different SNP markers than Africans - so you *must* classify them into different races according to your own 'reasoning'.....
This is double speech. Use of the term caucasian means the authors of these articles believe different races exist, including Cavelli, if he said the Dravidians were caucasian. This falsifies your theory that scientist, especially geneticist no longer believe in race.
.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Clyde Winters:
This is double speech. Use of the term caucasian means the authors of these articles believe different races exist, including Cavelli, if he said the Dravidians were caucasian. This falsifies your theory that scientist, especially geneticist no longer believe in race.
It isn't the question of what an individual geneticist supposedly thinks, much less his/her double talk, but it is more of a question of what that individual can prove by arguing for the existence of discrete biological "races" in humans; it hasn't been done! If somebody has done so - let me know. I'll get on their case right away. Posted by rasol (Member # 4592) on :
quote:Use of the term caucasian means the authors of these articles believe different races exist.
Not necessarily, but this comment is also irrelevant, since, as Supercar rightly noted, a proper assessment of scientific studies denotes what is or is not proven. Not your opinion of what somebody believes, which has no scientific value.
quote:Cavelli, if he said the Dravidians were caucasian. This falsifies your theory that scientist, especially geneticist no longer believe in race.
If I had such a theory pertaining to what all scientists 'believe in', it would certainly falsify it. But I don't. So your comment is moot.
As for Cavelli Sforza - he states correctly:
"Classification into race has proven to be a futile exercise".
Dr. Winters, your views of race provide a case in point:
You post a study intending to show us that differences in SNP markers in Caucasians and Taiwanese proves the existence of race [note: not actually what the study itself asserts],
You then completely contradict yourself by denying that difference in SNP markers between Africans and Dravidians can be used to prove they belong to different "races".
This is a clear contradiction in your discourse and it lends credence to Sforza's statement on the futility of said classifications.
And no, your opinion of Sforza's beliefs - in race - in religion - in politics, etc.. doesn't matter.
What matters is that his statement was factual, and you confirmed it.
Posted by rasol (Member # 4592) on :
^ Dr. Winters, rather than talk around the above, if you disagree with it please refute it directly in the following manner.
1) show us that different SNP markers can be used to systematically classify populations into races.
2) list the geneticist who support this theory with direct, clear statements to the effect that this is so.
3) present a study classifying Dravidians and Africans into a distinct race based upon specific SNP markers.
thanks.
Posted by rasol (Member # 4592) on :
quote:Originally posted by Supercar: You want to see how accurate Forensic methodology is, see:
"Variation in racial classification represents the lack of a Spanish sample within the FORDISC 2.0 databases as well as the human variation inherent within them. Individual crania were classified according to the best fit with the existing samples of the database, but the samples clearly were inadequate to elucidate the specific geographical origin of the overall Spanish sample…some crania were classified into groups with no clear geographic or ancestral relationship with the Spanish sample…
The authors also agree that additional and more complete samples from different geographical regions and groups are needed to augment the existing databases."
Anyone serious about proving the existence of biological races would address the above.
When no one even tries....?
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
^ Dr. Winters, rather than talk around the above, if you disagree with it please refute it directly in the following manner.
1) show us that different SNP markers can be used to systematically classify populations into races.
2) list the geneticist who support this theory with direct, clear statements to the effect that this is so.
3) present a study classifying Dravidians and Africans into a distinct race based upon specific SNP markers.
The subject of this thread is does race exist. It was originally claimed that race does not exist based on Templeton:
quote:
"Race is a real cultural, political and economic concept in society, but it is not a biological concept, and that unfortunately is what many people wrongfully consider to be the essence of race in humans -- genetic differences," Templeton said. "Evolutionary history is the key to understanding race, and new molecular biology techniques offer so much on recent evolutionary history. I wanted to bring some objectivity to the topic. This very objective analysis shows the outcome is not even a close call: There's nothing even like a really distinct subdivision of humanity."
1)I have shown that this is untrue. I presented evidence that Forensic scientists continue to use "race" as a way to classify humans
2) I have presented evidence that even geneticist use race when discussing the haplotype and haplogroup of individuals and populations.
These facts indicate that Templeton is wrong scientist still recognize a distinct subdivision of humanity.
In your post on the Templeton statement that guides this thread you claim that it can only be refuted by answering the following questions:
Rasol
quote: 1) show us that different SNP markers can be used to systematically classify populations into races.
2) list the geneticist who support this theory with direct, clear statements to the effect that this is so.
3) present a study classifying Dravidians and Africans into a distinct race based upon specific SNP markers.
[/B]
But this is uncessary because they were not part of Templeton's statement. Bu I will answer them anyway.
1) show us that different SNP markers can be used to systematically classify populations into races.
It is not necessary to provide any specific SNP markers used to systematically classify populations into races. Research studies published by geneticists clearly indicate that they continue to use race to describe poulations in the research literature as I have pointed out in previous post that I will repose below.
[/b]
: Hum Immunol. 2006 Jan-Feb;67(1-2):73-84. Epub 2006 Apr 5. Related Articles, Links The haplotype structure of the human major histocompatibility complex.Alper CA, Larsen CE, Dubey DP, Awdeh ZL, Fici DA, Yunis EJ.CBR Institute for Biomedical Research, Boston, MA 02115, USA; Department of Pediatrics, Harvard Medical School, Boston, MA 02115, USA.There is great interest in the use of single-nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) analysis to localize human disease genes. The results suggest that the human genome, including the major histocompatibility complex (MHC), consists largely of 5- to 200-kb blocks of sequence fixity between which random recombination occurs. Direct determination of MHC haplotypes from family studies also demonstrates similar-sized blocks, but otherwise gives a very different picture, with a third to a half of Caucasian haplotypes fixed from HLA-B to HLA-DR/DQ (at least 1 Mb) as conserved extended haplotypes (CEHs), some of which encompass more than 3 Mb. These fixed haplotypes differ in frequency both in different Caucasian subpopulations and in Caucasian patients with HLA-associated diseases, complicating disease susceptibility gene localization. The inherent inability of LD analysis to "see" DNA fixity beyond three markers contributes to the failure of SNP/LD analysis to define in detail or even detect CEHs in the MHC and probably elsewhere in the genome. More importantly, the use of statistical analysis, rather than direct haplotype determination and counting, fails to reveal the details of haplotype structure essential for gene localization. Given the oversimplified picture of the MHC (and probably the rest of the genome) provided only by SNP/LD-defined blocks, it is questionable whether this approach will be of great help in disease susceptibility gene localization or identification.
Br J Haematol. 1997 Aug;98(2):356-64. Related Articles, Links
Specificity and sensitivity of RHD genotyping methods by PCR-based DNA amplification.
Aubin JT, Le Van Kim C, Mouro I, Colin Y, Bignozzi C, Brossard Y, Cartron JP.
Centre d'Hemobiologie Perinale, Paris, France.
We have compared the sensitivity and specificity of four PCR methods of RHD gene detection using different sets of primers located in the regions of highest divergence between the RHD and RHCE genes, notably exon 10 (method I), exon 7 (method II), exon 4 (method III) and intron 4 (method IV). Methods I-III were the most sensitive and gave a detectable signal with D-pos/D-neg mixtures containing only 0.001% D-positive cells. Moreover, method II could detect the equivalent DNA amount present in only three nucleated cells in the assay without hybridization of PCR products, whereas the sensitivity of the other methods was 10-50 times less. Investigation of D variants indicated that false-negative results were obtained with method II (D(IVb) variant), method III (D(VI) and DFR variants) and method IV (D(VI) variants), but not method I. Weak D (D(u)) was correctly detected as D-positive by all methods, but most cases of Rh(null) appeared as false-positives, as they carry normal RH genes that are not phenotypically expressed. Some false-positive results were obtained with method I in a few Caucasian DNA samples serotyped as RhD-neg but carrying a C- or E-allele, whereas a high incidence of false-positives was found among non-Caucasian Rh-negative samples by all methods. In the Caucasian population, however, we found a full correlation between the predicted genotype and observed phenotype at birth of 92 infants. Although we routinely use the four methods for RHD genotyping, a PCR strategy based on at least two methods is recommended.
Hum Immunol. 2006 Jan-Feb;67(1-2):125-39. Epub 2005 Nov 4. Related Articles, Links
Disease Relevant HLA Class II Alleles Isolated by Genotypic, Haplotypic, and Sequence Analysis in North American Caucasians With Pemphigus Vulgaris.
Lee E, Lendas KA, Chow S, Pirani Y, Gordon D, Dionisio R, Nguyen D, Spizuoco A, Fotino M, Zhang Y, Sinha AA.
Department of Dermatology, Weill Medical College of Cornell University, New York, NY.
Early studies of genetic susceptibility to pemphigus vulgaris (PV) showed associations between human leukocyte antigen (HLA) DR4 and DR6 and disease. The emergence of DNA sequencing techniques has implicated numerous DRB1 and DQB1 loci in various populations, leading to confusion regarding which exact alleles confer susceptibility. The strong linkage disequilibrium among DR and DQ HLA alleles further complicates the investigation of the true susceptibility loci. In this study, we report genotyping data for the largest sampling of North American Caucasian non-Jewish and Ashkenazi Jewish PV patients studied to date and compare our data with other population studies. To pinpoint true susceptibility, alleles among overrepresented sequences, we applied a step-wise reductionist analysis through (1) determination of the degree of linkage disequilibrium (LD) between purportedly associated alleles, (2) haplotype frequencies comparisons, and (3) primary sequence comparisons of disease-associated versus non-disease-associated alleles to identify crucial differences in amino acid residues in putative peptide binding pockets. Collectively, our data provide extended support for the hypothesis that the HLA associations in Caucasian PV patients map to DRB1*0402 and DQB1*0503 alone. Further structure-function studies will be required to define the exact mechanisms of HLA-mediated control of susceptibility and resistance to disease.
PMID: 16698434 [PubMed - in process]
Ann Hum Genet. 2006 May;70(Pt 3):350-9. Related Articles, Links
A comparison of individual genotyping and pooled DNA analysis for polymorphism validation prior to large-scale genetic studies.
Yang HC, Lin CH, Hung SI, Fann CS.
Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan 115.
Polymorphism validation is an important issue in genetic studies because only polymorphic markers provide useful information. We analyzed genetic data for 180 SNPs in the human major histocompatibility complex region in Caucasian and Taiwanese populations, and evaluated ethnic heterogeneity between these populations to illustrate the importance of polymorphism validation. An initial individual genotyping experiment (IGE) with 95 samples was compared with a DNA pooling allele-typing experiment (PAE) of 630 individuals for polymorphism validation based on authentic data sets. Afterwards, all samples were genotyped individually in a confirmation study. Under narrow (broad) polymorphism criteria, 24 (41) polymorphic SNPs in Caucasians could not be validated in the Taiwanese population, suggesting a 13% (23%) inconsistency rate and revealing a strong discrepancy between genetic backgrounds, probably due to ethnic heterogeneity. IGE yielded high sensitivity and specificity for polymorphism validation, but may be sensitive to sampling variation. PAE showed high sensitivity (97%) and specificity (100%) using a narrow polymorphism criterion, but reduced specificity (83%) using a broad criterion. Public domain polymorphism databases should therefore be used with caution and polymorphism validation should be performed routinely prior to conducting large-scale genetic studies. PAE is a cost-saving, reliable alternative to IGE for polymorphism validation, especially for a stringent polymorphism criterion.
2) list the geneticist who support this theory with direct, clear statements to the effect that this is so.
This question was already answered above when I provided the published papers where racial terms such as caucasian is frequently used for the "white'" race. Use of the term caucasian is a clear statement to the effect race continues to play a role in the research of geneticists as proven by the papers discussed above.
3) present a study classifying Dravidians and Africans into a distinct race based upon specific SNP markers.
You already mentioned one the Cavelli Sforza study.
Clyde Winters [quote]:I have never read where the geneticists have claimed that the Dravidians were Caucasian.
Rasol
quote: Cavelli Sforza has claimed this.
Since Sforza classifies the Dravidians as caucasian proves that geneticists use racial terms to describe populations. It refutes Templeton's claim that
quote:
"Race is a real cultural, political and economic concept in society, but it is not a biological concept, and that unfortunately is what many people wrongfully consider to be the essence of race in humans -- genetic differences," Templeton said. "Evolutionary history is the key to understanding race, and new molecular biology techniques offer so much on recent evolutionary history. I wanted to bring some objectivity to the topic. This very objective analysis shows the outcome is not even a close call: There's nothing even like a really distinct subdivision of humanity."
If their is no distinct subdivision of humanity why do geneticists continue to use racial terms in their research and even Sforza call the Dravidians caucasians?
.
Posted by rasol (Member # 4592) on :
quote:Originally posted by Clyde Winters: The subject of this thread is does race exist. It was originally claimed that race does not exist based on Templeton:
quote:
Templeton: "Race is a real cultural, political and economic concept in society, it is not a biological concept, and that unfortunately is what many people wrongfully consider to be the essence of race in humans -- genetic differences," Templeton said. "Evolutionary history is the key to understanding race, and new molecular biology techniques offer so much on recent evolutionary history. I wanted to bring some objectivity to the topic. This very objective analysis shows the outcome is not even a close call: There's nothing even like a really distinct subdivision of humanity."
Yes geneticist Templeton's statement is correct.
quote:1)Winters: I have shown that this is untrue.
No you have not addessed it in anyway.
quote:Winters: I presented evidence that Forensic scientists continue to use "race" as a way to classify humans
1) Templeton does not claim otherwise so that does not refute him.
2) We've shown you three different studies from Forensic scientists falsifying your claim that classification into races can be validated thru forensics. You have not addresses these studies; presented any studies refuting them, or presenting any studies directly supporting your position.
quote: These facts indicate that Templeton is wrong scientist still recognize a distinct subdivision of humanity.
Incorrect - biology recognises only 1 division of humanity - homo sapiens, there are no sub-divisions. You have presented no scientific study claiming sub-divisions of humanity.
Templeton is correct, and you have presented no evidence of anything, and refute nothing.
Posted by rasol (Member # 4592) on :
quote:Rasol asks: 1) show us that different SNP markers can be used to systematically classify populations into races.
2) list the geneticist who support this theory with direct, clear statements to the effect that this is so.
3) present a study classifying Dravidians and Africans into a distinct race based upon specific SNP markers.
quote:Winters: But this is uncessary because they were not part of Templeton's statement.
It is necessary because the study on SNP markers is part of *your statement.*
quote:It is not necessary to provide any specific SNP markers used to systematically classify populations into races.
I asked you to prove that you could do so, because you presented a study on SNP markers as 'evidence.'
Instead you make excuses for why you cannot.
But if you can't or won't do so - then the study you presented on SNP markers cannot be used to support your argument.
Strike 1.
quote:Winters: Research studies published by geneticists clearly indicate that they continue to use race to describe populations
Again: Mere use of folk ethnic or racial labels does not scientifically validate race.
Such labels are ** used ** specifically in studies that conclude that race is invalid, and most importantly - this statement by you does not address my question about SNP markers.
Strike 2.
quote: in the research literature as I have pointed out in previous post that I will repose below.
Reposting the material that led to my question is not answering the question.
Strike 3.
Moving on....
quote:rasol: 2) list the geneticist who support this theory with direct, clear statements to the effect that this is so.
quote:This question was already answered above when I provided the published papers where racial terms such as caucasian is frequently used for the "white'" race.
False statement - as there is no clear direct statement supporting race by any geneticist in those studies.
I use the term caucasian and white - that is not proof that SNP markers define races...a non-sequitur conclusion. Strike 1
quote:Winters: Use of the term caucasian is a clear statement to the effect race
Redundant and non-sequitur, strike 2.
quote: continues to play a role in the research of geneticists as proven by the papers discussed above.
Let's remind everyone of the question you are supposidly answering: show us that different SNP markers can be used to systematically classify populations into races.
Have you shown us this, no you haven't. Strike 3.
quote:rasol 3) present a study classifying Dravidians and Africans into a distinct race based upon specific SNP markers.
quote:Winters: You already mentioned one the Cavelli Sforza study.
No - Sforza does not classify Dravidians and Africans into the same race.
quote:Since Sforza classifies the Dravidians as caucasian proves that geneticists use racial terms to describe populations. It refutes Templeton's claim.
Sforza also refers to Afro-Asiatic language as caucasian. Whatever it says about Sforza, it is completely irrelevant to what Templeton stated, and it is equally irrelevant to my three questions - none of which you ever did get around to answering.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
Sforza also refers to Afro-Asiatic language as caucasian. Whatever it says about Sforza, it is completely irrelevant to what Templeton stated, and it is equally irrelevant to my three questions - none of which you ever did get around to answering.
Here you are wrong. The comments of Sforza are relevant to this discussion.It was Sforza who first began the association of genetics with population movements.
If Sforza is mainly concerned with "race", and he is the originator of the use of this science in anthropology, it is clear that Templetons statement about the absence of race on a genetic level is pure hogwash. Templeton is refuted by Sforza and other geneticists who use racial terms in their research.
[/b]
: Hum Immunol. 2006 Jan-Feb;67(1-2):73-84. Epub 2006 Apr 5. Related Articles, Links The haplotype structure of the human major histocompatibility complex.Alper CA, Larsen CE, Dubey DP, Awdeh ZL, Fici DA, Yunis EJ.CBR Institute for Biomedical Research, Boston, MA 02115, USA; Department of Pediatrics, Harvard Medical School, Boston, MA 02115, USA.There is great interest in the use of single-nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) analysis to localize human disease genes. The results suggest that the human genome, including the major histocompatibility complex (MHC), consists largely of 5- to 200-kb blocks of sequence fixity between which random recombination occurs. Direct determination of MHC haplotypes from family studies also demonstrates similar-sized blocks, but otherwise gives a very different picture, with a third to a half of Caucasian haplotypes fixed from HLA-B to HLA-DR/DQ (at least 1 Mb) as conserved extended haplotypes (CEHs), some of which encompass more than 3 Mb. These fixed haplotypes differ in frequency both in different Caucasian subpopulations and in Caucasian patients with HLA-associated diseases, complicating disease susceptibility gene localization. The inherent inability of LD analysis to "see" DNA fixity beyond three markers contributes to the failure of SNP/LD analysis to define in detail or even detect CEHs in the MHC and probably elsewhere in the genome. More importantly, the use of statistical analysis, rather than direct haplotype determination and counting, fails to reveal the details of haplotype structure essential for gene localization. Given the oversimplified picture of the MHC (and probably the rest of the genome) provided only by SNP/LD-defined blocks, it is questionable whether this approach will be of great help in disease susceptibility gene localization or identification.
Br J Haematol. 1997 Aug;98(2):356-64. Related Articles, Links
Specificity and sensitivity of RHD genotyping methods by PCR-based DNA amplification.
Aubin JT, Le Van Kim C, Mouro I, Colin Y, Bignozzi C, Brossard Y, Cartron JP.
Centre d'Hemobiologie Perinale, Paris, France.
We have compared the sensitivity and specificity of four PCR methods of RHD gene detection using different sets of primers located in the regions of highest divergence between the RHD and RHCE genes, notably exon 10 (method I), exon 7 (method II), exon 4 (method III) and intron 4 (method IV). Methods I-III were the most sensitive and gave a detectable signal with D-pos/D-neg mixtures containing only 0.001% D-positive cells. Moreover, method II could detect the equivalent DNA amount present in only three nucleated cells in the assay without hybridization of PCR products, whereas the sensitivity of the other methods was 10-50 times less. Investigation of D variants indicated that false-negative results were obtained with method II (D(IVb) variant), method III (D(VI) and DFR variants) and method IV (D(VI) variants), but not method I. Weak D (D(u)) was correctly detected as D-positive by all methods, but most cases of Rh(null) appeared as false-positives, as they carry normal RH genes that are not phenotypically expressed. Some false-positive results were obtained with method I in a few Caucasian DNA samples serotyped as RhD-neg but carrying a C- or E-allele, whereas a high incidence of false-positives was found among non-Caucasian Rh-negative samples by all methods. In the Caucasian population, however, we found a full correlation between the predicted genotype and observed phenotype at birth of 92 infants. Although we routinely use the four methods for RHD genotyping, a PCR strategy based on at least two methods is recommended.
Hum Immunol. 2006 Jan-Feb;67(1-2):125-39. Epub 2005 Nov 4. Related Articles, Links
Disease Relevant HLA Class II Alleles Isolated by Genotypic, Haplotypic, and Sequence Analysis in North American Caucasians With Pemphigus Vulgaris.
Lee E, Lendas KA, Chow S, Pirani Y, Gordon D, Dionisio R, Nguyen D, Spizuoco A, Fotino M, Zhang Y, Sinha AA.
Department of Dermatology, Weill Medical College of Cornell University, New York, NY.
Early studies of genetic susceptibility to pemphigus vulgaris (PV) showed associations between human leukocyte antigen (HLA) DR4 and DR6 and disease. The emergence of DNA sequencing techniques has implicated numerous DRB1 and DQB1 loci in various populations, leading to confusion regarding which exact alleles confer susceptibility. The strong linkage disequilibrium among DR and DQ HLA alleles further complicates the investigation of the true susceptibility loci. In this study, we report genotyping data for the largest sampling of North American Caucasian non-Jewish and Ashkenazi Jewish PV patients studied to date and compare our data with other population studies. To pinpoint true susceptibility, alleles among overrepresented sequences, we applied a step-wise reductionist analysis through (1) determination of the degree of linkage disequilibrium (LD) between purportedly associated alleles, (2) haplotype frequencies comparisons, and (3) primary sequence comparisons of disease-associated versus non-disease-associated alleles to identify crucial differences in amino acid residues in putative peptide binding pockets. Collectively, our data provide extended support for the hypothesis that the HLA associations in Caucasian PV patients map to DRB1*0402 and DQB1*0503 alone. Further structure-function studies will be required to define the exact mechanisms of HLA-mediated control of susceptibility and resistance to disease.
PMID: 16698434 [PubMed - in process]
Ann Hum Genet. 2006 May;70(Pt 3):350-9. Related Articles, Links
A comparison of individual genotyping and pooled DNA analysis for polymorphism validation prior to large-scale genetic studies.
Yang HC, Lin CH, Hung SI, Fann CS.
Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan 115.
Polymorphism validation is an important issue in genetic studies because only polymorphic markers provide useful information. We analyzed genetic data for 180 SNPs in the human major histocompatibility complex region in Caucasian and Taiwanese populations, and evaluated ethnic heterogeneity between these populations to illustrate the importance of polymorphism validation. An initial individual genotyping experiment (IGE) with 95 samples was compared with a DNA pooling allele-typing experiment (PAE) of 630 individuals for polymorphism validation based on authentic data sets. Afterwards, all samples were genotyped individually in a confirmation study. Under narrow (broad) polymorphism criteria, 24 (41) polymorphic SNPs in Caucasians could not be validated in the Taiwanese population, suggesting a 13% (23%) inconsistency rate and revealing a strong discrepancy between genetic backgrounds, probably due to ethnic heterogeneity. IGE yielded high sensitivity and specificity for polymorphism validation, but may be sensitive to sampling variation. PAE showed high sensitivity (97%) and specificity (100%) using a narrow polymorphism criterion, but reduced specificity (83%) using a broad criterion. Public domain polymorphism databases should therefore be used with caution and polymorphism validation should be performed routinely prior to conducting large-scale genetic studies. PAE is a cost-saving, reliable alternative to IGE for polymorphism validation, especially for a stringent polymorphism criterion.
.
Posted by rasol (Member # 4592) on :
quote:Here you are wrong. The comments of Sforza are relevant to this discussion.
I know, I'm the one who posted them. "classification into races has proven a futile exercise" - C Sforza.
However they obviously don't answer my question to you.
Re-spamming the posts on SNP/HLA studies that I asked you the questions about, is also not answering the questions.
I'm still waiting......
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
Re-spamming the posts on SNP studies that I asked you the questions about, is also not answering the questions.
I'm still waiting......
I answered the questions earlier. The issue is not SNP studies. The thread theme is "Race dosen't exist. It is clear that race does exist as a concept in genetic studies. Below they are repeated.
1) show us that different SNP markers can be used to systematically classify populations into races. [/b]
It is not necessary to provide any specific SNP markers used to systematically classify populations into races. Research studies published by geneticists clearly indicate that they continue to use race to describe poulations in the research literature as I have pointed out in previous post that I will repose below.
[/b]
: Hum Immunol. 2006 Jan-Feb;67(1-2):73-84. Epub 2006 Apr 5. Related Articles, Links The haplotype structure of the human major histocompatibility complex.Alper CA, Larsen CE, Dubey DP, Awdeh ZL, Fici DA, Yunis EJ.CBR Institute for Biomedical Research, Boston, MA 02115, USA; Department of Pediatrics, Harvard Medical School, Boston, MA 02115, USA.There is great interest in the use of single-nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) analysis to localize human disease genes. The results suggest that the human genome, including the major histocompatibility complex (MHC), consists largely of 5- to 200-kb blocks of sequence fixity between which random recombination occurs. Direct determination of MHC haplotypes from family studies also demonstrates similar-sized blocks, but otherwise gives a very different picture, with a third to a half of Caucasian haplotypes fixed from HLA-B to HLA-DR/DQ (at least 1 Mb) as conserved extended haplotypes (CEHs), some of which encompass more than 3 Mb. These fixed haplotypes differ in frequency both in different Caucasian subpopulations and in Caucasian patients with HLA-associated diseases, complicating disease susceptibility gene localization. The inherent inability of LD analysis to "see" DNA fixity beyond three markers contributes to the failure of SNP/LD analysis to define in detail or even detect CEHs in the MHC and probably elsewhere in the genome. More importantly, the use of statistical analysis, rather than direct haplotype determination and counting, fails to reveal the details of haplotype structure essential for gene localization. Given the oversimplified picture of the MHC (and probably the rest of the genome) provided only by SNP/LD-defined blocks, it is questionable whether this approach will be of great help in disease susceptibility gene localization or identification.
Br J Haematol. 1997 Aug;98(2):356-64. Related Articles, Links
Specificity and sensitivity of RHD genotyping methods by PCR-based DNA amplification.
Aubin JT, Le Van Kim C, Mouro I, Colin Y, Bignozzi C, Brossard Y, Cartron JP.
Centre d'Hemobiologie Perinale, Paris, France.
We have compared the sensitivity and specificity of four PCR methods of RHD gene detection using different sets of primers located in the regions of highest divergence between the RHD and RHCE genes, notably exon 10 (method I), exon 7 (method II), exon 4 (method III) and intron 4 (method IV). Methods I-III were the most sensitive and gave a detectable signal with D-pos/D-neg mixtures containing only 0.001% D-positive cells. Moreover, method II could detect the equivalent DNA amount present in only three nucleated cells in the assay without hybridization of PCR products, whereas the sensitivity of the other methods was 10-50 times less. Investigation of D variants indicated that false-negative results were obtained with method II (D(IVb) variant), method III (D(VI) and DFR variants) and method IV (D(VI) variants), but not method I. Weak D (D(u)) was correctly detected as D-positive by all methods, but most cases of Rh(null) appeared as false-positives, as they carry normal RH genes that are not phenotypically expressed. Some false-positive results were obtained with method I in a few Caucasian DNA samples serotyped as RhD-neg but carrying a C- or E-allele, whereas a high incidence of false-positives was found among non-Caucasian Rh-negative samples by all methods. In the Caucasian population, however, we found a full correlation between the predicted genotype and observed phenotype at birth of 92 infants. Although we routinely use the four methods for RHD genotyping, a PCR strategy based on at least two methods is recommended.
Hum Immunol. 2006 Jan-Feb;67(1-2):125-39. Epub 2005 Nov 4. Related Articles, Links
Disease Relevant HLA Class II Alleles Isolated by Genotypic, Haplotypic, and Sequence Analysis in North American Caucasians With Pemphigus Vulgaris.
Lee E, Lendas KA, Chow S, Pirani Y, Gordon D, Dionisio R, Nguyen D, Spizuoco A, Fotino M, Zhang Y, Sinha AA.
Department of Dermatology, Weill Medical College of Cornell University, New York, NY.
Early studies of genetic susceptibility to pemphigus vulgaris (PV) showed associations between human leukocyte antigen (HLA) DR4 and DR6 and disease. The emergence of DNA sequencing techniques has implicated numerous DRB1 and DQB1 loci in various populations, leading to confusion regarding which exact alleles confer susceptibility. The strong linkage disequilibrium among DR and DQ HLA alleles further complicates the investigation of the true susceptibility loci. In this study, we report genotyping data for the largest sampling of North American Caucasian non-Jewish and Ashkenazi Jewish PV patients studied to date and compare our data with other population studies. To pinpoint true susceptibility, alleles among overrepresented sequences, we applied a step-wise reductionist analysis through (1) determination of the degree of linkage disequilibrium (LD) between purportedly associated alleles, (2) haplotype frequencies comparisons, and (3) primary sequence comparisons of disease-associated versus non-disease-associated alleles to identify crucial differences in amino acid residues in putative peptide binding pockets. Collectively, our data provide extended support for the hypothesis that the HLA associations in Caucasian PV patients map to DRB1*0402 and DQB1*0503 alone. Further structure-function studies will be required to define the exact mechanisms of HLA-mediated control of susceptibility and resistance to disease.
PMID: 16698434 [PubMed - in process]
Ann Hum Genet. 2006 May;70(Pt 3):350-9. Related Articles, Links
A comparison of individual genotyping and pooled DNA analysis for polymorphism validation prior to large-scale genetic studies.
Yang HC, Lin CH, Hung SI, Fann CS.
Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan 115.
Polymorphism validation is an important issue in genetic studies because only polymorphic markers provide useful information. We analyzed genetic data for 180 SNPs in the human major histocompatibility complex region in Caucasian and Taiwanese populations, and evaluated ethnic heterogeneity between these populations to illustrate the importance of polymorphism validation. An initial individual genotyping experiment (IGE) with 95 samples was compared with a DNA pooling allele-typing experiment (PAE) of 630 individuals for polymorphism validation based on authentic data sets. Afterwards, all samples were genotyped individually in a confirmation study. Under narrow (broad) polymorphism criteria, 24 (41) polymorphic SNPs in Caucasians could not be validated in the Taiwanese population, suggesting a 13% (23%) inconsistency rate and revealing a strong discrepancy between genetic backgrounds, probably due to ethnic heterogeneity. IGE yielded high sensitivity and specificity for polymorphism validation, but may be sensitive to sampling variation. PAE showed high sensitivity (97%) and specificity (100%) using a narrow polymorphism criterion, but reduced specificity (83%) using a broad criterion. Public domain polymorphism databases should therefore be used with caution and polymorphism validation should be performed routinely prior to conducting large-scale genetic studies. PAE is a cost-saving, reliable alternative to IGE for polymorphism validation, especially for a stringent polymorphism criterion.
2) list the geneticist who support this theory with direct, clear statements to the effect that this is so.
This question was already answered above when I provided the published papers where racial terms such as caucasian is frequently used for the "white'" race. Use of the term caucasian is a clear statement to the effect race continues to play a role in the research of geneticists as proven by the papers discussed above.
3) present a study classifying Dravidians and Africans into a distinct race based upon specific SNP markers.
You already mentioned one the Cavelli Sforza study.
Clyde Winters
quote::I have never read where the geneticists have claimed that the Dravidians were Caucasian.
Rasol
quote: Cavelli Sforza has claimed this.
Since Sforza classifies the Dravidians as caucasian proves that geneticists use racial terms to describe populations. It refutes Templeton's claim that
quote:
"Race is a real cultural, political and economic concept in society, but it is not a biological concept, and that unfortunately is what many people wrongfully consider to be the essence of race in humans -- genetic differences," Templeton said. "Evolutionary history is the key to understanding race, and new molecular biology techniques offer so much on recent evolutionary history. I wanted to bring some objectivity to the topic. This very objective analysis shows the outcome is not even a close call: There's nothing even like a really distinct subdivision of humanity."
If their is no distinct subdivision of humanity why do geneticists continue to use racial terms in their research and even Sforza call the Dravidians and Afro-Asian speakers caucasians?
.
Posted by rasol (Member # 4592) on :
quote:Winters writes: I answered the questions earlier. The issue is not SNP studies.
You make no sense - you continually spam posts on SNP and HLA studies.
I ask you questions about the studies you posted.
You decline to answer the questions.
You then repost the studies.
Nevermind Dr. Winters.
Since you won't answer my questions, I'll just move on and answer yours...
Posted by rasol (Member # 4592) on :
^ My opinion of Sforza's non-scientific and inappropriate use of the term caucasian, properly a folk ethnicity define as follows -
Of or relating to the Caucasus region or its peoples, languages, or cultures. Of or relating to a group of three language families spoken in the region of the Caucasus mountains, including Chechen, Abkhaz, and the Kartvelian languages.
...is that it reflects his ideological need to keep Europeans united via racial euphemisms.
Sforza does not define caucasian, culturally, or linguistically and certainly not genetically.
He also does not use the term Negro.
Sforza has been criticised by other scholars in this respect for being somewhat biased conceptually, and even [it is implied], hypocritical.
However - whether Sforza is or is not a hypocrite, or biased, or personally does or does not believe in race or devil worship- is irrelevant to what he claims is proven via genetics.
Sforza does not claim that populations can be sub-divided into races. He specifically concurs with Templeton in this regard.
They both agree with each other here, and they both refute you.
So you have no support for your views from any geneticist.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
-------------------------------------------------------------------------------- ^ My opinion of Sforza's non-scientific and inappropriate use of the term caucasian, properly a folk ethnicity define as follows -
Of or relating to the Caucasus region or its peoples, languages, or cultures. Of or relating to a group of three language families spoken in the region of the Caucasus mountains, including Chechen, Abkhaz, and the Kartvelian languages.
...is that it reflects his ideological need to keep Europeans united via racial euphemisms.
Sforza does not define caucasian, culturally, or linguistically and certainly not genetically.
He also does not use the term Negro.
Sforza has been criticised by other scholars in this respect for being somewhat biased conceptually, and even [it is implied], hypocritical.
However - whether Sforza is or is not a hypocrite, or biased, or personally does or does not believe in race or devil worship- is irrelevant to what he claims is proven via genetics.
Sforza does not claim that populations can be sub-divided into races. He specifically concurs with Templeton in this regard.
This is double speech. Sforza can not be said to avoid the division of mankind into races, when he specifically says the Afro-Asiatic speakers and Dravidian speakers are caucasian.
Use of these terms by Sforza, show that the founder of genetic-anthropology was a major proponent of race. Theis makes it clear that my proposition has not been refuted.
[Quote]
-------------------------------------------------------------------------------- Rasol asks: 1) show us that different SNP markers can be used to systematically classify populations into races.
Forensic value of the multicopy Y-STR marker DYS464
John M. Butler * , Richard Schoske 1 Biotechnology Division, National Institute of Standards and Technology, Gaithersburg, MD, USA Abstract. The tetranucleotide Y-chromosome short tandem repeat (Y-STR) marker, DYS464, first reported by Redd et al. [Forensic Sci. Int. 130 (2002) 97] appears to be the most polymorphic Y-STR marker discovered to date. A single primer pair can generate up to four distinct peaks over an allele range of 9–20 repeats. Allele calls can be made based on peaks that are present (conservative approach; C-type) or a combination of alleles and peak height ratios (expanded typing method; E- type). We have observed 113 C-types and 179 E-types in 679 males from three US populations. D 2003 Elsevier B.V. All rights reserved. Keywords: Y-STR; Y-chromosome; DYS464; Multicopy loci; DNA typing 1. Introduction DYS464 occurs at least four times in the highly palindromic region near the center of the long arm of the Y-chromosome [1–3]. In forensic casework applications where the amount of typable DNA material may be limited, the use of highly polymorphic markers is advantageous in order to limit the number of markers needed to distinguish unrelated individuals. 2. Materials and methods A total of 679 unique male DNA samples from three different US populations [4] were typed with DYS464 along with 21 additional Y-chromosome short tandem repeat (Y-STR) markers [3]. Only the DYS464 results are described in this report. Two novel DYS464 primer pairs, which differ from those originally described by Redd et al. [2], were used. 0531-5131/ D 2003 Elsevier B.V. All rights reserved. doi:10.1016/S0531-5131(03)01713-8 $ Points of view are those of the authors and do not necessarily represent the position of the US Departments of Justice or Defense. Certain commercial equipment, instruments, and materials are identified in order to specify experimental procedures as completely as possible. In no case does such identification imply a recommendation or endorsement by the National Institute of Standards and Technology, nor does it imply that any of the materials, instruments, or equipment identified are necessarily the best available for the purpose. * Corresponding author. Tel.: +1-301-975-4049; fax: +1-301-975-8505. E-mail address: john.butler@nist.gov (J.M. Butler). 1 Current address: Armed Forces Institute of Pathology, Washington, DC, USA. www.ics-elsevier.com International Congress Series 1261 (2004) 278–280
Page 2 The primers VIC-CTTTGGGCTATGCCTCAGTTT and GCCATACCTGGGTAACAGA- GAGAC produce green-labeled amplicons in the size range of 242–286 bp for DYS464 alleles 9–20, while the primers 6FAM-AGTTTACGAGCTTTGGGCTATG and GTGGCAAGATCTCATTTCTTCAA generate blue dye-labeled polymerase chain reac- tion (PCR) products that are 327–367 bp in size. PCR conditions are as previously described for the Y-STR 20plex [5]. An allelic ladder was created for DYS464 (Fig. 1), which contains all of the major alleles as well as single-base variants observed in our population study [3]. 3. Results and discussion We observed 179 expanded types with DYS464 in 679 male samples from three different US population sets: 265 African–Americans, 262 Caucasians, and 152 His- panics. The addition of peak height information (E-type) to just allele calls (C-type) can result in an expansion in the number of types observed (e.g., Fig. 2). The most common types are 15,15,17,17, which occurs in 10.6% of this data set, and 15,15,16,17, which occurs in 7.5%. All other DYS464 types are found at less than the 5% level, with over half of the observed types occurring only once (92 of 179 observed). If the DYS464 data are collapsed to C-types (conservative typing method), then 113 allele calls are observed in these 679 males. By way of comparison to other DNA typing markers in the same data set, DYS385 exhibited only 56 different types and FGA, the single best autosomal STR examined, had only 78 different genotypes. Furthermore, the four single-copy Y-STRs DYS19, DYS391, DYS392, and DYS393, when combined, only produced 93 different Fig. 1. NIST allelic ladder for DYS464 produced from eight different DNA samples. The variant alleles 14.3, 15.1, and 15.3 are helpful as a tool for measuring single-base resolution in electrophoretic systems. Fig. 2. Example of four samples with the same conservative DYS464 type, 14,15,18, which can be separated from one another by considering their expanded type through peak height variation. J.M. Butler, R. Schoske / International Congress Series 1261 (2004) 278–280 279
Page 3 haplotypes. Thus, DYS464 is more polymorphic than DYS385, the previously considered best multicopy Y-STR, and four single-copy Y-STRs in combination. A human Y- chromosome DNA profiling standard, NIST Standard Reference Material (SRM) 2395, is available and contains DYS464 information on its five male samples (see http:// www.nist.gov/srm). This SRM will enable laboratories worldwide to accurately calibrate their DYS464 typing results. Acknowledgements This work was supported by research funds from the US National Institute of Justice through Interagency Agreement 1999-IJ-R-094 with the NIST Office of Law Enforcement Standards. Much of this work was performed while R.S. was a graduate student at the NIST and the American University through funding from the US Air Force. The technical assistance and suggestions of Peter Vallone, David Duewer, Margaret Kline, and Jan Redman from our group at the NIST and Alan Redd from the University of Arizona are gratefully acknowledged. References [1] J.M. Butler, Recent developments in Y-short tandem repeat and Y-single nucleotide polymorphism analysis, Forensic Sci. Rev. 15 (2003) 91–111. [2] A.J. Redd, A.B. Agellon, V.A. Kearney, T. Karafet, P. de Knijff, H. Park, J.M. Butler, M.F. Hammer, Forensic value of fourteen novel STRs on the human Y chromosome, Forensic Sci. Int. 130 (2002) 97–111. [3] R. Schoske, P.M. Vallone, M.C. Kline, J.W. Redman, J.M. Butler, High-throughput Y-STR typing of U.S. populations with 27 regions of the Y chromosome using two multiplex PCR assays, Forensic Sci. Int. (In press). [4] J.M. Butler, R. Schoske, P.M. Vallone, J.W. Redman, M.C. Kline, Allele frequencies for 15 autosomal STR loci on U.S. Caucasian, African American, and Hispanic populations, J. Forensic Sci. 48 (4) (2003) 908–911. [5] J.M. Butler, R. Schoske, P.M. Vallone, M.C. Kline, A.J. Redd, M.F. Hammer, A novel multiplex for simultaneous amplification of 20 Y chromosome STR markers, Forensic Sci. Int. 129 (2002) 10–24. J.M. Butler, R. Schoske / International Congress Series 1261 (2004) 278–280 280
J Forensic Sci, July 2004, Vol. 49, No. 4 Paper ID JFS2003303 Available online at: www.astm.org Peter M. Vallone,1 Ph.D. and John M. Butler,1 Ph.D. Y-SNP Typing of U.S. African American and Caucasian Samples Using Allele-Specific Hybridization and Primer Extension∗ ABSTRACT: Multiplex analysis of genetic markers has become increasingly important in a number of fields, including DNA diagnostics and human identity testing. Two methods for examination of single nucleotide polymorphisms (SNPs) with a potential for a high degree of multiplex analysis of markers are primer extension with fluorescence detection, and allele-specific hybridization using flow cytometry. In this paper, we examined 50 different SNPs on the Y-chromosome using three primer extension multiplexes and five hybridization multiplex assays. For certain loci, the allele-specific hybridization method exhibited sizable background signal from the absent alternate allele. However, 100% concordance (>2000 alleles) was observed in ten markers that were typed using both methods. A total of 18 unique haplogroups out of a possible 45 were observed in a group of 229 U.S. African American and Caucasian males with the majority of samples being assigned into 2 of the 18 haplogroups. KEYWORDS: forensic science, Y-chromosome, single nucleotide polymorphism, SNP typing, Y-SNPs, SNaPshot, primer extension, Luminex, allele-specific hybridization In recent years, single nucleotide polymorphisms (SNPs) have become more widely used in a variety of applications, including medical diagnostics, population genetics, and human identity testing (1,2). The ability to analyze a number of SNP markers in parallel relies on multiplex amplification and detection formats (3). Two SNP detection formats capable of multiplex analysis are allelespecific primer extension (ASPE) and allele-specific hybridization (ASH), which we use here to examine variation along the Y-chromosome. The lack of recombination along most of the Y-chromosome makes it a useful tool in human evolutionary studies and assessing male migration patterns (4–10). Y-chromosome markers have also been used in attempts to address some interesting historical questions (11,12). Analysis of Y-SNP markers has typically been done with manual techniques such as restriction digestion of PCR products (10,13) or by procedures that can only examine one or two markers simultaneously such as allele-specific PCR (7), denaturing high performance liquid chromatography (5), melting curve analysis (14), and real-time PCR (15). More recently, microarrays (16), time-of-flight mass spectrometry (17), and fluorescent primer extension (10,18) have been applied to Y-SNP analysis in order to type multiple markers in parallel. In an effort to evaluate the usefulness of Y-chromosome SNP markers for human identity applications, we constructed several novel multiplex ASPE assays and utilized a new commercial ASH 1 Biotechnology Division, National Institute of Standards and Technology, Gaithersburg, MD 20899-8311. ∗ Contribution of the U.S. National Institute of Standards and Technology. Certain commercial equipment, instruments, and materials are identified in order to specify experimental procedures as completely as possible. In no case does such identification imply a recommendation or endorsement by the National Institute of Standards and Technology nor does it imply that any of the materials, instruments, or equipment identified are necessarily the best available for the purpose. Received 6 Sept. 2003; and in revised form 21 Dec. 2003, 6 March 2004. accepted 6 March 2004; published XXXX. kit to type 50 Y-SNP markers in more than 200 individuals. In addition, by examining ten of the Y-SNPs with both methods, we were able to assess concordance in more than 2000 allele calls between primer extension and hybridization approaches. Methods U.S. African American and Caucasian DNA Samples Anonymous liquid blood samples with self-identified ethnicities were purchased from Interstate Blood Bank, Inc. (Memphis, TN) and Millennium Biotech, Inc. (Ft. Lauderdale, FL) and extracted using a modified salting out procedure (19). Carll Ladd from the Connecticut Forensic Laboratory (Meriden, CT) kindly provided extracted DNA for 20 U.S. Caucasian and 20 African American samples usedas part of this study. TheextractedDNAwas quantified using ultraviolet (UV) spectrophotometry followed by a PicoGreen assay (20) to adjust concentrations to approximately 1 ng/µL. All samples were examined with 15 autosomal short tandem repeats and the amelogenin sex-typing marker using the AmpF_STR Identifiler Kit to verify that each sample was unique (21). A total of 229 male samples were typed (115 African Americans and 114 Caucasians). Y-SNP Markers A total of 50 Y-chromosome biallelic markers were used to cover all 18 major haplogroups (A-R) recognized by the Y-chromosome consortium (YCC) (22,23). Table 1 contains a summary of the YSNP markers used in this study according to their physical position along theY-chromosome. These positions were identified using amplicon sequences for the 50 Y-SNPs with the BLAST-Like Alignment Tool (BLAT): http://genome.ucsc.edu/cgi-bin/hgBlat. Of the 50 Y-SNPs, 18 was typed by three hexaplex allele specific primer extension assays. An additional set of 42 Y-SNP loci was typed by an ASH assay described below. Ten of the Y-SNP loci probed were redundant between the two sets. Copyright C_ 2004 by ASTM International, 100 Barr Harbor Drive, PO Box C700, West Conshohocken, PA 19428-2959. 723
J Forensic Sci, Mar. 2005, Vol. 50, No. 2 Paper ID JFS2004293 Available online at: www.astm.org TECHNICAL NOTE Margaret C. Kline,1 M.S.; Peter M. Vallone,1 Ph.D.; Janette W. Redman;1 David L. Duewer,2 Ph.D.; Cassandra D. Calloway,3,4 M.S.; and John M. Butler,1 Ph.D. Mitochondrial DNA Typing Screens with Control Region and Coding Region SNPs∗
ABSTRACT: Mitochondrial DNA (mtDNA) analysis has found an important niche in forensic DNA typing. It is used with highly degraded samples or low-copy number materials such as might be found from shed hair or bones exposed to severe environmental conditions. The primary advantage of mtDNA is that it is present in high copy number within cells and therefore more likely to be recovered from highly degraded specimens. A major disadvantage to traditional forensic mtDNA analysis is that it is time-consuming and labor-intensive to generate and review the 610 nucleotides of sequence information commonly targeted in hypervariable regions I and II (HVI and HVII) of the control region. In addition, common haplotypes exist in HVI/HVII mtDNA sequences that can reduce the ability to differentiate two unrelated samples. In this report we describe the utility of two newly available screening assays for rapid exclusion of non-matching samples. The LINEAR ARRAY mtDNA HVI/HVII Region-Sequencing Typing Kit (Roche Applied Science, Indianapolis, IN) was used to type 666 individuals from U.S. Caucasian, African American, and Hispanic groups. Processing of the LINEAR ARRAY probe panels “mito strips” was automated on a ProfiBlot workstation. Observable variation in 666 individuals is reported and frequencies of the mitotypes within and between populations are presented. Samples exhibiting the most common Caucasian mitotype were subdivided with a multiplexed amplification and detection assay using eleven single nucleotide polymorphisms in the mitochondrial genome. These types of screening assays should enable more rapid evaluation of forensic casework samples such that only samples not excluded would be subjected to further characterization through full HVI/HVII mtDNA sequence analysis. KEYWORDS: forensic science, DNA typing, mtDNA, SSO probes, mitochondrial DNA coding region, primer extension For the past decade, DNA sequencing of hypervariable regions I (HVI) and II (HVII) in the control region of mitochondrial DNA (mtDNA) has been useful in forensic casework for the analysis of human remains when nuclear DNA systems fail due to low amounts of DNA or highly degraded specimens (1–3). However, considerable effort and expense are required to develop a full HVI and HVII mtDNA sequence (typically positions 16024–16365 and 1 Biotechnology Division, National Institute of Standards and Technology, Gaithersburg, MD 20899. 2 Analytical Chemistry Division, National Institute of Standards and Technology, Gaithersburg, MD 20899. 3 Department of Human Genetics, Roche Molecular Systems, Alameda, CA 94501. 4 Comparative Biochemistry Group, University of California, Berkeley, CA. ∗ Contribution of the U.S. National Institute of Standards and Technology. Not subject to copyright. Certain commercial equipment, instruments and materials are identified in order to specify experimental procedures as completely as possible. In no case does such identification imply a recommendation or endorsement by the National Institute of Standards and Technology nor does it imply that any of the materials, instruments or equipment identified are necessarily the best available for the purpose. † Parts of this work were presented at the 2003 International Symposium on Human Identification, Phoenix, Arizona, and at the 2004 Annual Meeting of the American Academy of Forensic Sciences, Dallas, Texas. ‡ National Institute of Justice (NIJ) funded this work in part through an interagency agreement with the NIST Office of Law Enforcement Standards and NIJ grant 95-IJ-CX-0014 to Roche Molecular Systems. Received 31 July 2004; and in revised form 16 Oct. 2004; accepted 16 Oct. 2004; published 2 Feb. 2005. 73–340 are examined). Hence, several mtDNA screening methods have been developed (4–9). These screening methods permit rapid resolution of non-matching samples allowing a laboratory to focus more attention on full-sequencing of samples that cannot be resolved from one another with the screening method. Alternatively, laboratories without DNA sequencing capabilities or expertise can perform mtDNAtyping with a screening method and then send only those samples that are not excluded to a private or public laboratory for full HVI/HVII sequencing. This report details a number of inter-related technologies associated with the use of the newly available Linear Array Mitochondrial DNA HVI/HVII Region-Sequence Typing Kit (Roche Applied Science, Indianapolis, IN). The utility of a new microchip CE method for quantifying PCR products that are then hybridized to immobilized sequence specific oligonucleotide (SSO) probes is demonstrated. A semi-automated sample processing method for the Linear Arrays was developed and is demonstrated. The utility of this mtDNA typing kit is demonstrated by differentiating several hundred unrelated individuals from U.S. Caucasian, African American, and Hispanic groups. These results are compared to previous work with similar mtDNA SSO typing probes. The presence of multiple signals within a probe region resulting from sequence heteroplasmy is described as is the absence of signal within a probe region resulting from failed hybridization of PCR products due to additional destabilizing polymorphisms. In addition, a new coding region single nucleotide polymorphism (SNP) assay was employed to help subdivide 51 individuals possessing the most common Caucasian mtDNA haplotype (10,11). Copyright C_ 2005 by ASTM International, 100 Barr Harbor Drive, PO Box C700, West Conshohocken, PA 19428-2959. 377
378 JOURNAL OF FORENSIC SCIENCES Materials and Methods The steps involved in typing the control region SNPs with the mtDNA Linear Arrays are: DNA extraction/quantification, PCR amplification, PCR product quantification, hybridization of the PCR products to the Linear Arrays, detection with colored precipitate, interpretation of results for each sample, comparison of Linear Array results to other samples, and subdividing into groupings. Those samples possessing the most common Caucasian type were also processed with an additional coding region SNP assay as described below. DNA Samples A total of 666 DNA samples that had previously been extracted from whole blood were evaluated in this study. These samples, purchased from Interstate Blood Bank Inc. (Memphis, TN), are assumed to be unrelated and were classified into U.S. Caucasian (N =286), African American (N =252), or Hispanic (N =128) groups based on self-declaration. All samples possess unique STR profiles as determined previously with the AmpF_STR Identifier STR kit (Applied Biosystems, Foster City, CA) (12). Bloods were extracted by a modified “saltout” procedure (13). Portions of the genomic extracts were quantified by UV measurement on a Cary Bio 100 double-beam spectrophotometer (Varian Analytical Instruments, Walnut Creek, CA). Based on the UV/260 quantification, the samples were diluted to a nominal 1 ng/µL (14,15). The concentration of the diluted sample was verified by Pico Green quantitation to be between 0.5 ng/µL and 1.5 ng/µL (16). PCR Amplification One µL of each sample extract (≈1 ng/µL) was amplified using the mtDNA HVI/HVII Primer mix and mtDNA PCR Reaction Mix supplied by Roche Molecular Systems (Alameda, CA) as part of a beta-test of the Linear Array Mitochondrial DNA HVI/HVII Region-Sequence Typing kit. This kit is now available from Roche Applied Sciences (Indianapolis, IN) in the same format as described in this work (catalog number 03-527-867-001). Samples are amplified in a duplex PCR that simultaneously generates PCR products for HVI (positions 15975-16418) and HVII (positions 15–429). The HVI primers amplify an approximately 444 bp PCR product using the following primers: Forward (F15975-15993B) 5_-biotin-CTCCACCATTAGCACCCAA-3_ Reverse (R16418-16401B) 5_-biotin-ATTTCACGGAGGATGGTG-3_ The HVII primers amplify an approximately 416 bp PCR product using the following primers: Forward (F15-34B) 5_-biotin-CACCCTATTAACCACTCACG-3_ Reverse (R429-410B) 5_-biotin-CTGTTAAAAGTGCATACCGC-3_ Since 1 ng of genomic DNA was used rather than the “Kit” recommended 5 pg (based on nuclear DNA quantification), the number of amplification cycles was reduced from the recommended protocol. Whereas the standard protocol calls for 34–38 cycles, only 28 cycles were run in order to yield PCR products in the desired concentration range (see below). The PCR parameters used with a GeneAmp 9700 thermal cycler (Applied Biosystems) were: 94◦C for 14 min, 28 cycles of {92◦C for 15 s, 59◦C for 30 s, and 72◦C for 30 s}, final extension 72◦C for 10 min, and hold at 10◦C until the products could be removed from the thermal cycler. Amplification and typing of 11 SNP sites outside the HVI/HVII Region was performed using the multiplex amplification and allelespecific primer extension assay as previously published (11). These sites include SNPs at positions 3010, 4580, 4793, 5004, 7028, 7202, 10211, 12858, 14470 in the coding region and at positions 477 and 16519 in theVariable Regions (control region outside of HVI/HVII) that help differentiate the most common Caucasian Haplotype (10). Post-PCR Quantification Forty of the PCR products were quantified by loading 4 µL on to an agarose (3% mass NuSieve, 1% mass SeaKem GTG, Cambrex Bio Science Rockland, Inc., Rockland, ME) yield gel stained with ethidium bromide and imaged/analyzed with a FMBIO III plus (MiraiBio Inc., Alameda, CA). A yield gel quantification standard was supplied from Roche Molecular Systems as part of the beta-site test, which is the same as the DNA Molecular Weight Marker XIV 100 bp ladder available from Roche Applied Sciences (catalog number 1-721-933). A DNA Low Mass Ladder (catalog number 10068-013, Invitrogen, Carlsbad, CA) was also used for PCR product size estimation and quantification. All 666 HVI/HVII PCR products were quantified using the Agilent 2100 Bioanalyzer Lab Chip system (Agilent Technologies, Palo Alto, CA) and 1 µL of each PCR product according to the manufacturer’s protocols. The Agilent 2100 standard ladder calibrates for base pair (bp) sizing, and quantification for up to 12 samples per run (17). Two DNA fragments, 15 bp and 1500 bp, are added in each tested sample as internal standards to quantify PCR product amounts. Quantitation results were imported to an Excel spreadsheet in order to calculate the appropriate quantity of the PCR product to add to each Linear Array probe panel. Typically addition of ≈50 ng total amplified product to each probe panel was targeted. Control Region SNP Typing Manufacturer protocols for the Linear Arrays were followed in processing the HVI/HVII PCR products through hybridization to a nylon membrane containing specific probe sequences (Fig. 1). Allele-specific hybridization of the amplified DNA is detected using an enzymatic conversion of a soluble, colorless substrate to a blue-colored precipitate with the detection chemistry originally described by Saiki et al. (18). Cambridge Reference Sequence (19, 20) positions 16093, 16126, 16129, 16270, 16278, 16304, 16309, 16311, and 16362 from HVI and positions 73, 146, 150, 152, 189, 195, 198, 200, and 247 from HVII are probed in this assay. Samples were processed both manually (120 samples) and using a SLT ProfiBlot workstation (Tecan US, Research Triangle Park, NC) (remaining 446 samples). Steps in the developed Profiblot protocol are listed in Table 1. All reagents required for processing are pre-loaded onto the Tecan Profiblot. Up to 24 probe panels can be processed simultaneously in a 2 h run. The wash solution is placed in a heated/stirred heat block to maintain the required 55◦C temperature for hybridization. After the Linear Array probe panels are added to the tray, the Profiblot SLT instrument dispenses the
2) list the geneticist who support this theory with direct, clear statements to the effect that this is so.
Mitochondrial DNA: Coding Region SNP Assay Development
Participants: Peter M. Vallone, Michael D. Coble, Margaret C. Kline, and John M. Butler (AFDIL participants: Rebecca Just and Thomas Parsons)
Project Timeframe: 2001 to present
Purpose: The development of multiplex primer extension assays to probe coding region mitochondrial SNPs to help resolve common mitotypes.
Progress: The typing of single nucleotide polymorphisms (SNPs) located throughout the mitochondrial genome (mtGenome) allows for differentiation between individuals possessing an identical HV1/HV2 sequence. A set of 11 SNPs selected for distinguishing individuals of the most common Caucasian HV1/HV2 mitotype were incorporated in an allele-specific primer extension assay. The 11-plex assay probed SNPs located at positions 477, 3010, 4580, 4793, 5004, 7028, 7202, 10211, 12858, 14470 and 16519 in the mtGenome. The assay was optimized for multiplex detection of these SNPs. Primers were designed to allow for the simultaneous polymerase chain reaction (PCR) amplification of 11 unique regions in the mtGenome. Locus specific primers of varying lengths were employed in multiplex primer extension reactions. Extension primers binding 5’ adjacent to the SNP site of interest were enzymatically extended using fluorescently labeled dideoxynucleotides (ddNTPs). Resolution and detection of each extended fragment were achieved by analysis on a capillary-based electrophoresis (CE) platform. The electrophoretic mobility for the extension primers was compared in denaturing POP4 and POP6 CE running buffers. Empirical adjustment of extension primer concentrations resulted in even signal intensity for the 11 loci probed. The development of the mtSNP 11-plex assay has resulted in an accurate method for typing sequence variant mtSNPs on a platform common to forensic laboratories.
We are currently developing additional multiplex SNP panels to resolve other common mitotypes (Caucasian, Hispanic, and African American).
Publications Resulting From This Project: Kline, M.C., Vallone, P.M., Redman, J.W., Duewer, D.L., Calloway, C.D., and Butler, J.M. (2005) Mitochondrial DNA typing screens with control region and coding region SNPs. J. Forensic Sci. 50(2): 377-385.
Just, R.S., Irwin, J.A., O'Callaghan, J.E., Saunier, J.L., Coble, M.D., Vallone, P.M., Butler, J.M., Barritt, S.M., and Parsons, T.J. (2004) Toward increased utility of mtDNA in forensic identifications. Forensic Sci. Int. 146S: S147-S149.
Vallone, P.M., Just, R.S., Coble, M.D., Butler, J.M., and Parsons, T.J. (2004) A multiplex allele-specific primer extension assay for forensically informative SNPs distributed throughout the mitochondrial genome. Int. J. Legal Med. 118: 147-157.
Coble, M.D., Just, R.S., O'Callaghan, J.E., Letmanyi, I.H., Peterson, C.T., Irwin, J.A., Parsons, T.J. (2004) Single nucleotide polymorphisms over the entire mtDNA genome that increase the power of forensic testing in Caucasians. Int. J. Legal Med. 118: 137-146.
3) present a study classifying Dravidians and Africans into a distinct race based upon specific SNP markers.
The study of Sforza where he claims that Afro-Asiatic and Dravidian speakers are caucasian answers this question.
The forensic studies and comments by Sforza and other geneticists indicate that race does exist.
.
Posted by rasol (Member # 4592) on :
quote:study of Sforza where he claims that Afro-Asiatic and Dravidian speakers are caucasian answers this question.
No it does not - Sforza does not consider Dravidian and AfroAsiatic language, nor does he consider Africans caucasians, nor does he consider Dravidians and Africans to be genetically close, nor does he claim Dravidians and Africans are the same race.
He simply misdefines AfroAsiatic languages as caucasian. This shows his ignorance of linguistics. But does not help you answer my question.
Posted by rasol (Member # 4592) on :
quote: show us that different SNP markers can be used to systematically classify populations into races.
quote:Forensic value of the multicopy Y-STR marker DYS464
That is not a study of SNP markers.
And nowhere does it conclude that SNP or any other genetic markers classify races.
Posted by rasol (Member # 4592) on :
quote: Forensic Sci, July 2004, Vol. 49, No. 4 Paper ID JFS2003303 Available online at: www.astm.org Peter M. Vallone,1 Ph.D. and John M. Butler,1 Ph.D. Y-SNP Typing of U.S. African American and Caucasian Samples Using Allele-Specific Hybridization and Primer Extension
This one *is* a study of SNP markers, but nowhere within it does it claim that SNP markers classify races. Same with the others you posted.
Disagree?
You may prove your point - simply tell us exactly which SNP marker classify which 'race' based upon any study you posted?
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote: quote: -------------------------------------------------------------------------------- Forensic Sci, July 2004, Vol. 49, No. 4 Paper ID JFS2003303 Available online at: www.astm.org Peter M. Vallone,1 Ph.D. and John M. Butler,1 Ph.D. Y-SNP Typing of U.S. African American and Caucasian Samples Using Allele-Specific Hybridization and Primer Extension --------------------------------------------------------------------------------
This one *is* a study of SNP markers, but nowhere within it does it claim that SNP markers classify races. Same with the others you posted.
Disagree?
You may prove your point - simply tell us exactly which SNP marker classify which 'race' based upon any study you posted?
The authors describe the population as caucasian this means they were using race in their discussion of a population. This means that to these scientists race exist.
J Forensic Sci, July 2004, Vol. 49, No. 4 Paper ID JFS2003303 Available online at: www.astm.org Peter M. Vallone,1 Ph.D. and John M. Butler,1 Ph.D. Y-SNP Typing of U.S. African American and Caucasian Samples Using Allele-Specific Hybridization and Primer Extension∗ ABSTRACT: Multiplex analysis of genetic markers has become increasingly important in a number of fields, including DNA diagnostics and human identity testing. Two methods for examination of single nucleotide polymorphisms (SNPs) with a potential for a high degree of multiplex analysis of markers are primer extension with fluorescence detection, and allele-specific hybridization using flow cytometry. In this paper, we examined 50 different SNPs on the Y-chromosome using three primer extension multiplexes and five hybridization multiplex assays. For certain loci, the allele-specific hybridization method exhibited sizable background signal from the absent alternate allele. However, 100% concordance (>2000 alleles) was observed in ten markers that were typed using both methods. A total of 18 unique haplogroups out of a possible 45 were observed in a group of 229 U.S. African American and Caucasian males with the majority of samples being assigned into 2 of the 18 haplogroup...." .
Posted by rasol (Member # 4592) on :
quote:Dr. Winters writes: The authors describe the population as caucasian
The socially defined discriptions - African American and Caucasian in that study in no way scientifically validate race.
And your response is a non-sequitur which does not answer my question:
quote:rasol asks: Simply tell us exactly which SNP marker classify which 'race' based upon any study you posted?
We'll happily credit you with evidence if you provide and answer.
However no answer = no evidence earning you no credit.
Last chance....
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote: quote: -------------------------------------------------------------------------------- Dr. Winters writes: The authors describe the population as caucasian --------------------------------------------------------------------------------
The socially defined discriptions - African American and Caucasian in that study in no way scientifically validate race.
And your response is a non-sequitur which does not answer my question:
quote: -------------------------------------------------------------------------------- rasol asks: Simply tell us exactly which SNP marker classify which 'race' based upon any study you posted? --------------------------------------------------------------------------------
We'll happily credit you with evidence if you provide and answer.
However no answer = no evidence earning you no credit.
Last chance....
Your math is wrong. The sources I presented prove that scientist use the terms in their studies. If they did not use the terms you could claim that race is not a valid scientific term.
quote:
J Forensic Sci, July 2004, Vol. 49, No. 4 Paper ID JFS2003303 Available online at: www.astm.org Peter M. Vallone,1 Ph.D. and John M. Butler,1 Ph.D. Y-SNP Typing of U.S. African American and Caucasian Samples Using Allele-Specific Hybridization and Primer Extension∗ ABSTRACT: Multiplex analysis of genetic markers has become increasingly important in a number of fields, including DNA diagnostics and human identity testing. Two methods for examination of single nucleotide polymorphisms (SNPs) with a potential for a high degree of multiplex analysis of markers are primer extension with fluorescence detection, and allele-specific hybridization using flow cytometry. In this paper, we examined 50 different SNPs on the Y-chromosome using three primer extension multiplexes and five hybridization multiplex assays. For certain loci, the allele-specific hybridization method exhibited sizable background signal from the absent alternate allele. However, 100% concordance (>2000 alleles) was observed in ten markers that were typed using both methods. A total of 18 unique haplogroups out of a possible 45 were observed in a group of 229 U.S. African American and Caucasian males with the majority of samples being assigned into 2 of the 18 haplogroup...."
.
Use of racial terms implies race as a scientific reality in identifying populations.
Posted by rasol (Member # 4592) on :
^ Respect to you Dr. Winters, but the question was not answered.
Anyone else?
quote:rasol asks: Simply tell us exactly which SNP marker classify which 'race' based upon any study you posted?
Posted by Clyde Winters (Member # 10129) on :
^ respect to you. I proved my point race is a valid term in science.
Posted by rasol (Member # 4592) on :
^ No, but you did prove that you couldn't answer my question. Posted by Clyde Winters (Member # 10129) on :
Rasol I am sorry that you fail to accept the refutation of Templeton's idea that race no longer exist. Your question has nothing to do with this thread. Maybe you should start your own thread.
But any thread that claims race dosen't exist, when scientists continue to use the term is doomed to falsification. Because some geneticist, like forensic anthropologists employ racial terms in their research. To employ racial terms in their work implies their support of the view races exist.
The subject of this thread is race doesn't exist. It was originally claimed that race does not exist based on Templeton:
quote: "Race is a real cultural, political and economic concept in society, but it is not a biological concept, and that unfortunately is what many people wrongfully consider to be the essence of race in humans -- genetic differences," Templeton said. "Evolutionary history is the key to understanding race, and new molecular biology techniques offer so much on recent evolutionary history. I wanted to bring some objectivity to the topic. This very objective analysis shows the outcome is not even a close call: There's nothing even like a really distinct subdivision of humanity."
I have refuted the contention that scientist do not recognize distinct subdivisions of humanity.
1)I have shown that this is untrue. I presented evidence that Forensic scientists continue to use "race" as a way to classify humans
2) I have presented evidence that even geneticist use race when discussing the haplotype and haplogroup of individuals and populations.
These facts indicate that Templeton is wrong scientist still recognize a distinct subdivision of humanity. Race does exist.
.
Posted by *Topdog* (Member # 10328) on :
Clyde wrote:
"But any thread that claims race dosen't exist, when scientists continue to use the term is doomed to falsification. Because some geneticist, like forensic anthropologists employ racial terms in their research. To employ racial terms in their work implies their support of the view races exist."
Thats like saying:
"But any thread that claims the Easter Bunny dosen't exist, when people continue to use the term is doomed to falsification. Because some people, like little children talk about the Easter Bunny during Easter holiday. To talk about the Easter Bunny during Easter Holiday in implies their support of the view that the Easter Bunny exists."
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Clyde Winters:
Your question has nothing to do with this thread. Maybe you should start your own thread.
Of course, it does; but you have to understand how so, before you realize this.
quote:Clyde Winters:
But any thread that claims race dosen't exist, when scientists continue to use the term is doomed to falsification. Because some geneticist, like forensic anthropologists employ racial terms in their research. To employ racial terms in their work implies their support of the view races exist.
Which "geneticist" uses the "term" that signifies "race". How has this use proven the existence of discrete biological "races" in humans?
You have been shown, as Rasol mentioned, different studies showing just how "Forensics" operate, all the while claiming to "predicting" socially constructed "racial" types. The shortcomings inherent in such approach to typological thinking in science, has been spelt out in the aforementioned studies on the issue of Forensics; you haven't yet addressed those points.
Posted by *Topdog* (Member # 10328) on :
To Clyde:
"Forensic anthropology has been much more reluctant to divorce itself from the premodern partitioning of human biological variation into races (Smay and Armelagos 2000), despite the fact that human biological variation in genetic markers (Lewontin 1972, Stoneking 1993) and cranial morphology (Relethford 1994) is quantitatively greater within than between major geographic regions or races. Pressure from local law enforcement officials who insist on “knowing” the social race of unknowns may prompt some forensic anthropologists to designate racial affinity (provided that the sex of the individual can be determined), producing classifications that some have called “bureaucratic races.” However, the use of forensic tools to determine ancestry must assume that a given cranium is more similar to those of the ascribed population than to those of any other (e.g., Byers 2002). The fact that populations are variably defined as geographic regions, islands, countries, reproductive isolates, languages, cultures, or race categories may severely limit the reliability of such diagnoses.
Reports of Fordisc 2.0 analyses in the primary literature are scarce, suggesting that practitioners of this program are using a tool that has not been systematically tested for validity. Fordisc 2.0 produced poor results in Ubelaker, Ross, and Graver’s (2002) study of sixteenthand seventeenth-century Spanish crania, with half the crania being attributed to non-European/North African samples using one of its data sets, Howells’s (1973, 1995) cranial series, and less than half attributed to the white category using its other data set, the Forensic Data Bank (Ousley and Jantz 1996). Ubelaker et al. (2002) nevertheless call it “a powerful tool in forensic analysis that is routinely employed in most North American forensic laboratories” and generally support its use provided that care is taken when the samples are not represented in either of its databases (see also Ousley and Jantz 1996). Other researchers are less convinced of Fordisc’s practical use. Fukuzawa and Maish (1997) sought to ascribe ancestry to Native Canadians without success, and Leathers, Edwards, and Armelagos (2002) and Belcher, Williams, and Armelagos (2002) found that the program failed to classify populations as expected. We used both of its data sets to identify cranial remains from an ancient Meroitic Nubian population and found that it accurately classified very few of these remains.
"But any thread that claims race dosen't exist, when scientists continue to use the term is doomed to falsification. Because some geneticist, like forensic anthropologists employ racial terms in their research. To employ racial terms in their work implies their support of the view races exist."
Thats like saying:
"But any thread that claims the Easter Bunny dosen't exist, when people continue to use the term is doomed to falsification. Because some people, like little children talk about the Easter Bunny during Easter holiday. To talk about the Easter Bunny during Easter Holiday in implies their support of the view that the Easter Bunny exists."
This is illogical. I have presented evidence that geneticists use racial terms in their papers. This includes Sforza the father of genetic anthropology. How can they use racial terms in their research papers and claim races don't exist?
Below is a list of studies discussing race using DNA to denote differences.
: Hum Immunol. 2006 Jan-Feb;67(1-2):73-84. Epub 2006 Apr 5. Related Articles, Links The haplotype structure of the human major histocompatibility complex.Alper CA, Larsen CE, Dubey DP, Awdeh ZL, Fici DA, Yunis EJ.CBR Institute for Biomedical Research, Boston, MA 02115, USA; Department of Pediatrics, Harvard Medical School, Boston, MA 02115, USA.There is great interest in the use of single-nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) analysis to localize human disease genes. The results suggest that the human genome, including the major histocompatibility complex (MHC), consists largely of 5- to 200-kb blocks of sequence fixity between which random recombination occurs. Direct determination of MHC haplotypes from family studies also demonstrates similar-sized blocks, but otherwise gives a very different picture, with a third to a half of Caucasian haplotypes fixed from HLA-B to HLA-DR/DQ (at least 1 Mb) as conserved extended haplotypes (CEHs), some of which encompass more than 3 Mb. These fixed haplotypes differ in frequency both in different Caucasian subpopulations and in Caucasian patients with HLA-associated diseases, complicating disease susceptibility gene localization. The inherent inability of LD analysis to "see" DNA fixity beyond three markers contributes to the failure of SNP/LD analysis to define in detail or even detect CEHs in the MHC and probably elsewhere in the genome. More importantly, the use of statistical analysis, rather than direct haplotype determination and counting, fails to reveal the details of haplotype structure essential for gene localization. Given the oversimplified picture of the MHC (and probably the rest of the genome) provided only by SNP/LD-defined blocks, it is questionable whether this approach will be of great help in disease susceptibility gene localization or identification.
Br J Haematol. 1997 Aug;98(2):356-64. Related Articles, Links
Specificity and sensitivity of RHD genotyping methods by PCR-based DNA amplification.
Aubin JT, Le Van Kim C, Mouro I, Colin Y, Bignozzi C, Brossard Y, Cartron JP.
Centre d'Hemobiologie Perinale, Paris, France.
We have compared the sensitivity and specificity of four PCR methods of RHD gene detection using different sets of primers located in the regions of highest divergence between the RHD and RHCE genes, notably exon 10 (method I), exon 7 (method II), exon 4 (method III) and intron 4 (method IV). Methods I-III were the most sensitive and gave a detectable signal with D-pos/D-neg mixtures containing only 0.001% D-positive cells. Moreover, method II could detect the equivalent DNA amount present in only three nucleated cells in the assay without hybridization of PCR products, whereas the sensitivity of the other methods was 10-50 times less. Investigation of D variants indicated that false-negative results were obtained with method II (D(IVb) variant), method III (D(VI) and DFR variants) and method IV (D(VI) variants), but not method I. Weak D (D(u)) was correctly detected as D-positive by all methods, but most cases of Rh(null) appeared as false-positives, as they carry normal RH genes that are not phenotypically expressed. Some false-positive results were obtained with method I in a few Caucasian DNA samples serotyped as RhD-neg but carrying a C- or E-allele, whereas a high incidence of false-positives was found among non-Caucasian Rh-negative samples by all methods. In the Caucasian population, however, we found a full correlation between the predicted genotype and observed phenotype at birth of 92 infants. Although we routinely use the four methods for RHD genotyping, a PCR strategy based on at least two methods is recommended.
Hum Immunol. 2006 Jan-Feb;67(1-2):125-39. Epub 2005 Nov 4. Related Articles, Links
Disease Relevant HLA Class II Alleles Isolated by Genotypic, Haplotypic, and Sequence Analysis in North American Caucasians With Pemphigus Vulgaris.
Lee E, Lendas KA, Chow S, Pirani Y, Gordon D, Dionisio R, Nguyen D, Spizuoco A, Fotino M, Zhang Y, Sinha AA.
Department of Dermatology, Weill Medical College of Cornell University, New York, NY.
Early studies of genetic susceptibility to pemphigus vulgaris (PV) showed associations between human leukocyte antigen (HLA) DR4 and DR6 and disease. The emergence of DNA sequencing techniques has implicated numerous DRB1 and DQB1 loci in various populations, leading to confusion regarding which exact alleles confer susceptibility. The strong linkage disequilibrium among DR and DQ HLA alleles further complicates the investigation of the true susceptibility loci. In this study, we report genotyping data for the largest sampling of North American Caucasian non-Jewish and Ashkenazi Jewish PV patients studied to date and compare our data with other population studies. To pinpoint true susceptibility, alleles among overrepresented sequences, we applied a step-wise reductionist analysis through (1) determination of the degree of linkage disequilibrium (LD) between purportedly associated alleles, (2) haplotype frequencies comparisons, and (3) primary sequence comparisons of disease-associated versus non-disease-associated alleles to identify crucial differences in amino acid residues in putative peptide binding pockets. Collectively, our data provide extended support for the hypothesis that the HLA associations in Caucasian PV patients map to DRB1*0402 and DQB1*0503 alone. Further structure-function studies will be required to define the exact mechanisms of HLA-mediated control of susceptibility and resistance to disease.
PMID: 16698434 [PubMed - in process]
Ann Hum Genet. 2006 May;70(Pt 3):350-9. Related Articles, Links
A comparison of individual genotyping and pooled DNA analysis for polymorphism validation prior to large-scale genetic studies.
Yang HC, Lin CH, Hung SI, Fann CS.
Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan 115.
Polymorphism validation is an important issue in genetic studies because only polymorphic markers provide useful information. We analyzed genetic data for 180 SNPs in the human major histocompatibility complex region in Caucasian and Taiwanese populations, and evaluated ethnic heterogeneity between these populations to illustrate the importance of polymorphism validation. An initial individual genotyping experiment (IGE) with 95 samples was compared with a DNA pooling allele-typing experiment (PAE) of 630 individuals for polymorphism validation based on authentic data sets. Afterwards, all samples were genotyped individually in a confirmation study. Under narrow (broad) polymorphism criteria, 24 (41) polymorphic SNPs in Caucasians could not be validated in the Taiwanese population, suggesting a 13% (23%) inconsistency rate and revealing a strong discrepancy between genetic backgrounds, probably due to ethnic heterogeneity. IGE yielded high sensitivity and specificity for polymorphism validation, but may be sensitive to sampling variation. PAE showed high sensitivity (97%) and specificity (100%) using a narrow polymorphism criterion, but reduced specificity (83%) using a broad criterion. Public domain polymorphism databases should therefore be used with caution and polymorphism validation should be performed routinely prior to conducting large-scale genetic studies. PAE is a cost-saving, reliable alternative to IGE for polymorphism validation, especially for a stringent polymorphism criterion.
.
Posted by Clyde Winters (Member # 10129) on :
Supercar
quote:
You have been shown, as Rasol mentioned, different studies showing just how "Forensics" operate, all the while claiming to "predicting" socially constructed "racial" types. The shortcomings inherent in such approach to typological thinking in science, has been spelt out in the aforementioned studies on the issue of Forensics; you haven't yet addressed those points.
Where have you been I have already discussed these points by illustrating that race is a key aspect of forensic science.
The subject of this thread is race doesn't exist. It was originally claimed that race does not exist based on Templeton:
quote: "Race is a real cultural, political and economic concept in society, but it is not a biological concept, and that unfortunately is what many people wrongfully consider to be the essence of race in humans -- genetic differences," Templeton said. "Evolutionary history is the key to understanding race, and new molecular biology techniques offer so much on recent evolutionary history. I wanted to bring some objectivity to the topic. This very objective analysis shows the outcome is not even a close call: There's nothing even like a really distinct subdivision of humanity."
I have refuted the contention that scientist do not recognize distinct subdivisions of humanity.
1)I have shown that this is untrue. I presented evidence that Forensic scientists continue to use "race" as a way to classify humans
2) I have presented evidence that even geneticist use race when discussing the haplotype and haplogroup of individuals and populations.
These facts indicate that Templeton is wrong scientist still recognize a distinct subdivision of humanity. Race does exist.
.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Clyde Winters:
Where have you been I have already discussed these points by illustrating that race is a key aspect of forensic science.
Where have you been when you were asked to address the point made on the studies that point out the flaws associated with Forensic "predictions" based on typological concepts?
quote:Clyde Winters: The subject of this thread is race doesn't exist. It was originally claimed that race does not exist based on Templeton
And you are claiming it does: now, prove it by addressing the points and questions that you've dodged.
quote:Clyde:
I have refuted the contention that scientist do not recognize distinct subdivisions of humanity.
How so? If you have demonstrated this, then you would have produced substantiation on what biological parameters define "races" on humans, and address the points and questions forwarded to you. Feel free to do so any time soon.
quote:Clyde: 1)I have shown that this is untrue. I presented evidence that Forensic scientists continue to use "race" as a way to classify humans
You never addressed that studies that point out the flaws associated with Forensic "predictions", along "racial" typological lines. How then can you use "forensics" to claim that discrete biological "races" in humans exist?
quote:Clyde Winters:
2) I have presented evidence that even geneticist use race when discussing the haplotype and haplogroup of individuals and populations.
How so, when Templeton has just shown you what a bunch of nonesense that is - the same position that American Association of Anthropologists hold? How can you claim that a geneticist believes in "race", when you haven't deomonstrated that the said geneticist has proven the concept of human "races" in biology.
quote:Clyde Winters:
These facts indicate that Templeton is wrong scientist still recognize a distinct subdivision of humanity. Race does exist.
Nonsense from you, not to mention lack of answers, VINDICATE Templeton's point!
Posted by Clyde Winters (Member # 10129) on :
Supercar
quote:
You never addressed that studies that point out the flaws associated with Forensic "predictions", along "racial" typological lines. How then can you use "forensics" to claim that discrete biological "races" in humans exist?
This post is nonesense. It has nothing at all to do with this thread. I can use forensic scientist to discuss the fact that race exist in science because they use genetics to identify humans and classify these humans into racial groups.
You claim that I am not being honest in my replies to this issue because I have not responded to your post about Fordisc 2.0. I did not discuss this issue because this is a DOI, here we are discussing scientists not computer programs.
Supercar
quote:
Reports of Fordisc 2.0 analyses in the primary literature are scarce, suggesting that practitioners of this program are using a tool that has not been systematically tested for validity. Fordisc 2.0 produced poor results in Ubelaker, Ross, and Graver’s (2002) study of sixteenthand seventeenth-century Spanish crania, with half the crania being attributed to non-European/North African samples using one of its data sets, Howells’s (1973, 1995) cranial series, and less than half attributed to the white category using its other data set, the Forensic Data Bank (Ousley and Jantz 1996). Ubelaker et al. (2002) nevertheless call it “a powerful tool in forensic analysis that is routinely employed in most North American forensic laboratories” and generally support its use provided that care is taken when the samples are not represented in either of its databases (see also Ousley and Jantz 1996). Other researchers are less convinced of Fordisc’s practical use. Fukuzawa and Maish (1997) sought to ascribe ancestry to Native Canadians without success, and Leathers, Edwards, and Armelagos (2002) and Belcher, Williams, and Armelagos (2002) found that the program failed to classify populations as expected. We used both of its data sets to identify cranial remains from an ancient Meroitic Nubian population and found that it accurately classified very few of these remains.
I don’t think you read this article. It is not a testimony to the errors of Forensic science, it is discussing Fordisc 2.0. Fordisc 2.0 is a digital object identifier (DOI) . This is a computer program. We are not talking about the problems in the data set of a DOI, we are talking about the use of race/racial terms in biology.
I am not talking about a computer programs I am talking about Forensic scientists. The article you cited has nothing to do at all with this thread.
Supercar
quote:
You have been shown, as Rasol mentioned, different studies showing just how "Forensics" operate, all the while claiming to "predicting" socially constructed "racial" types. The shortcomings inherent in such approach to typological thinking in science, has been spelt out in the aforementioned studies on the issue of Forensics; you haven't yet addressed those points.
This study is concerned with a computer program.I have already discussed these points by illustrating that race is a key aspect of forensic science.
The subject of this thread is race doesn't exist. It was originally claimed that race does not exist based on Templeton:
quote: "Race is a real cultural, political and economic concept in society, but it is not a biological concept, and that unfortunately is what many people wrongfully consider to be the essence of race in humans -- genetic differences," Templeton said. "Evolutionary history is the key to understanding race, and new molecular biology techniques offer so much on recent evolutionary history. I wanted to bring some objectivity to the topic. This very objective analysis shows the outcome is not even a close call: There's nothing even like a really distinct subdivision of humanity."
I have refuted the contention that scientist do not recognize distinct subdivisions of humanity.
1)I have shown that this is untrue. I presented evidence that Forensic scientists continue to use "race" as a way to classify humans
2) I have presented evidence that even geneticist use race when discussing the haplotype and haplogroup of individuals and populations.
These facts indicate that Templeton is wrong scientist still recognize a distinct subdivision of humanity. Race does exist.
Below is a list of studies discussing race using DNA to denote differences.
: Hum Immunol. 2006 Jan-Feb;67(1-2):73-84. Epub 2006 Apr 5. Related Articles, Links The haplotype structure of the human major histocompatibility complex.Alper CA, Larsen CE, Dubey DP, Awdeh ZL, Fici DA, Yunis EJ.CBR Institute for Biomedical Research, Boston, MA 02115, USA; Department of Pediatrics, Harvard Medical School, Boston, MA 02115, USA.There is great interest in the use of single-nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) analysis to localize human disease genes. The results suggest that the human genome, including the major histocompatibility complex (MHC), consists largely of 5- to 200-kb blocks of sequence fixity between which random recombination occurs. Direct determination of MHC haplotypes from family studies also demonstrates similar-sized blocks, but otherwise gives a very different picture, with a third to a half of Caucasian haplotypes fixed from HLA-B to HLA-DR/DQ (at least 1 Mb) as conserved extended haplotypes (CEHs), some of which encompass more than 3 Mb. These fixed haplotypes differ in frequency both in different Caucasian subpopulations and in Caucasian patients with HLA-associated diseases, complicating disease susceptibility gene localization. The inherent inability of LD analysis to "see" DNA fixity beyond three markers contributes to the failure of SNP/LD analysis to define in detail or even detect CEHs in the MHC and probably elsewhere in the genome. More importantly, the use of statistical analysis, rather than direct haplotype determination and counting, fails to reveal the details of haplotype structure essential for gene localization. Given the oversimplified picture of the MHC (and probably the rest of the genome) provided only by SNP/LD-defined blocks, it is questionable whether this approach will be of great help in disease susceptibility gene localization or identification.
Br J Haematol. 1997 Aug;98(2):356-64. Related Articles, Links
Specificity and sensitivity of RHD genotyping methods by PCR-based DNA amplification.
Aubin JT, Le Van Kim C, Mouro I, Colin Y, Bignozzi C, Brossard Y, Cartron JP.
Centre d'Hemobiologie Perinale, Paris, France.
We have compared the sensitivity and specificity of four PCR methods of RHD gene detection using different sets of primers located in the regions of highest divergence between the RHD and RHCE genes, notably exon 10 (method I), exon 7 (method II), exon 4 (method III) and intron 4 (method IV). Methods I-III were the most sensitive and gave a detectable signal with D-pos/D-neg mixtures containing only 0.001% D-positive cells. Moreover, method II could detect the equivalent DNA amount present in only three nucleated cells in the assay without hybridization of PCR products, whereas the sensitivity of the other methods was 10-50 times less. Investigation of D variants indicated that false-negative results were obtained with method II (D(IVb) variant), method III (D(VI) and DFR variants) and method IV (D(VI) variants), but not method I. Weak D (D(u)) was correctly detected as D-positive by all methods, but most cases of Rh(null) appeared as false-positives, as they carry normal RH genes that are not phenotypically expressed. Some false-positive results were obtained with method I in a few Caucasian DNA samples serotyped as RhD-neg but carrying a C- or E-allele, whereas a high incidence of false-positives was found among non-Caucasian Rh-negative samples by all methods. In the Caucasian population, however, we found a full correlation between the predicted genotype and observed phenotype at birth of 92 infants. Although we routinely use the four methods for RHD genotyping, a PCR strategy based on at least two methods is recommended.
Hum Immunol. 2006 Jan-Feb;67(1-2):125-39. Epub 2005 Nov 4. Related Articles, Links
Disease Relevant HLA Class II Alleles Isolated by Genotypic, Haplotypic, and Sequence Analysis in North American Caucasians With Pemphigus Vulgaris.
Lee E, Lendas KA, Chow S, Pirani Y, Gordon D, Dionisio R, Nguyen D, Spizuoco A, Fotino M, Zhang Y, Sinha AA.
Department of Dermatology, Weill Medical College of Cornell University, New York, NY.
Early studies of genetic susceptibility to pemphigus vulgaris (PV) showed associations between human leukocyte antigen (HLA) DR4 and DR6 and disease. The emergence of DNA sequencing techniques has implicated numerous DRB1 and DQB1 loci in various populations, leading to confusion regarding which exact alleles confer susceptibility. The strong linkage disequilibrium among DR and DQ HLA alleles further complicates the investigation of the true susceptibility loci. In this study, we report genotyping data for the largest sampling of North American Caucasian non-Jewish and Ashkenazi Jewish PV patients studied to date and compare our data with other population studies. To pinpoint true susceptibility, alleles among overrepresented sequences, we applied a step-wise reductionist analysis through (1) determination of the degree of linkage disequilibrium (LD) between purportedly associated alleles, (2) haplotype frequencies comparisons, and (3) primary sequence comparisons of disease-associated versus non-disease-associated alleles to identify crucial differences in amino acid residues in putative peptide binding pockets. Collectively, our data provide extended support for the hypothesis that the HLA associations in Caucasian PV patients map to DRB1*0402 and DQB1*0503 alone. Further structure-function studies will be required to define the exact mechanisms of HLA-mediated control of susceptibility and resistance to disease.
PMID: 16698434 [PubMed - in process]
Ann Hum Genet. 2006 May;70(Pt 3):350-9. Related Articles, Links
A comparison of individual genotyping and pooled DNA analysis for polymorphism validation prior to large-scale genetic studies.
Yang HC, Lin CH, Hung SI, Fann CS.
Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan 115.
Polymorphism validation is an important issue in genetic studies because only polymorphic markers provide useful information. We analyzed genetic data for 180 SNPs in the human major histocompatibility complex region in Caucasian and Taiwanese populations, and evaluated ethnic heterogeneity between these populations to illustrate the importance of polymorphism validation. An initial individual genotyping experiment (IGE) with 95 samples was compared with a DNA pooling allele-typing experiment (PAE) of 630 individuals for polymorphism validation based on authentic data sets. Afterwards, all samples were genotyped individually in a confirmation study. Under narrow (broad) polymorphism criteria, 24 (41) polymorphic SNPs in Caucasians could not be validated in the Taiwanese population, suggesting a 13% (23%) inconsistency rate and revealing a strong discrepancy between genetic backgrounds, probably due to ethnic heterogeneity. IGE yielded high sensitivity and specificity for polymorphism validation, but may be sensitive to sampling variation. PAE showed high sensitivity (97%) and specificity (100%) using a narrow polymorphism criterion, but reduced specificity (83%) using a broad criterion. Public domain polymorphism databases should therefore be used with caution and polymorphism validation should be performed routinely prior to conducting large-scale genetic studies. PAE is a cost-saving, reliable alternative to IGE for polymorphism validation, especially for a stringent polymorphism criterion.
quote: quote:Clyde Winters:
2) I have presented evidence that even geneticist use race when discussing the haplotype and haplogroup of individuals and populations.
quote: Supercar
How so, when Templeton has just shown you what a bunch of nonesense that is - the same position that American Association of Anthropologists hold? How can you claim that a geneticist believes in "race", when you haven't deomonstrated that the said geneticist has proven the concept of human "races" in biology.
The articles above prove the lie to your thesis. The fact that the authors of the articles discussed above use racial terms to identify the human populations in association with DNA evidence makes it clear that the concept of "race" continues to be part of biological research.
.
Posted by rasol (Member # 4592) on :
quote: Supercar:
You never addressed that studies that point out the flaws associated with Forensic "predictions", along "racial" typological lines. How then can you use "forensics" to claim that discrete biological "races" in humans exist?
quote:Dr. Winters: This post is nonesense. It has nothing at all to do with this thread.
You respond to questions by calling them nonsense, instead of answering them.
Bad habit that.
Any intelligent reader detects that you simply have no answer to SuperCar's question, and are now monologuing, and not dialoguing.
You can't make any point with *anyone* in this fashion Dr. Winters.
m2c.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by rasol:
quote: Supercar:
You never addressed that studies that point out the flaws associated with Forensic "predictions", along "racial" typological lines. How then can you use "forensics" to claim that discrete biological "races" in humans exist?
quote:Dr. Winters: This post is nonesense. It has nothing at all to do with this thread.
You respond to questions by calling them nonsense, instead of answering them.
Indeed, notice how every point he has laid down, has either been refuted, or else he was questioned to further explain them to the end he is presumably using them. In all counts, he has failed to deliver.
Posted by rasol (Member # 4592) on :
^ I also found this comment amusing: we are discussing scientists *not* computer programs.
Dr. Winters 'believes' in the use of craniometry in forensics, but can't see the relevance of Fordisc - "forensic discriminant" assessment program, designed by Harvard scientist WW Howells for the purpose of lending mathamatical 'objectivity' to the process of skull measurement, and used by scientists the world over.
It's almost as if he prefers 19th century craniometics, based upon arbitrary whim, and common prejudice:
Craniometry is the measurement of cranial features in order to classify people according to race, criminal temperament, intelligence, etc.
The underlying assumption of craniometry is that skull size and shape determine brain size which determines such things as intelligence and capacity for moral behavior.
Empirical evidence for this assumption is not very strong. This fact has not hindered small-headed people from claiming they are members of a superior race or gender because the head size of their racial or gender group is larger on average than the head size of some other racial or gender group.
As members of superior races and gender, these small-headed people reason that they, too, must be superior to all members of races inferior to their own and of all members of the other gender.
In logic, this is called the fallacy of division: reasoning that what is true of the whole or group must also be true of the parts or members of the group.
In the 19th century, the British used craniometry to justify its racist policies toward the Irish and black Africans, whom the British considered to be inferior races. Irish skulls were said to have the shape of Cro-Magnon men and were akin to that of apes, proof of their inferiority along with black Africans.
In France, Paul Broca demonstrated that women are inferior to men because of their smaller crania.
He argued against higher education for women because their small brains couldn't handle the demands.*
In the 20th century, the Nazis used craniometry and anthropometry to distinguish Aryans from non-Aryans.
The Belgians used these pseudosciences, among other things, to distinguish Hutus from Tutsis in Rwanda. "In the 1930s the Belgians required everybody [in Rwanda] to start carrying an identity card classifying themselves as Hutu or Tutsi, thereby markedly increasing the ethnic distinction that had already existed" - (Diamond 2005: 314).
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote: You respond to questions by calling them nonsense, instead of answering them.
Bad habit that.
Any intelligent reader detects that you simply have no answer to SuperCar's question, and are now monologuing, and not dialoguing.
You can't make any point with *anyone* in this fashion Dr. Winters.
Where have you been. The studies Supercar presented discussed the lack of validity in using Fordisc 2.0, to digically analyze populations. This is a computer program. The problems with this program can be corrected by adjusting the data base of Fordisc 2.0. The failure of one DOI does nothing to falsify the existence of "race" as a term used to identify biological samples of human remains.
Again this is a DOI. There are many data bases used for comparison in physical anthropology. This says nothing about the use of race in science.
I have presented articles from the United States Government's Mitochondrial DNA: Coding Region SNP Assay Development Project. The Participants: Peter M. Vallone, Michael D. Coble, Margaret C. Kline, and John M. Butler (AFDIL participants: Rebecca Just and Thomas Parsons)
Purpose: The development of multiplex primer extension assays to probe coding region mitochondrial SNPs to help resolve common mitotypes.
Progress: The typing of single nucleotide polymorphisms (SNPs) located throughout the mitochondrial genome (mtGenome) allows for differentiation between individuals possessing an identical HV1/HV2 sequence. A set of 11 SNPs selected for distinguishing individuals of the most common Caucasian HV1/HV2 mitotype were incorporated in an allele-specific primer extension assay. The 11-plex assay probed SNPs located at positions 477, 3010, 4580, 4793, 5004, 7028, 7202, 10211, 12858, 14470 and 16519 in the mtGenome. The assay was optimized for multiplex detection of these SNPs. Primers were designed to allow for the simultaneous polymerase chain reaction (PCR) amplification of 11 unique regions in the mtGenome. Locus specific primers of varying lengths were employed in multiplex primer extension reactions. Extension primers binding 5’ adjacent to the SNP site of interest were enzymatically extended using fluorescently labeled dideoxynucleotides (ddNTPs). Resolution and detection of each extended fragment were achieved by analysis on a capillary-based electrophoresis (CE) platform. The electrophoretic mobility for the extension primers was compared in denaturing POP4 and POP6 CE running buffers. Empirical adjustment of extension primer concentrations resulted in even signal intensity for the 11 loci probed. The development of the mtSNP 11-plex assay has resulted in an accurate method for typing sequence variant mtSNPs on a platform common to forensic laboratories. We are currently developing additional multiplex SNP panels to resolve other common mitotypes (Caucasian, Hispanic, and African American).
Publications Resulting From This Project: Kline, M.C., Vallone, P.M., Redman, J.W., Duewer, D.L., Calloway, C.D., and Butler, J.M. (2005) Mitochondrial DNA typing screens with control region and coding region SNPs. J. Forensic Sci. 50(2): 377-385.
Just, R.S., Irwin, J.A., O'Callaghan, J.E., Saunier, J.L., Coble, M.D., Vallone, P.M., Butler, J.M., Barritt, S.M., and Parsons, T.J. (2004) Toward increased utility of mtDNA in forensic identifications. Forensic Sci. Int. 146S: S147-S149.
Vallone, P.M., Just, R.S., Coble, M.D., Butler, J.M., and Parsons, T.J. (2004) A multiplex allele-specific primer extension assay for forensically informative SNPs distributed throughout the mitochondrial genome. Int. J. Legal Med. 118: 147-157.
Coble, M.D., Just, R.S., O'Callaghan, J.E., Letmanyi, I.H., Peterson, C.T., Irwin, J.A., Parsons, T.J. (2004) Single nucleotide polymorphisms over the entire mtDNA genome that increase the power of forensic testing in Caucasians. Int. J. Legal Med. 118: 137-146.
These articles use genetics to identify individuals according to their race. The results of this project makes it clear that the concept of race is still a part of biology.
Race does exist
.
Posted by rasol (Member # 4592) on :
quote:Where have you been. The studies Supercar presented discussed the lack of validity in using Fordisc 2.0, to digically analyze populations
This is the 21st century Dr. Winters. Computer programs are essential tools to Forensic science. If you can't even grasp the use of computers in forensic science then the question is.......Where have YOU been for the last 50 odd years? The central point of the studies in question is over the validity of 'race', not computers.
If it is a pseudoscience, why does Keita use it in his discussion of the ethnicity of the ancient Egyptians?
Moreover as pointed out by the United States Government's Mitochondrial DNA: Coding Region SNP Assay Development Project, forensic scientists use DNA in addition to Craniometry to establish the racial identity of individuals.
Both the use of DNA and craniometry by forensic scientists make it clear that 'race' continues to be a key concept of biology.
.
Posted by rasol (Member # 4592) on :
quote:If it is a pseudoscience, why does Keita use it in his discussion of the ethnicity of the ancient Egyptians?
Read carefully - Craniometry AND pseudoscience, not craniometry IS pseudoscience.
It means the article examines the relationship between the two.
Now that you understand this, go back and read it, and learn.
Also read the thread on pseudoscience. It will help you move beyound the 19th century time warp of pseudoscientific racialism you are mired in.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
This is the 21st century Dr. Winters. Computer programs are essential tools to Forensic science. If you can't even grasp the use of computers in forensic science then the question is.......Where have YOU been for the last 50 odd years?
You've proven that Scientific illiteracy does exist.
I agree. You know nothing about physical anthropological methods. If not for your scientific illiteracy you would know that their are numerous data sets forensic scientists can use to conduct their work.
You can do forensic work without a computer.
.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
quote:If it is a pseudoscience, why does Keita use it in his discussion of the ethnicity of the ancient Egyptians?
Read carefully - Craniometry AND pseudoscience, not craniometry IS pseudoscience.
I am glad you cleared this up. The fact remains though, craniometrics deals with the "race" of the individuals under study. Since race is part of this science, race does exist. Right.
.
Posted by rasol (Member # 4592) on :
^Wrong. Dr. Keita, whom you just mentioned, utilises craniometry and like most anthropologist concludes that race is not scientifically valid.
You know this.
So you're dead in the water in this thread.
For all practicle purposes your argument died when you couldn't answer any of the questions about the material that you presented.
Material that did not support your scientifically illiterate argument in any case.
quote:Winters: You can do forensic work without a computer.
And you can dig without a shovel, or bulldozer.
More to the point: Did anyone say it was not possible to do 'forensic work' without a computer? No.
Did you suggest that use of computers "invalidated" forensic work? Yes.
Did you provide any support for this or any of your other ridiculous claims? No.
As for computers, they merely crunch numbers.
This they do very well. They are excellent for testing the validity of theorem based on the principal - garbage in, garbage out.
The problem lies in the theory of race typologies - which are garbage, not in the computers mathamatical acuity, which accurately expose the fallacy of race.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
So you're dead in the water in this thread.
For all practicle purposes your argument died when you couldn't answer any of the questions about the material that you presented.
Material that did not support your scientifically illiterate argument in any case.
You just like to see what you write in this forum. I answered all the questions you and Supercar proposed.
Rasol asked:
1) show us that different SNP markers can be used to systematically classify populations into races.
Forensic value of the multicopy Y-STR marker DYS464
John M. Butler * , Richard Schoske 1 Biotechnology Division, National Institute of Standards and Technology, Gaithersburg, MD, USA Abstract. The tetranucleotide Y-chromosome short tandem repeat (Y-STR) marker, DYS464, first reported by Redd et al. [Forensic Sci. Int. 130 (2002) 97] appears to be the most polymorphic Y-STR marker discovered to date. A single primer pair can generate up to four distinct peaks over an allele range of 9–20 repeats. Allele calls can be made based on peaks that are present (conservative approach; C-type) or a combination of alleles and peak height ratios (expanded typing method; E- type). We have observed 113 C-types and 179 E-types in 679 males from three US populations. D 2003 Elsevier B.V. All rights reserved. Keywords: Y-STR; Y-chromosome; DYS464; Multicopy loci; DNA typing 1. Introduction DYS464 occurs at least four times in the highly palindromic region near the center of the long arm of the Y-chromosome [1–3]. In forensic casework applications where the amount of typable DNA material may be limited, the use of highly polymorphic markers is advantageous in order to limit the number of markers needed to distinguish unrelated individuals. 2. Materials and methods A total of 679 unique male DNA samples from three different US populations [4] were typed with DYS464 along with 21 additional Y-chromosome short tandem repeat (Y-STR) markers [3]. Only the DYS464 results are described in this report. Two novel DYS464 primer pairs, which differ from those originally described by Redd et al. [2], were used. 0531-5131/ D 2003 Elsevier B.V. All rights reserved. doi:10.1016/S0531-5131(03)01713-8 $ Points of view are those of the authors and do not necessarily represent the position of the US Departments of Justice or Defense. Certain commercial equipment, instruments, and materials are identified in order to specify experimental procedures as completely as possible. In no case does such identification imply a recommendation or endorsement by the National Institute of Standards and Technology, nor does it imply that any of the materials, instruments, or equipment identified are necessarily the best available for the purpose. * Corresponding author. Tel.: +1-301-975-4049; fax: +1-301-975-8505. E-mail address: john.butler@nist.gov (J.M. Butler). 1 Current address: Armed Forces Institute of Pathology, Washington, DC, USA. www.ics-elsevier.com International Congress Series 1261 (2004) 278–280
Page 2 The primers VIC-CTTTGGGCTATGCCTCAGTTT and GCCATACCTGGGTAACAGA- GAGAC produce green-labeled amplicons in the size range of 242–286 bp for DYS464 alleles 9–20, while the primers 6FAM-AGTTTACGAGCTTTGGGCTATG and GTGGCAAGATCTCATTTCTTCAA generate blue dye-labeled polymerase chain reac- tion (PCR) products that are 327–367 bp in size. PCR conditions are as previously described for the Y-STR 20plex [5]. An allelic ladder was created for DYS464 (Fig. 1), which contains all of the major alleles as well as single-base variants observed in our population study [3]. 3. Results and discussion We observed 179 expanded types with DYS464 in 679 male samples from three different US population sets: 265 African–Americans, 262 Caucasians, and 152 His- panics. The addition of peak height information (E-type) to just allele calls (C-type) can result in an expansion in the number of types observed (e.g., Fig. 2). The most common types are 15,15,17,17, which occurs in 10.6% of this data set, and 15,15,16,17, which occurs in 7.5%. All other DYS464 types are found at less than the 5% level, with over half of the observed types occurring only once (92 of 179 observed). If the DYS464 data are collapsed to C-types (conservative typing method), then 113 allele calls are observed in these 679 males. By way of comparison to other DNA typing markers in the same data set, DYS385 exhibited only 56 different types and FGA, the single best autosomal STR examined, had only 78 different genotypes. Furthermore, the four single-copy Y-STRs DYS19, DYS391, DYS392, and DYS393, when combined, only produced 93 different Fig. 1. NIST allelic ladder for DYS464 produced from eight different DNA samples. The variant alleles 14.3, 15.1, and 15.3 are helpful as a tool for measuring single-base resolution in electrophoretic systems. Fig. 2. Example of four samples with the same conservative DYS464 type, 14,15,18, which can be separated from one another by considering their expanded type through peak height variation. J.M. Butler, R. Schoske / International Congress Series 1261 (2004) 278–280 279
Page 3 haplotypes. Thus, DYS464 is more polymorphic than DYS385, the previously considered best multicopy Y-STR, and four single-copy Y-STRs in combination. A human Y- chromosome DNA profiling standard, NIST Standard Reference Material (SRM) 2395, is available and contains DYS464 information on its five male samples (see http:// www.nist.gov/srm). This SRM will enable laboratories worldwide to accurately calibrate their DYS464 typing results. Acknowledgements This work was supported by research funds from the US National Institute of Justice through Interagency Agreement 1999-IJ-R-094 with the NIST Office of Law Enforcement Standards. Much of this work was performed while R.S. was a graduate student at the NIST and the American University through funding from the US Air Force. The technical assistance and suggestions of Peter Vallone, David Duewer, Margaret Kline, and Jan Redman from our group at the NIST and Alan Redd from the University of Arizona are gratefully acknowledged. References [1] J.M. Butler, Recent developments in Y-short tandem repeat and Y-single nucleotide polymorphism analysis, Forensic Sci. Rev. 15 (2003) 91–111. [2] A.J. Redd, A.B. Agellon, V.A. Kearney, T. Karafet, P. de Knijff, H. Park, J.M. Butler, M.F. Hammer, Forensic value of fourteen novel STRs on the human Y chromosome, Forensic Sci. Int. 130 (2002) 97–111. [3] R. Schoske, P.M. Vallone, M.C. Kline, J.W. Redman, J.M. Butler, High-throughput Y-STR typing of U.S. populations with 27 regions of the Y chromosome using two multiplex PCR assays, Forensic Sci. Int. (In press). [4] J.M. Butler, R. Schoske, P.M. Vallone, J.W. Redman, M.C. Kline, Allele frequencies for 15 autosomal STR loci on U.S. Caucasian, African American, and Hispanic populations, J. Forensic Sci. 48 (4) (2003) 908–911. [5] J.M. Butler, R. Schoske, P.M. Vallone, M.C. Kline, A.J. Redd, M.F. Hammer, A novel multiplex for simultaneous amplification of 20 Y chromosome STR markers, Forensic Sci. Int. 129 (2002) 10–24. J.M. Butler, R. Schoske / International Congress Series 1261 (2004) 278–280 280
J Forensic Sci, July 2004, Vol. 49, No. 4 Paper ID JFS2003303 Available online at: www.astm.org Peter M. Vallone,1 Ph.D. and John M. Butler,1 Ph.D. Y-SNP Typing of U.S. African American and Caucasian Samples Using Allele-Specific Hybridization and Primer Extension∗ ABSTRACT: Multiplex analysis of genetic markers has become increasingly important in a number of fields, including DNA diagnostics and human identity testing. Two methods for examination of single nucleotide polymorphisms (SNPs) with a potential for a high degree of multiplex analysis of markers are primer extension with fluorescence detection, and allele-specific hybridization using flow cytometry. In this paper, we examined 50 different SNPs on the Y-chromosome using three primer extension multiplexes and five hybridization multiplex assays. For certain loci, the allele-specific hybridization method exhibited sizable background signal from the absent alternate allele. However, 100% concordance (>2000 alleles) was observed in ten markers that were typed using both methods. A total of 18 unique haplogroups out of a possible 45 were observed in a group of 229 U.S. African American and Caucasian males with the majority of samples being assigned into 2 of the 18 haplogroups. KEYWORDS: forensic science, Y-chromosome, single nucleotide polymorphism, SNP typing, Y-SNPs, SNaPshot, primer extension, Luminex, allele-specific hybridization In recent years, single nucleotide polymorphisms (SNPs) have become more widely used in a variety of applications, including medical diagnostics, population genetics, and human identity testing (1,2). The ability to analyze a number of SNP markers in parallel relies on multiplex amplification and detection formats (3). Two SNP detection formats capable of multiplex analysis are allelespecific primer extension (ASPE) and allele-specific hybridization (ASH), which we use here to examine variation along the Y-chromosome. The lack of recombination along most of the Y-chromosome makes it a useful tool in human evolutionary studies and assessing male migration patterns (4–10). Y-chromosome markers have also been used in attempts to address some interesting historical questions (11,12). Analysis of Y-SNP markers has typically been done with manual techniques such as restriction digestion of PCR products (10,13) or by procedures that can only examine one or two markers simultaneously such as allele-specific PCR (7), denaturing high performance liquid chromatography (5), melting curve analysis (14), and real-time PCR (15). More recently, microarrays (16), time-of-flight mass spectrometry (17), and fluorescent primer extension (10,18) have been applied to Y-SNP analysis in order to type multiple markers in parallel. In an effort to evaluate the usefulness of Y-chromosome SNP markers for human identity applications, we constructed several novel multiplex ASPE assays and utilized a new commercial ASH 1 Biotechnology Division, National Institute of Standards and Technology, Gaithersburg, MD 20899-8311. ∗ Contribution of the U.S. National Institute of Standards and Technology. Certain commercial equipment, instruments, and materials are identified in order to specify experimental procedures as completely as possible. In no case does such identification imply a recommendation or endorsement by the National Institute of Standards and Technology nor does it imply that any of the materials, instruments, or equipment identified are necessarily the best available for the purpose. Received 6 Sept. 2003; and in revised form 21 Dec. 2003, 6 March 2004. accepted 6 March 2004; published XXXX. kit to type 50 Y-SNP markers in more than 200 individuals. In addition, by examining ten of the Y-SNPs with both methods, we were able to assess concordance in more than 2000 allele calls between primer extension and hybridization approaches. Methods U.S. African American and Caucasian DNA Samples Anonymous liquid blood samples with self-identified ethnicities were purchased from Interstate Blood Bank, Inc. (Memphis, TN) and Millennium Biotech, Inc. (Ft. Lauderdale, FL) and extracted using a modified salting out procedure (19). Carll Ladd from the Connecticut Forensic Laboratory (Meriden, CT) kindly provided extracted DNA for 20 U.S. Caucasian and 20 African American samples usedas part of this study. TheextractedDNAwas quantified using ultraviolet (UV) spectrophotometry followed by a PicoGreen assay (20) to adjust concentrations to approximately 1 ng/µL. All samples were examined with 15 autosomal short tandem repeats and the amelogenin sex-typing marker using the AmpF_STR Identifiler Kit to verify that each sample was unique (21). A total of 229 male samples were typed (115 African Americans and 114 Caucasians). Y-SNP Markers A total of 50 Y-chromosome biallelic markers were used to cover all 18 major haplogroups (A-R) recognized by the Y-chromosome consortium (YCC) (22,23). Table 1 contains a summary of the YSNP markers used in this study according to their physical position along theY-chromosome. These positions were identified using amplicon sequences for the 50 Y-SNPs with the BLAST-Like Alignment Tool (BLAT): http://genome.ucsc.edu/cgi-bin/hgBlat. Of the 50 Y-SNPs, 18 was typed by three hexaplex allele specific primer extension assays. An additional set of 42 Y-SNP loci was typed by an ASH assay described below. Ten of the Y-SNP loci probed were redundant between the two sets. Copyright C_ 2004 by ASTM International, 100 Barr Harbor Drive, PO Box C700, West Conshohocken, PA 19428-2959. 723
J Forensic Sci, Mar. 2005, Vol. 50, No. 2 Paper ID JFS2004293 Available online at: www.astm.org TECHNICAL NOTE Margaret C. Kline,1 M.S.; Peter M. Vallone,1 Ph.D.; Janette W. Redman;1 David L. Duewer,2 Ph.D.; Cassandra D. Calloway,3,4 M.S.; and John M. Butler,1 Ph.D. Mitochondrial DNA Typing Screens with Control Region and Coding Region SNPs∗
ABSTRACT: Mitochondrial DNA (mtDNA) analysis has found an important niche in forensic DNA typing. It is used with highly degraded samples or low-copy number materials such as might be found from shed hair or bones exposed to severe environmental conditions. The primary advantage of mtDNA is that it is present in high copy number within cells and therefore more likely to be recovered from highly degraded specimens. A major disadvantage to traditional forensic mtDNA analysis is that it is time-consuming and labor-intensive to generate and review the 610 nucleotides of sequence information commonly targeted in hypervariable regions I and II (HVI and HVII) of the control region. In addition, common haplotypes exist in HVI/HVII mtDNA sequences that can reduce the ability to differentiate two unrelated samples. In this report we describe the utility of two newly available screening assays for rapid exclusion of non-matching samples. The LINEAR ARRAY mtDNA HVI/HVII Region-Sequencing Typing Kit (Roche Applied Science, Indianapolis, IN) was used to type 666 individuals from U.S. Caucasian, African American, and Hispanic groups. Processing of the LINEAR ARRAY probe panels “mito strips” was automated on a ProfiBlot workstation. Observable variation in 666 individuals is reported and frequencies of the mitotypes within and between populations are presented. Samples exhibiting the most common Caucasian mitotype were subdivided with a multiplexed amplification and detection assay using eleven single nucleotide polymorphisms in the mitochondrial genome. These types of screening assays should enable more rapid evaluation of forensic casework samples such that only samples not excluded would be subjected to further characterization through full HVI/HVII mtDNA sequence analysis. KEYWORDS: forensic science, DNA typing, mtDNA, SSO probes, mitochondrial DNA coding region, primer extension For the past decade, DNA sequencing of hypervariable regions I (HVI) and II (HVII) in the control region of mitochondrial DNA (mtDNA) has been useful in forensic casework for the analysis of human remains when nuclear DNA systems fail due to low amounts of DNA or highly degraded specimens (1–3). However, considerable effort and expense are required to develop a full HVI and HVII mtDNA sequence (typically positions 16024–16365 and 1 Biotechnology Division, National Institute of Standards and Technology, Gaithersburg, MD 20899. 2 Analytical Chemistry Division, National Institute of Standards and Technology, Gaithersburg, MD 20899. 3 Department of Human Genetics, Roche Molecular Systems, Alameda, CA 94501. 4 Comparative Biochemistry Group, University of California, Berkeley, CA. ∗ Contribution of the U.S. National Institute of Standards and Technology. Not subject to copyright. Certain commercial equipment, instruments and materials are identified in order to specify experimental procedures as completely as possible. In no case does such identification imply a recommendation or endorsement by the National Institute of Standards and Technology nor does it imply that any of the materials, instruments or equipment identified are necessarily the best available for the purpose. † Parts of this work were presented at the 2003 International Symposium on Human Identification, Phoenix, Arizona, and at the 2004 Annual Meeting of the American Academy of Forensic Sciences, Dallas, Texas. ‡ National Institute of Justice (NIJ) funded this work in part through an interagency agreement with the NIST Office of Law Enforcement Standards and NIJ grant 95-IJ-CX-0014 to Roche Molecular Systems. Received 31 July 2004; and in revised form 16 Oct. 2004; accepted 16 Oct. 2004; published 2 Feb. 2005. 73–340 are examined). Hence, several mtDNA screening methods have been developed (4–9). These screening methods permit rapid resolution of non-matching samples allowing a laboratory to focus more attention on full-sequencing of samples that cannot be resolved from one another with the screening method. Alternatively, laboratories without DNA sequencing capabilities or expertise can perform mtDNAtyping with a screening method and then send only those samples that are not excluded to a private or public laboratory for full HVI/HVII sequencing. This report details a number of inter-related technologies associated with the use of the newly available Linear Array Mitochondrial DNA HVI/HVII Region-Sequence Typing Kit (Roche Applied Science, Indianapolis, IN). The utility of a new microchip CE method for quantifying PCR products that are then hybridized to immobilized sequence specific oligonucleotide (SSO) probes is demonstrated. A semi-automated sample processing method for the Linear Arrays was developed and is demonstrated. The utility of this mtDNA typing kit is demonstrated by differentiating several hundred unrelated individuals from U.S. Caucasian, African American, and Hispanic groups. These results are compared to previous work with similar mtDNA SSO typing probes. The presence of multiple signals within a probe region resulting from sequence heteroplasmy is described as is the absence of signal within a probe region resulting from failed hybridization of PCR products due to additional destabilizing polymorphisms. In addition, a new coding region single nucleotide polymorphism (SNP) assay was employed to help subdivide 51 individuals possessing the most common Caucasian mtDNA haplotype (10,11). Copyright C_ 2005 by ASTM International, 100 Barr Harbor Drive, PO Box C700, West Conshohocken, PA 19428-2959. 377
378 JOURNAL OF FORENSIC SCIENCES Materials and Methods The steps involved in typing the control region SNPs with the mtDNA Linear Arrays are: DNA extraction/quantification, PCR amplification, PCR product quantification, hybridization of the PCR products to the Linear Arrays, detection with colored precipitate, interpretation of results for each sample, comparison of Linear Array results to other samples, and subdividing into groupings. Those samples possessing the most common Caucasian type were also processed with an additional coding region SNP assay as described below. DNA Samples A total of 666 DNA samples that had previously been extracted from whole blood were evaluated in this study. These samples, purchased from Interstate Blood Bank Inc. (Memphis, TN), are assumed to be unrelated and were classified into U.S. Caucasian (N =286), African American (N =252), or Hispanic (N =128) groups based on self-declaration. All samples possess unique STR profiles as determined previously with the AmpF_STR Identifier STR kit (Applied Biosystems, Foster City, CA) (12). Bloods were extracted by a modified “saltout” procedure (13). Portions of the genomic extracts were quantified by UV measurement on a Cary Bio 100 double-beam spectrophotometer (Varian Analytical Instruments, Walnut Creek, CA). Based on the UV/260 quantification, the samples were diluted to a nominal 1 ng/µL (14,15). The concentration of the diluted sample was verified by Pico Green quantitation to be between 0.5 ng/µL and 1.5 ng/µL (16). PCR Amplification One µL of each sample extract (≈1 ng/µL) was amplified using the mtDNA HVI/HVII Primer mix and mtDNA PCR Reaction Mix supplied by Roche Molecular Systems (Alameda, CA) as part of a beta-test of the Linear Array Mitochondrial DNA HVI/HVII Region-Sequence Typing kit. This kit is now available from Roche Applied Sciences (Indianapolis, IN) in the same format as described in this work (catalog number 03-527-867-001). Samples are amplified in a duplex PCR that simultaneously generates PCR products for HVI (positions 15975-16418) and HVII (positions 15–429). The HVI primers amplify an approximately 444 bp PCR product using the following primers: Forward (F15975-15993B) 5_-biotin-CTCCACCATTAGCACCCAA-3_ Reverse (R16418-16401B) 5_-biotin-ATTTCACGGAGGATGGTG-3_ The HVII primers amplify an approximately 416 bp PCR product using the following primers: Forward (F15-34B) 5_-biotin-CACCCTATTAACCACTCACG-3_ Reverse (R429-410B) 5_-biotin-CTGTTAAAAGTGCATACCGC-3_ Since 1 ng of genomic DNA was used rather than the “Kit” recommended 5 pg (based on nuclear DNA quantification), the number of amplification cycles was reduced from the recommended protocol. Whereas the standard protocol calls for 34–38 cycles, only 28 cycles were run in order to yield PCR products in the desired concentration range (see below). The PCR parameters used with a GeneAmp 9700 thermal cycler (Applied Biosystems) were: 94◦C for 14 min, 28 cycles of {92◦C for 15 s, 59◦C for 30 s, and 72◦C for 30 s}, final extension 72◦C for 10 min, and hold at 10◦C until the products could be removed from the thermal cycler. Amplification and typing of 11 SNP sites outside the HVI/HVII Region was performed using the multiplex amplification and allelespecific primer extension assay as previously published (11). These sites include SNPs at positions 3010, 4580, 4793, 5004, 7028, 7202, 10211, 12858, 14470 in the coding region and at positions 477 and 16519 in theVariable Regions (control region outside of HVI/HVII) that help differentiate the most common Caucasian Haplotype (10). Post-PCR Quantification Forty of the PCR products were quantified by loading 4 µL on to an agarose (3% mass NuSieve, 1% mass SeaKem GTG, Cambrex Bio Science Rockland, Inc., Rockland, ME) yield gel stained with ethidium bromide and imaged/analyzed with a FMBIO III plus (MiraiBio Inc., Alameda, CA). A yield gel quantification standard was supplied from Roche Molecular Systems as part of the beta-site test, which is the same as the DNA Molecular Weight Marker XIV 100 bp ladder available from Roche Applied Sciences (catalog number 1-721-933). A DNA Low Mass Ladder (catalog number 10068-013, Invitrogen, Carlsbad, CA) was also used for PCR product size estimation and quantification. All 666 HVI/HVII PCR products were quantified using the Agilent 2100 Bioanalyzer Lab Chip system (Agilent Technologies, Palo Alto, CA) and 1 µL of each PCR product according to the manufacturer’s protocols. The Agilent 2100 standard ladder calibrates for base pair (bp) sizing, and quantification for up to 12 samples per run (17). Two DNA fragments, 15 bp and 1500 bp, are added in each tested sample as internal standards to quantify PCR product amounts. Quantitation results were imported to an Excel spreadsheet in order to calculate the appropriate quantity of the PCR product to add to each Linear Array probe panel. Typically addition of ≈50 ng total amplified product to each probe panel was targeted. Control Region SNP Typing Manufacturer protocols for the Linear Arrays were followed in processing the HVI/HVII PCR products through hybridization to a nylon membrane containing specific probe sequences (Fig. 1). Allele-specific hybridization of the amplified DNA is detected using an enzymatic conversion of a soluble, colorless substrate to a blue-colored precipitate with the detection chemistry originally described by Saiki et al. (18). Cambridge Reference Sequence (19, 20) positions 16093, 16126, 16129, 16270, 16278, 16304, 16309, 16311, and 16362 from HVI and positions 73, 146, 150, 152, 189, 195, 198, 200, and 247 from HVII are probed in this assay. Samples were processed both manually (120 samples) and using a SLT ProfiBlot workstation (Tecan US, Research Triangle Park, NC) (remaining 446 samples). Steps in the developed Profiblot protocol are listed in Table 1. All reagents required for processing are pre-loaded onto the Tecan Profiblot. Up to 24 probe panels can be processed simultaneously in a 2 h run. The wash solution is placed in a heated/stirred heat block to maintain the required 55◦C temperature for hybridization. After the Linear Array probe panels are added to the tray, the Profiblot SLT instrument dispenses the
2) list the geneticist who support this theory with direct, clear statements to the effect that this is so.
Mitochondrial DNA: Coding Region SNP Assay Development
Participants: Peter M. Vallone, Michael D. Coble, Margaret C. Kline, and John M. Butler (AFDIL participants: Rebecca Just and Thomas Parsons)
Project Timeframe: 2001 to present
Purpose: The development of multiplex primer extension assays to probe coding region mitochondrial SNPs to help resolve common mitotypes.
Progress: The typing of single nucleotide polymorphisms (SNPs) located throughout the mitochondrial genome (mtGenome) allows for differentiation between individuals possessing an identical HV1/HV2 sequence. A set of 11 SNPs selected for distinguishing individuals of the most common Caucasian HV1/HV2 mitotype were incorporated in an allele-specific primer extension assay. The 11-plex assay probed SNPs located at positions 477, 3010, 4580, 4793, 5004, 7028, 7202, 10211, 12858, 14470 and 16519 in the mtGenome. The assay was optimized for multiplex detection of these SNPs. Primers were designed to allow for the simultaneous polymerase chain reaction (PCR) amplification of 11 unique regions in the mtGenome. Locus specific primers of varying lengths were employed in multiplex primer extension reactions. Extension primers binding 5’ adjacent to the SNP site of interest were enzymatically extended using fluorescently labeled dideoxynucleotides (ddNTPs). Resolution and detection of each extended fragment were achieved by analysis on a capillary-based electrophoresis (CE) platform. The electrophoretic mobility for the extension primers was compared in denaturing POP4 and POP6 CE running buffers. Empirical adjustment of extension primer concentrations resulted in even signal intensity for the 11 loci probed. The development of the mtSNP 11-plex assay has resulted in an accurate method for typing sequence variant mtSNPs on a platform common to forensic laboratories.
We are currently developing additional multiplex SNP panels to resolve other common mitotypes (Caucasian, Hispanic, and African American).
Publications Resulting From This Project: Kline, M.C., Vallone, P.M., Redman, J.W., Duewer, D.L., Calloway, C.D., and Butler, J.M. (2005) Mitochondrial DNA typing screens with control region and coding region SNPs. J. Forensic Sci. 50(2): 377-385.
Just, R.S., Irwin, J.A., O'Callaghan, J.E., Saunier, J.L., Coble, M.D., Vallone, P.M., Butler, J.M., Barritt, S.M., and Parsons, T.J. (2004) Toward increased utility of mtDNA in forensic identifications. Forensic Sci. Int. 146S: S147-S149.
Vallone, P.M., Just, R.S., Coble, M.D., Butler, J.M., and Parsons, T.J. (2004) A multiplex allele-specific primer extension assay for forensically informative SNPs distributed throughout the mitochondrial genome. Int. J. Legal Med. 118: 147-157.
Coble, M.D., Just, R.S., O'Callaghan, J.E., Letmanyi, I.H., Peterson, C.T., Irwin, J.A., Parsons, T.J. (2004) Single nucleotide polymorphisms over the entire mtDNA genome that increase the power of forensic testing in Caucasians. Int. J. Legal Med. 118: 137-146.
3) present a study classifying Dravidians and Africans into a distinct race based upon specific SNP markers.
The study of Sforza where he claims that Afro-Asiatic and Dravidian speakers are caucasian answers this question.
Supercar
quote:
Reports of Fordisc 2.0 analyses in the primary literature are scarce, suggesting that practitioners of this program are using a tool that has not been systematically tested for validity. Fordisc 2.0 produced poor results in Ubelaker, Ross, and Graver’s (2002) study of sixteenthand seventeenth-century Spanish crania, with half the crania being attributed to non-European/North African samples using one of its data sets, Howells’s (1973, 1995) cranial series, and less than half attributed to the white category using its other data set, the Forensic Data Bank (Ousley and Jantz 1996). Ubelaker et al. (2002) nevertheless call it “a powerful tool in forensic analysis that is routinely employed in most North American forensic laboratories” and generally support its use provided that care is taken when the samples are not represented in either of its databases (see also Ousley and Jantz 1996). Other researchers are less convinced of Fordisc’s practical use. Fukuzawa and Maish (1997) sought to ascribe ancestry to Native Canadians without success, and Leathers, Edwards, and Armelagos (2002) and Belcher, Williams, and Armelagos (2002) found that the program failed to classify populations as expected. We used both of its data sets to identify cranial remains from an ancient Meroitic Nubian population and found that it accurately classified very few of these remains.
I don’t think you read this article. It is not a testimony to the errors of Forensic science, it is discussing Fordisc 2.0. Fordisc 2.0 is a digital object identifier (DOI) . This is a computer program. We are not talking about the problems in the data set of a DOI, we are talking about the use of race/racial terms in biology.
I am not talking about a computer programs I am talking about Forensic scientists. The article you cited has nothing to do at all with this thread.
Supercar
quote: You have been shown, as Rasol mentioned, different studies showing just how "Forensics" operate, all the while claiming to "predicting" socially constructed "racial" types. The shortcomings inherent in such approach to typological thinking in science, has been spelt out in the aforementioned studies on the issue of Forensics; you haven't yet addressed those points.
This study is concerned with a computer program.I have already discussed these points by illustrating that race is a key aspect of forensic science.
The subject of this thread is race doesn't exist. It was originally claimed that race does not exist based on Templeton:
quote: "Race is a real cultural, political and economic concept in society, but it is not a biological concept, and that unfortunately is what many people wrongfully consider to be the essence of race in humans -- genetic differences," Templeton said. "Evolutionary history is the key to understanding race, and new molecular biology techniques offer so much on recent evolutionary history. I wanted to bring some objectivity to the topic. This very objective analysis shows the outcome is not even a close call: There's nothing even like a really distinct subdivision of humanity."
I have refuted the contention that scientist do not recognize distinct subdivisions of humanity.
1)I have shown that this is untrue. I presented evidence that Forensic scientists continue to use "race" as a way to classify humans
2) I have presented evidence that even geneticist use race when discussing the haplotype and haplogroup of individuals and populations. 3) I have presented evidence that Fordisc 2.0 is a computer program that has a poor data base, is only one among many data bases used by physical anthropology to determine race.
The forensic studies and comments by Sforza and other geneticists indicate that race does exist.
These facts indicate that Templeton is wrong scientist still recognize a distinct subdivision of humanity. Race does exist.
Posted by rasol (Member # 4592) on :
^Logical fallacy: Argumentum ad nauseam, the fallacy of trying to prove something by saying it again and again. But no matter how many times you repeat something, it will not become any more or less true than it was in the first place; this fallacy hopes that repettition alone will be confused with actual proof.
Actual proof:
Misclassification of Nubian Crania by Dr. Armelagos and Van Gervan 2003, their conclusions in their own words, speaks for itself, and cuts thru Winters ad nauseum fallacies:
quote:We suggest that skeletal specimens or samples cannot be accurately classified by geography or by racial affinity because of
(1) the wide variation in crania of the known series that cross-cuts geographic populations (polymorphism),
(2) the clinal pattern of human variation, and
(3) cultural and environmental factors.
Finally, the assumption that cranial form is an immutable “racial” character is very likely to be false.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
On the misclassification of Nubian Crania by Dr. Armelagos and Van Gervan 2003, their conclusions in their own words, it speaks for itself, and cuts thru your Winters ad nauseum fallacies:
We suggest that skeletal specimens or samples cannot be accurately clas-sified by geography or by racial affinity because of
(1) the wide variation in crania of the known series that cross-cuts geographic populations (polymorphism),
(2) theclinal pattern of human variation, and
(3) cultural and environmental factors.
Finally, the assumption that cranial form is an immutable “racial” character is very likely to be false
This is there opinion. It does not dispute the fact that forensic scientists use race to describe individuals and populations.
J Forensic Sci, Mar. 2005, Vol. 50, No. 2 Paper ID JFS2004293 Available online at: www.astm.org TECHNICAL NOTE Margaret C. Kline,1 M.S.; Peter M. Vallone,1 Ph.D.; Janette W. Redman;1 David L. Duewer,2 Ph.D.; Cassandra D. Calloway,3,4 M.S.; and John M. Butler,1 Ph.D. Mitochondrial DNA Typing Screens with Control Region and Coding Region SNPs∗
ABSTRACT: Mitochondrial DNA (mtDNA) analysis has found an important niche in forensic DNA typing. It is used with highly degraded samples or low-copy number materials such as might be found from shed hair or bones exposed to severe environmental conditions. The primary advantage of mtDNA is that it is present in high copy number within cells and therefore more likely to be recovered from highly degraded specimens. A major disadvantage to traditional forensic mtDNA analysis is that it is time-consuming and labor-intensive to generate and review the 610 nucleotides of sequence information commonly targeted in hypervariable regions I and II (HVI and HVII) of the control region. In addition, common haplotypes exist in HVI/HVII mtDNA sequences that can reduce the ability to differentiate two unrelated samples. In this report we describe the utility of two newly available screening assays for rapid exclusion of non-matching samples. The LINEAR ARRAY mtDNA HVI/HVII Region-Sequencing Typing Kit (Roche Applied Science, Indianapolis, IN) was used to type 666 individuals from U.S. Caucasian, African American, and Hispanic groups. Processing of the LINEAR ARRAY probe panels “mito strips” was automated on a ProfiBlot workstation. Observable variation in 666 individuals is reported and frequencies of the mitotypes within and between populations are presented. Samples exhibiting the most common Caucasian mitotype were subdivided with a multiplexed amplification and detection assay using eleven single nucleotide polymorphisms in the mitochondrial genome. These types of screening assays should enable more rapid evaluation of forensic casework samples such that only samples not excluded would be subjected to further characterization through full HVI/HVII mtDNA sequence analysis. KEYWORDS: forensic science, DNA typing, mtDNA, SSO probes, mitochondrial DNA coding region, primer extension For the past decade, DNA sequencing of hypervariable regions I (HVI) and II (HVII) in the control region of mitochondrial DNA (mtDNA) has been useful in forensic casework for the analysis of human remains when nuclear DNA systems fail due to low amounts of DNA or highly degraded specimens (1–3). However, considerable effort and expense are required to develop a full HVI and HVII mtDNA sequence (typically positions 16024–16365 and 1 Biotechnology Division, National Institute of Standards and Technology, Gaithersburg, MD 20899. 2 Analytical Chemistry Division, National Institute of Standards and Technology, Gaithersburg, MD 20899. 3 Department of Human Genetics, Roche Molecular Systems, Alameda, CA 94501. 4 Comparative Biochemistry Group, University of California, Berkeley, CA. ∗ Contribution of the U.S. National Institute of Standards and Technology. Not subject to copyright. Certain commercial equipment, instruments and materials are identified in order to specify experimental procedures as completely as possible. In no case does such identification imply a recommendation or endorsement by the National Institute of Standards and Technology nor does it imply that any of the materials, instruments or equipment identified are necessarily the best available for the purpose. † Parts of this work were presented at the 2003 International Symposium on Human Identification, Phoenix, Arizona, and at the 2004 Annual Meeting of the American Academy of Forensic Sciences, Dallas, Texas. ‡ National Institute of Justice (NIJ) funded this work in part through an interagency agreement with the NIST Office of Law Enforcement Standards and NIJ grant 95-IJ-CX-0014 to Roche Molecular Systems. Received 31 July 2004; and in revised form 16 Oct. 2004; accepted 16 Oct. 2004; published 2 Feb. 2005. 73–340 are examined). Hence, several mtDNA screening methods have been developed (4–9). These screening methods permit rapid resolution of non-matching samples allowing a laboratory to focus more attention on full-sequencing of samples that cannot be resolved from one another with the screening method. Alternatively, laboratories without DNA sequencing capabilities or expertise can perform mtDNAtyping with a screening method and then send only those samples that are not excluded to a private or public laboratory for full HVI/HVII sequencing. This report details a number of inter-related technologies associated with the use of the newly available Linear Array Mitochondrial DNA HVI/HVII Region-Sequence Typing Kit (Roche Applied Science, Indianapolis, IN). The utility of a new microchip CE method for quantifying PCR products that are then hybridized to immobilized sequence specific oligonucleotide (SSO) probes is demonstrated. A semi-automated sample processing method for the Linear Arrays was developed and is demonstrated. The utility of this mtDNA typing kit is demonstrated by differentiating several hundred unrelated individuals from U.S. Caucasian, African American, and Hispanic groups. These results are compared to previous work with similar mtDNA SSO typing probes. The presence of multiple signals within a probe region resulting from sequence heteroplasmy is described as is the absence of signal within a probe region resulting from failed hybridization of PCR products due to additional destabilizing polymorphisms. In addition, a new coding region single nucleotide polymorphism (SNP) assay was employed to help subdivide 51 individuals possessing the most common Caucasian mtDNA haplotype (10,11). Copyright C_ 2005 by ASTM International, 100 Barr Harbor Drive, PO Box C700, West Conshohocken, PA 19428-2959. 377
Posted by rasol (Member # 4592) on :
quote: Rasol
On the misclassification of Nubian Crania by Dr. Armelagos and Van Gervan 2003, their conclusions in their own words, it speaks for itself, and cuts thru Winters ad nauseum fallacies:
We suggest that skeletal specimens or samples cannot be accurately clas-sified by geography or by racial affinity because of
(1) the wide variation in crania of the known series that cross-cuts geographic populations (polymorphism),
(2) theclinal pattern of human variation, and
(3) cultural and environmental factors.
Finally, the assumption that cranial form is an immutable “racial” character is very likely to be false
quote:Winters: This is there opinion.
It is the conclusion of their forensic study, and it confirms Templeton.
In contrast - you can only post massive, blobs of incoherent cut and paste 'eyesore' spam that do not refute Templeton or Armegelos, answer anyones questions, or lend any support to your racialist views.
Ok, so go back to spamming....i'm done with you.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Clyde Winters:
Supercar
quote:
You never addressed that studies that point out the flaws associated with Forensic "predictions", along "racial" typological lines. How then can you use "forensics" to claim that discrete biological "races" in humans exist?
This post is nonesense. It has nothing at all to do with this thread. I can use forensic scientist to discuss the fact that race exist in science because they use genetics to identify humans and classify these humans into racial groups.
Do you know what you are talking about? If the highlighting of flaws associated with "Forensics" using "racial" typology to 'predict' socially constructed "races" - since naturally it hasn't been proven biologically - doesn't have anything to do with the topic at hand on the 'existence of race", then I don't know what does.
quote:Clyde Winters: You claim that I am not being honest in my replies to this issue because I have not responded to your post about Fordisc 2.0. I did not discuss this issue because this is a DOI, here we are discussing scientists not computer programs.
Actually, you haven't responded to at least three different studies highlighting the flaws associated with the idea of "Forensics" predicting "race", when such doesn't biologically exist in humans. This has nothing to do with "computer programs"; you would know this if you had read and understood the studies provided. Apparently you haven't read all them - or else, you are engaging in some unsavory act to hide from the fact that it doesn't support your suppositions.
quote:Clyde Winters:
I am not talking about a computer programs I am talking about Forensic scientists. The article you cited has nothing to do at all with this thread.
Neither am I; I am here on planet earth; which planet are you on?
quote:Clyde Winters:
Supercar
quote:
You have been shown, as Rasol mentioned, different studies showing just how "Forensics" operate, all the while claiming to "predicting" socially constructed "racial" types. The shortcomings inherent in such approach to typological thinking in science, has been spelt out in the aforementioned studies on the issue of Forensics; you haven't yet addressed those points.
This study is concerned with a computer program.I have already discussed these points by illustrating that race is a key aspect of forensic science.
See my post above, on what we are ACTUALLY discussing, and what you are dodging with these strawmen.
quote:Clyde Winters:
The subject of this thread is race doesn't exist. It was originally claimed that race does not exist based on Templeton:
Exactly, and you have yet to refute that conclusion.
quote:Clyde Winters:
I have refuted the contention that scientist do not recognize distinct subdivisions of humanity.
1)I have shown that this is untrue. I presented evidence that Forensic scientists continue to use "race" as a way to classify humans
2) I have presented evidence that even geneticist use race when discussing the haplotype and haplogroup of individuals and populations.
These facts indicate that Templeton is wrong scientist still recognize a distinct subdivision of humanity. Race does exist.[/b]
What purpose does it serve you to repeat claims which were just momentarily discredited point by point. See my earlier reply on these points, and address the issues raised therein, which you have unsucessfully dodged to this point. We know when you are not addressing the issues - trust me, it is that blatant.
quote:Clyde Winters:
quote:Super car:
quote:Clyde Winters:
2) I have presented evidence that even geneticist use race when discussing the haplotype and haplogroup of individuals and populations.
How so, when Templeton has just shown you what a bunch of nonesense that is - the same position that American Association of Anthropologists hold? How can you claim that a geneticist believes in "race", when you haven't deomonstrated that the said geneticist has proven the concept of human "races" in biology.
The articles above prove the lie to your thesis. The fact that the authors of the articles discussed above use racial terms to identify the human populations in association with DNA evidence makes it clear that the concept of "race" continues to be part of biological research.
Actually they don't, since you still haven't addressed the different studies on the flaws associated with Forensics in the attempt to determine "socially" constructed "races" in humans. What haplotypes are restricted to which "single" race, and define the parameters for that "race", and how these dilineate the said "race" from other human "races". For instance, if such "haplotypes" are restricted to a particular race, then does this mean others who don't carry the said "haplotypes" are a different "race"?
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote: quote: Rasol
On the misclassification of Nubian Crania by Dr. Armelagos and Van Gervan 2003, their conclusions in their own words, it speaks for itself, and cuts thru Winters ad nauseum fallacies:
We suggest that skeletal specimens or samples cannot be accurately clas-sified by geography or by racial affinity because of
(1) the wide variation in crania of the known series that cross-cuts geographic populations (polymorphism),
(2) theclinal pattern of human variation, and
(3) cultural and environmental factors.
Finally, the assumption that cranial form is an immutable “racial” character is very likely to be false
quote:Winters: This is there opinion.
It is the conclusion of their forensic study, and it confirms Templeton.
In contrast - you can only post massive, blobs of incoherent cut and paste 'eyesore' spam that do not refute Templeton or Armegelos, answer anyones questions, or lend any support to your racialist views.
Ok, so go back to spamming....i'm done with you.
What you call spamming is focusing on the evidence. Just because you present one study does not falsify my claim that race exist.
I have presented no fallacies in my discussion of race. As pointed out above, I have provided numerous studies indicating that forensic scientist continue to use racial terms in their genetic research. In addition, you admitted yourself that the father of genetic anthropology Sforza, classified the Dravidians and Afro-Asiatic speakers as caucasian. All of these studies confirm that race continues to be a major concept in biological research.
What you call "blobs of incoherent cut and paste 'eyesore', are studies showing how scientist use racial terms in their biological research studies. If the scientist use racial terms to define populations they are admitting that race does exist.
You are living in a dream world if you believe just because someone says race does not exist, racial thinking will disappear. Race will remain a part of biological science because people note a difference among individuals and population groups based on their ego.
.
Posted by rasol (Member # 4592) on :
quote:Winters: What you call spamming is focusing on the evidence.
No, but I suppose that if we wade thru the mass of garbage you attempt to distract us with we can zero in your *lack of evidence*.....
A set of approximately 650 anonymous population samples from U.S. Caucasians, African Americans, and Hispanics, SELF DECLARED ETHNICITIES. Posted by Clyde Winters (Member # 10129) on :
Supercar
quote: What purpose does it serve you to repeat claims which were just momentarily discredited point by point. See my earlier reply on these points, and address the issues raised therein, which you have unsucessfully dodged to this point. We know when you are not addressing the issues - trust me, it is that blatant.
I have answered every question you and Rasol have proposed . You have provided no evidence that the racial terms in the studies I posted did not exist.
The existence of said racial comments by scientists is all the evidence I need to prove that race exist in biological research , which is the subject of this thread. How can you discredit the fact that the scientist who wrote the studies used race in their studies.
The use of racial terms denotes the fact that race exist in biological research.
.
Posted by rasol (Member # 4592) on :
quote:I have answered every question you and Rasol have proposed
No, you haven't answered any of my questions. Sorry.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Clyde Winters:
I have answered every question you and Rasol have proposed . You have provided no evidence that the racial terms in the studies I posted did not exist.
The first and foremost evidence was "evidence" in the opening notes of this topic, to be followed by studies talking about the flaws associated with forensic "predictions/guesses". You have produced no evidence that the folks whom you claim used these "racial" terms, have proven or even have the capacity to prove the existence biological "races" in humans. The AAA stance on "races" in humans, is not without scientific merit; just remember that.
quote:No, you haven't answered any of my questions. Sorry.
I co-sign.
Posted by Tee85 (Member # 10823) on :
I would say race does and doesn't exist.
Phenotypically it exist. GNETICALLY it doesn't. It some ways, culturally it does.
It does and doesn;t exist.
For example: VJ sing(sp) is darker in complexion that I yet he may Gnetically be far removed from African lineages.
It's really difficault so people just disiss it as "not existing".
Some whites use race for their advantage ala "one drop rule"= more slaves in American slavery which equals more MONEY
Yet, when dealing with Egypt, a sort of "prized" civilization the slightest bit of 'admixure" or "non-negorid" phenotypes then automatically the people become non-black, even WHITE sometimes!!!!! It's crazy.
If someone that looked like the bust of King Tut was in America, he would be group with Blacks during the slavery period. Yet in Egyptology, to some, he is not black!?!?!?!?! It's crazy.
If I wanna know what it's like to be white, I guess all I have to do is live in Ancient Egypt according to some people.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Tee85: I would say race does and doesn't exist.
Phenotypically it exist. GNETICALLY it doesn't. It some ways, culturally it does
Okay lay out the "phenotypic" discrete "races" of people who are "related" as a "race" without being "genetically" related. How do biologically/genetically distant folks become a "race", while those who share closer genetic ties aren't part of the same "race". Does this make any sense to you?
Moreover, what are the distinctive parameters for each single "race"?...and show how those "parameters" don't coincide or overlap with those of another distinct human "race".
Posted by Tee85 (Member # 10823) on :
Nope it didn't make sense.
Are you saying, lay out the people who look similar, and are considered black, yet are genetically disimular or distanlty related.
Is that what you're saying?
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Tee85: Nope it didn't make sense.
Are you saying, lay out the people who look similar, and are considered black, yet are genetically disimular or distanlty related.
Is that what you're saying?
If it didn't make sense, it is because what you said didn't either.
You claim that phenotype is "race", but genes aren't taken into consideration in this. How can genes not be, if phenotype is the outward manifestation of genetic coding?
Moreover, you are telling us that genetically closer folks, who may not necessarily look similar, are not part of the same race, but that two genetically distant groups who may show similarities as a happenstance, belong to a "race"? What is up with that?
Moreover, what distinctive parameters makes a "single" race discrete from those of another human "race"? Demonstrate to us how these parameters don't overlap between "races" according to your parameters for "race". You haven't answered that question yet either.
Posted by Tee85 (Member # 10823) on :
Some people can look the same yet not be genetically the same.
Everyone that it black is not realated to an African American genetically but they both may still have dark skin which is considered "Black".
So phnoetypically it exist, yet genetically there may be some dissimilarties.
So phenotypically we may look the sme but be different genetically thus race exist phenotypically yet genetically it doesn't.
I guess it depends on what you base it on.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Tee85: Some people can look the same yet not be genetically the same.
Everyone that it black is not realated to an African American genetically but they both may still have dark skin which is considered "Black".
So phnoetypically it exist, yet genetically there may be some dissimilarties.
So phenotypically we may look the sme but be different genetically thus race exist phenotypically yet genetically it doesn't.
I guess it depends on what you base it on.
How about stop sounding like a broken record, and actually answer the questions forwarded to you?
Posted by Tee85 (Member # 10823) on :
I was meaning the ways in which people classify races and how it exist to them.
I don't see how you don't get what I'm saying.
quote:Moreover, what distinctive parameters makes a "single" race discrete from those of another human "race"? Demonstrate to us how these parameters don't overlap between "races" according to your parameters for "race". You haven't answered that question yet either.
There are no real paramenters. The parameters are different for different peopele. That's what I was trying to say. Maybe I should've have worded it differently. My paramenters are, if you look black, you are "Black". Is that scentific??? No. My parameter relates to phenotype. Some might say someone who looks "black" doesn't have ALL of the phenotypic traits of what "pure" Blacks. ect.
Basically race exist on many different levels to different people from Egyptologist, to regular people.
Nevamind I have a hard time articualating my points. Just carry on.
I'll let the learned people fisnish. Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
On the misclassification of Nubian Crania by Dr. Armelagos and Van Gervan 2003, their conclusions in their own words, it speaks for itself, and cuts thru Winters ad nauseum fallacies:
We suggest that skeletal specimens or samples cannot be accurately clas-sified by geography or by racial affinity because of
(1) the wide variation in crania of the known series that cross-cuts geographic populations (polymorphism),
(2) theclinal pattern of human variation, and
(3) cultural and environmental factors.
Finally, the assumption that cranial form is an immutable “racial” character is very likely to be false
What you call spamming is focusing on the evidence. Just because you present one study does not falsify my claim that race exist.
I have presented no fallacies in my discussion of race. As pointed out above, I have provided numerous studies indicating that forensic scientist continue to use racial terms in their genetic research.
In addition, you admitted yourself that the father of genetic anthropology Sforza, classified the Dravidians and Afro-Asiatic speakers as caucasian. All of these studies confirm that race continues to be a major concept in biological research.
What you call "blobs of incoherent cut and paste 'eyesore', are studies showing how scientist use racial terms in their biological research studies. If the scientist use racial terms to define populations they are admitting that race does exist.
I have refuted the contention that scientist do not recognize distinct subdivisions of humanity.
1)I presented evidence that Forensic scientists continue to use "race" as a way to classify humans
2) I have presented evidence that even geneticist use race when discussing the haplotype and haplogroup of individuals and populations.
3) I have presented evidence that Fordisc 2.0 is a computer program that has a poor data base, is only one among many data bases used by physical anthropology to determine race.
4) The Armelagos and Van Gervan conclusions has not falsified the idea that race exist. This is one article discussing the fact that some of the analysis of Nubian crania has been misclassified.
This article does not deny the fact that Forensic scientists use genetic and craniometric data to identify race of individuals. This article discussed the errors of physical anthropologist. This article is concerned with physical anthropologists, it has nothing to do with my discussion of the use of racial terms in biological research.
The errors in identifying Nubians is mainly the result of the fact that certain Nubian groups have been traditionally identified as Europeans, when they are in reality one variety, in the African variety of mankind. All Blacks do not look alike.
I have pointed this out in numerous articles published above which show specific examples of the use of racial terms in the biological interpretation of individuals and poulations.
The forensic studies and comments by Sforza and other geneticists indicate that race does exist.
These facts indicate that Templeton is wrong scientist still recognize a distinct subdivision of humanity. Race does exist.
You are living in a dream world if you believe just because someone says race does not exist, racial thinking will disappear. Race will remain a part of biological science because people note a difference among individuals and population groups based on their ego.
You can try to fool the readers of this forum by posting the views of only one group of scientists--that race does not exist. But I have proven the lie of this idea by presenting articles where the forensic scientists use racial terms to identify individuals and population.
You can not wish away race, it is a key element in the biological study of man.
.
Posted by rasol (Member # 4592) on :
quote:Just because you present one study does not falsify my claim that race exist.
Your "claims" are completely vapid, and so there isn't even anything *there* to falsify.
And actually I've presented 4 studies by over a dozen anthropologists.
But 4 or 4000, it doesn't much matter as you talk and talk but never have any answers for Templeton, Supercar, Topdog, myself or anyone else.
Posted by rasol (Member # 4592) on :
quote:Tee writes: There are no real paramenters. The parameters are different for different peopele. That's what I was trying to say.
Hence the concept of race as social baggage, not a science. This much is correct.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote: Your "claims" are completely vapid, and so there isn't even anything *there* to falsify.
And actually I've presented 4 studies by over a dozen anthropologists.
But 4 or 4000, it doesn't much matter as you talk and talk but never have any answers for Templeton, Supercar, Topdog, myself or anyone else.
This is false I have answered all questions. Plus my post have made it clear that race exist in biological research no matter what you say.
.
Posted by rasol (Member # 4592) on :
quote:This is false I have answered all questions.
Not according to any of the people who asked you the questions in the 1st place.
But then, you are monologing, not dialoging, so why do you care what we think?
quote:Plus my post have made it clear.
....that you will argue on ad nauseum while not answering anyone's questions, yes I agree. Posted by Clyde Winters (Member # 10129) on :
This is false I have answered all questions. --------------------------------------------------------------------------------
Not according to any of the people who asked you the questions in the 1st place.
But then, you are are monologing, not dialoging, so why do you care what we think?
......when you continue to promote a false prosition that is not supported by the literature. A literature that makes it clear that race is still a major part of biological research.
.
Posted by basicbows (Member # 10371) on :
Research article . Reconstructing recent human phylogenies with forensic STR loci: A statistical approach Suraksha Agrawal1 and Faisal Khan1, 2 1Department of Medical Genetics, Sanjay Gandhi Post Graduate Institute of Medical Sciences, Raebareli Road, Lucknow (UP) 226014 India 2Department of Biotechnology, Bundelkhand University, Jhansi (UP), India
Forensic Short Tandem Repeat (STR) loci are effective for the purpose of individual identification, and other forensic applications. Most of these markers have high allelic variability and mutation rate because of which they have limited use in the phylogenetic reconstruction. In the present study, we have carried out a meta-analysis to explore the possibility of using only five STR loci (TPOX, FES, vWA, F13A and Tho1) to carry out phylogenetic assessment based on the allele frequency profile of 20 world population and north Indian Hindus analyzed in the present study.
Results
Phylogenetic analysis based on two different approaches – genetic distance and maximum likelihood along with statistical bootstrapping procedure involving 1000 replicates was carried out. The ensuing tree topologies and PC plots were further compared with those obtained in earlier phylogenetic investigations. The compiled database of 21 populations got segregated and finely resolved into three basal clusters with very high bootstrap values corresponding to three geo-ethnic groups of African, Orientals, and Caucasians.
Conclusion
Based on this study we conclude that if appropriate and logistic statistical approaches are followed then even lesser number of forensic STR loci are powerful enough to reconstruct the recent human phylogenies despite of their relatively high mutation rates.
Posted by basicbows (Member # 10371) on :
Go to full text | Return to Issue Table of Contents
Genetic Structure, Self-Identified Race/Ethnicity, and Confounding in Case-Control Association Studies
Hua Tang,1 Tom Quertermous,2 Beatriz Rodriguez,4 Sharon L. R. Kardia,5 Xiaofeng Zhu,6 Andrew Brown,7 James S. Pankow,8 Michael A. Province,9 Steven C. Hunt,10 Eric Boerwinkle,11 Nicholas J. Schork,12 and Neil J. Risch3,13
1Division of Public Health Sciences, Fred Hutchinson Cancer Research Center, Seattle; 2Division of Cardiovascular Medicine and 3Department of Genetics, Stanford University School of Medicine, Stanford, CA; 4Department of Public Health Sciences and Epidemiology, University of Hawaii, Manoa; 5Department of Epidemiology, University of Michigan School of Public Health, Ann Arbor; 6Department of Preventive Medicine and Epidemiology, Loyola University Medical Center, Maywood, IL; 7Department of Medicine, University of Mississippi Medical Center, Jackson; 8Division of Epidemiology, University of Minnesota, Minneapolis; 9Division of Biostatistics, Washington University School of Medicine, St. Louis; 10Cardiovascular Genetics, Department of Internal Medicine, University of Utah, Salt Lake City; 11Institute for Molecular Medicine and Human Genetics Center, University of Texas-Houston Health Science Center, Houston; 12Polymorphism Research Laboratory, Department of Psychiatry, University of California, San Diego; and 13Division of Research, Kaiser Permanente, Oakland, CA
Received October 8, 2004; accepted for publication December 3, 2004; electronically published December 29, 2004.
We have analyzed genetic data for 326 microsatellite markers that were typed uniformly in a large multiethnic population-based sample of individuals as part of a study of the genetics of hypertension (Family Blood Pressure Program). Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic) and were recruited from 15 different geographic locales within the United States and Taiwan. Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories. Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity. On the other hand, we detected only modest genetic differentiation between different current geographic locales within each race/ethnicity group. Thus, ancient geographic ancestry, which is highly correlated with self-identified race/ethnicityas opposed to current residenceis the major determinant of genetic structure in the U.S. population. Implications of this genetic structure for case-control association studies are discussed.
Go to full text | Return to Issue Table of Contents
Posted by basicbows (Member # 10371) on :
Article
Human Genetics Publisher: Springer Berlin / Heidelberg ISSN: 0340-6717 (Paper) 1432-1203 (Online) DOI: 10.1007/s00439-005-0012-1 Issue: Volume 118, Numbers 3-4
Date: December 2005 Pages: 382 - 392 Original Investigation Examination of ancestry and ethnic affiliation using highly informative diallelic DNA markers: application to diverse and admixed populations and implications for clinical epidemiology and forensic medicine Nan Yang1, Hongzhe Li1, Lindsey A. Criswell2, Peter K. Gregersen3, Marta E. Alarcon-Riquelme4, Rick Kittles5, Russell Shigeta1, Gabriel Silva6, Pragna I. Patel7, John W. Belmont8 and Michael F. Seldin1
(1) Rowe Program in Human Genetics, Departments of Biological chemistry and Medicine, University of California, One Shields Avenue, Davis, CA 95616-8669, USA (2) Rosalind Russell Medical Research Center for Arthritis, University of California, San Francisco, CA, USA (3) University of Uppsala, Uppsala, Sweden (4) The Robert S. Boas Center for Genomics and Human Genetics, North Shore Lij for Medical Research, Manhasset, NY, USA (5) Comprehensive Cancer Center, Ohio State University, Colombus, OH, USA (6) Obras Sociales Del Hermano Pedro, Antigua, Guatemala (7) Institute for Genetic Medicine, Universtiy of Southern California, Los Angeles, CA, USA (8) Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX, USA
Received: 5 March 2005 Accepted: 1 June 2005 Published online: 29 September 2005
Abstract We and others have identified several hundred ancestry informative markers (AIMs) with large allele frequency differences between different major ancestral groups. For this study, a panel of 199 widely distributed AIMs was used to examine a diverse set of 796 DNA samples including self-identified European Americans, West Africans, East Asians, Amerindians, African Americans, Mexicans, Mexican Americans, Puerto Ricans and South Asians. Analysis using a Bayesian clustering algorithm (STRUCTURE) showed grouping of individuals with similar ethnic identity without any identifier other than the AIMs genotyping and showed admixture proportions that clearly distinguished different individuals of mixed ancestry. Additional analyses showed that, for the majority of samples, the predicted ethnic identity corresponded with the self-identified ethnicity at high probability (P > 0.99). Overall, the study demonstrates that AIMs can provide a useful adjunct to forensic medicine, pharmacogenomics and disease studies in which major ancestry or ethnic affiliation might be linked to specific outcomes. Electronic Supplementary Material Supplementary material is available for this article at http://dx.doi.org/10.1007/s00439-005-0012-1
Michael F. Seldin Email: mfseldin@ucdavis.edu Phone: +530-754-6017 Fax: +530-754-6015
Posted by Clyde Winters (Member # 10129) on :
^Basicbows provides another example of the use of race in biiological research. Great post.
Race is a key element in biological research. Biological researchers constantly use the term caucasian in reference to individuals and human populations. Lets look at the definitions of this term: Caucasian "A caucasoid person". Caucasoid: " of the major divisions of the human species whose members characteristically have skin color ranging from very light to brown...."
These definitions make it clear that use of this term implies discussion of race or the caucasoid human species. This term is frequently used in reference to the caucasoid species in numerous biological studies. Use of this term makes it clear race exist. Below are examples from different biological research papers.
Indigenous Puerto Rico: DNA evidence upsets established history By Rick Kearns
Reprinted with permission, from Indian Country Today Posted: October 06, 2003 - 1:34pm EST by: Rick Kearns / Correspondent / Indian Country Today
History is written by the conquerors. The Native peoples of North America know this all too well, as they are still trying to bring the truth to light. Now, their long-lost Caribbean cousins are beginning the same process.
It’s an uphill battle.
Most Puerto Ricans know, or think they know, their ethnic and racial history: a blending of Taino (Indian), Spanish and African. Students of the islands’ past have read the same account for over 300 years; that the Native people, and their societies, were killed off by the Spanish invaders by the 1600s. It was always noted though, how many of the original colonists married Taino women or had Taino concubines, producing the original mestizaje (mixture) that, when blended with African, would produce Puerto Ricans.
Those first unions, according to the conventional wisdom, explain why some Puerto Ricans have "a little bit" of Native heritage. Mainly we are Spanish, we are told, with a little African blood and far-away Taino ancestry.
But the order of that sequence will have to change.
Dr. Juan Martinez Cruzado, a geneticist from the University of Puerto Rico Mayaguez who designed an island-wide DNA survey, has just released the final numbers and analysis of the project, and these results tell a different story.
According to the study funded by the U.S. National Science Foundation, 61 percent of all Puerto Ricans have Amerindian mitochondrial DNA, 27 percent have African and 12 percent Caucasian. (Nuclear DNA, or the genetic material present in a gene’s nucleus, is inherited in equal parts from one’s father and mother. Mitochondrial DNA is inherited only from one’s mother and does not change or blend with other materials over time.) http://www.biomedcentral.com/1471-2350/6/30
High frequency of the IVS2-2A>G DNA sequence variation in SLC26A5, encoding the cochlear motor protein prestin, precludes its involvement in hereditary hearing loss Hsiao-Yuan Tang1 , Anping Xia1 , John S Oghalai1 , Fred A Pereira1, 2 and Raye L Alford1
Background Cochlear outer hair cells change their length in response to variations in membrane potential. This capability, called electromotility, is believed to enable the sensitivity and frequency selectivity of the mammalian cochlea. Prestin is a transmembrane protein required for electromotility. Homozygous prestin knockout mice are profoundly hearing impaired. In humans, a single nucleotide change in SLC26A5, encoding prestin, has been reported in association with hearing loss. This DNA sequence variation, IVS2-2A>G, occurs in the exon 3 splice acceptor site and is expected to abolish splicing of exon 3. Methods To further explore the relationship between hearing loss and the IVS2-2A>G transition, and assess allele frequency, genomic DNA from hearing impaired and control subjects was analyzed by DNA sequencing. SLC26A5 genomic DNA sequences from human, chimp, rat, mouse, zebrafish and fruit fly were aligned and compared for evolutionary conservation of the exon 3 splice acceptor site. Alternative splice acceptor sites within intron 2 of human SLC26A5 were sought using a splice site prediction program from the Berkeley Drosophila Genome Project. Results The IVS2-2A>G variant was found in a heterozygous state in 4 of 74 hearing impaired subjects of Hispanic, Caucasian or uncertain ethnicity and 4 of 150 Hispanic or Caucasian controls (p = 0.45). The IVS2-2A>G variant was not found in 106 subjects of Asian or African American descent. No homozygous subjects were identified (n = 330). Sequence alignment of SLC26A5 orthologs demonstrated that the A nucleotide at position IVS2-2 is invariant among several eukaryotic species. Sequence analysis also revealed five potential alternative splice acceptor sites in intron 2 of human SLC26A5.
http://www.ecacc.org.uk/default.asp?Reload=detail2.asp?itemid=92970 ECACC Releases all 5 Human Random Control (HRC) DNA (480 HRC individual DNAs) in Convenient 96 Well Panels Building on the success of the ECACC Human Random Control (HRC) DNA in genetics research (see selected publications list) ECACC has responded to customer demand and re-formatted all 480 HRC DNA samples into a more convenient 96 well format. This new development has been made possible by ECACC’s investment, during 2005, in automated liquid handling technologies. This development along with more efficient work practises has had the added benefit of substantially reducing the price of obtaining the whole 480 HRC DNA resources, bringing it within the scope of individual consumable budgets. The HRC DNA consists of authenticated, high quality purified human genomic DNA. Each of the available 480 samples is from a single individual, providing a control population of randomly selected, non-related UK Caucasian blood donors. The HRC DNA is available as a series of five panels each containing samples from 96 separate individuals in a convenient 8 x 12 well format. This is a readily available, cost effective and renewable source of standardised control DNA samples for use in a range of applications that include: • Population studies • Mutation analysis • SNP genotyping • Validation of technology • Assay development and validation • Association analysis • Comparative genomic hybridisation • Genomic DNA library construction http://www.funpecrp.com.br/gmr/year2002/vol2-1/gmr0004_full_text.htm Frequency of the hypervariable DNA loci D18S849, D3S1744, D12S1090 and D1S80 in a mixed ancestry population of Chilean blood donors M. Acuña1, H. Jorquera2, L. Cifuentes1 and L. Armanet3 1ICBM Genetic Program and 2Medical Technology School, Facultad de Medicina, Universidad de Chile, Casilla 70061, Santiago 7, Chile 3Forensic Medical Service, Santiago, Chile Corresponding author: M. Acuña E-mail: macuna@machi.med.uchile.cl Genet. Mol. Res. 1 (2): 139-146 (2002) Received April 11, 2002 Published June 27, 2002
Comparisons of D1S80 allele distribution between populations (Figure 2) using the ² test showed no significant differences between the Chilean population sample when compared with Southwestern US Hispanics and US Hispanics pooled (Zago et al., 1996; Huckenbeck et al., 1997). The research presented in this paper shows that the hypervariable DNA loci investigated are distinguishable from other Caucasian (Spanish), Black and Oriental populations, but that the D3S1744 locus is indistinguishable from the Caucasian population. All the loci studied are indistinguishable from USA Hispanic populations (Figures 2 and 3). This study provides the first database for DNA markers in low and middle socioeconomic strata in a Chilean population. The results presented indicate that the analysis of these loci may have useful applications in population genetics as well as in identity tests.
http://www.biomedcentral.com/1471-2415/5/5 A polymorphism at codon 31 of gene p21 is not associated with primary open angle glaucoma in Caucasians Thomas Ressiniotis1, 2 , Philip G Griffiths1 , Sharon M Keers2 , Patrick F Chinnery2 and Michael Birch1 1Department of Ophthalmology, Royal Victoria Infirmary, Newcastle upon Tyne, UK 2Department of Neurology, The Medical School, The University of Newcastle upon Tyne, UK
The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2415/5/5 Received 18 January 2005 Accepted 4 April 2005 Published 4 April 2005
Background Primary open angle glaucoma (POAG) is considered to be a neurodegenerative optic neuropathy, in which cell death occurs by apoptosis. p21, is an important protective component of the apoptotic pathway, regulating cellular arrest in the presence of DNA damage. An unstable or altered p21 protein could modify the cellular response to genomic injury and abolish the effect of p21. A previous study on a Chinese cohort suggested that the p21 codon 31 polymorphism may alter the state of apoptosis in glaucomatous optic neuropathy, failing to protect the ganglion cells.The aim of this study was to test the hypothesis that a p21 codon 31 polymorphism is associated with POAG on a Caucasian cohort. Methods 140 POAG patients and a control group of 73 healthy individuals were included in the study. All the subjects were of Caucasian origin. Genomic DNA was amplified by polymerase chain reaction, followed by enzymatic restriction fragment length polymorphism technique (PCR-RFLP). Patients and controls were genotyped for a single nucleotide polymorphism (C/A transversion) in the third base of codon 31 of p21, which leads to a serine (Ser)/arginine (Arg) substitution.
Haplotyping using the GOOD assay was then performed on nine unrelated DNA samples, three Caucasian, three African and three Asian. The results of the genotyping experiment (Table 2) were confirmed by sequencing. The success of allele-specific PCR is confirmed by querying the SNP used for allele-specific PCR (internal control). Position –654 is typed with an extension primer in the opposite direction to the amplification primer, position 79 is controlled by querying position –47, which is in complete linkage disequilibrium with position 79 in all known haplotypes. Figure 2 shows examples of spectra obtained by MALDI analysis with the different allele-specific PCRs. They allow unambiguous assignment of the different haplotypes with the queried positions. In all three populations haplotypes of groups C and E were found, the frequent haplotypes in these populations. Group A was not found in African samples, as it is uncommon in this ethnic group.
These studies make it clear: Race does exist.
Posted by basicbows (Member # 10371) on :
Clines, Clusters, and the Effect of Study Design on the Inference of Human Population Structure Noah A. Rosenberg1*, Saurabh Mahajan2, Sohini Ramachandran3, Chengfeng Zhao4, Jonathan K. Pritchard5, Marcus W. Feldman3
1 Department of Human Genetics, Bioinformatics Program, and the Life Sciences Institute, University of Michigan, Ann Arbor, Michigan, United States of America, 2 Department of Computer Science, University of Southern California, Los Angeles, California, United States of America, 3 Department of Biological Sciences, Stanford University, Stanford, California, United States of America, 4 Mammalian Genotyping Service, Marshfield Clinic Research Foundation, Marshfield, Wisconsin, United States of America, 5 Department of Human Genetics, University of Chicago, Chicago, Illinois, United States of America
Previously, we observed that without using prior information about individual sampling locations, a clustering algorithm applied to multilocus genotypes from worldwide human populations produced genetic clusters largely coincident with major geographic regions. It has been argued, however, that the degree of clustering is diminished by use of samples with greater uniformity in geographic distribution, and that the clusters we identified were a consequence of uneven sampling along genetic clines. Expanding our earlier dataset from 377 to 993 markers, we systematically examine the influence of several study design variables—sample size, number of loci, number of clusters, assumptions about correlations in allele frequencies across populations, and the geographic dispersion of the sample—on the “clusteredness” of individuals. With all other variables held constant, geographic dispersion is seen to have comparatively little effect on the degree of clustering. Examination of the relationship between genetic and geographic distance supports a view in which the clusters arise not as an artifact of the sampling scheme, but from small discontinuous jumps in genetic distance for most population pairs on opposite sides of geographic barriers, in comparison with genetic distance for pairs on the same side. Thus, analysis of the 993-locus dataset corroborates our earlier results: if enough markers are used with a sufficiently large worldwide sample, individuals can be partitioned into genetic clusters that match major geographic subdivisions of the globe, with some individuals from intermediate geographic locations having mixed membership in the clusters that correspond to neighboring regions.
Full text at
Clines, Clusters, and the Effect of Study Design on the Inference of Human Population Structure Noah A. Rosenberg1*, Saurabh Mahajan2, Sohini Ramachandran3, Chengfeng Zhao4, Jonathan K. Pritchard5, Marcus W. Feldman3
1 Department of Human Genetics, Bioinformatics Program, and the Life Sciences Institute, University of Michigan, Ann Arbor, Michigan, United States of America, 2 Department of Computer Science, University of Southern California, Los Angeles, California, United States of America, 3 Department of Biological Sciences, Stanford University, Stanford, California, United States of America, 4 Mammalian Genotyping Service, Marshfield Clinic Research Foundation, Marshfield, Wisconsin, United States of America, 5 Department of Human Genetics, University of Chicago, Chicago, Illinois, United States of America
Previously, we observed that without using prior information about individual sampling locations, a clustering algorithm applied to multilocus genotypes from worldwide human populations produced genetic clusters largely coincident with major geographic regions. It has been argued, however, that the degree of clustering is diminished by use of samples with greater uniformity in geographic distribution, and that the clusters we identified were a consequence of uneven sampling along genetic clines. Expanding our earlier dataset from 377 to 993 markers, we systematically examine the influence of several study design variables—sample size, number of loci, number of clusters, assumptions about correlations in allele frequencies across populations, and the geographic dispersion of the sample—on the “clusteredness” of individuals. With all other variables held constant, geographic dispersion is seen to have comparatively little effect on the degree of clustering. Examination of the relationship between genetic and geographic distance supports a view in which the clusters arise not as an artifact of the sampling scheme, but from small discontinuous jumps in genetic distance for most population pairs on opposite sides of geographic barriers, in comparison with genetic distance for pairs on the same side. Thus, analysis of the 993-locus dataset corroborates our earlier results: if enough markers are used with a sufficiently large worldwide sample, individuals can be partitioned into genetic clusters that match major geographic subdivisions of the globe, with some individuals from intermediate geographic locations having mixed membership in the clusters that correspond to neighboring regions.
Clines, Clusters, and the Effect of Study Design on the Inference of Human Population Structure Noah A. Rosenberg1*, Saurabh Mahajan2, Sohini Ramachandran3, Chengfeng Zhao4, Jonathan K. Pritchard5, Marcus W. Feldman3
1 Department of Human Genetics, Bioinformatics Program, and the Life Sciences Institute, University of Michigan, Ann Arbor, Michigan, United States of America, 2 Department of Computer Science, University of Southern California, Los Angeles, California, United States of America, 3 Department of Biological Sciences, Stanford University, Stanford, California, United States of America, 4 Mammalian Genotyping Service, Marshfield Clinic Research Foundation, Marshfield, Wisconsin, United States of America, 5 Department of Human Genetics, University of Chicago, Chicago, Illinois, United States of America
Previously, we observed that without using prior information about individual sampling locations, a clustering algorithm applied to multilocus genotypes from worldwide human populations produced genetic clusters largely coincident with major geographic regions. It has been argued, however, that the degree of clustering is diminished by use of samples with greater uniformity in geographic distribution, and that the clusters we identified were a consequence of uneven sampling along genetic clines. Expanding our earlier dataset from 377 to 993 markers, we systematically examine the influence of several study design variables—sample size, number of loci, number of clusters, assumptions about correlations in allele frequencies across populations, and the geographic dispersion of the sample—on the “clusteredness” of individuals. With all other variables held constant, geographic dispersion is seen to have comparatively little effect on the degree of clustering. Examination of the relationship between genetic and geographic distance supports a view in which the clusters arise not as an artifact of the sampling scheme, but from small discontinuous jumps in genetic distance for most population pairs on opposite sides of geographic barriers, in comparison with genetic distance for pairs on the same side. Thus, analysis of the 993-locus dataset corroborates our earlier results: if enough markers are used with a sufficiently large worldwide sample, individuals can be partitioned into genetic clusters that match major geographic subdivisions of the globe, with some individuals from intermediate geographic locations having mixed membership in the clusters that correspond to neighboring regions.
Posted by rasol (Member # 4592) on :
quote:Originally posted by Clyde Winters: [QB] Rasol
This is false I have answered all questions. --------------------------------------------------------------------------------
Not according to any of the people who asked you the questions in the 1st place.
But then, you are are monologing, not dialoging, so why do you care what we think?
......when you continue to promote a false prosition that is not supported by the literature.
..when you continue to drone on with a mindless monologue that makes it clear that you have no answers to Templeton, Keita, Wells, Armegelos, the American Anthropological Association, or anyone else....
Posted by rasol (Member # 4592) on :
quote:Originally posted by basicbows: Clines, Clusters, and the Effect of Study Design on the Inference of Human Population Structure Noah A. Rosenberg1*, Saurabh Mahajan2, Sohini Ramachandran3, Chengfeng Zhao4, Jonathan K. Pritchard5, Marcus W. Feldman3
However, the absence of sharp discontinuities in the neutral genetic diversity among human populations implies that, in practice, a large number of neutral markers will be required to identify the genetic ancestry of one individual - Proportioning Whole-Genome Single-Nucleotide–Polymorphism Diversity for the Identification of Geographic Population Structure and Genetic Ancestry
Posted by Clyde Winters (Member # 10129) on :
The articles posted on this thread indicating that race plays a key role in biological research make it clear that what you preceive as...
Rasol
quote: a mindless monologue that makes it clear that you have no answers to Templeton, Keita, Wells, Armegelos, the American Anthropological Association, or anyone else....
accurately shows that while some scientists take the position that race is no longer part of the biological sciences, other researchers actively employ race in their biological research.
You can not claim that race no longer exist when the scientists conducting biological research continue to employ race in their discourse. A discourse that makes it clear race does exist.
.
Posted by rasol (Member # 4592) on :
quote:other researchers actively employ race in their biological research
^ moot monologue as it fails to address templeton, keita, wells, brace, or armegelos and fails to answer our questions.
Posted by Clyde Winters (Member # 10129) on :
Tee85
quote:
Okay lay out the "phenotypic" discrete "races" of people who are "related" as a "race" without being "genetically" related. How do biologically/genetically distant folks become a "race", while those who share closer genetic ties aren't part of the same "race". Does this make any sense to you?
Yes it does. Let me explain. On average Europeans are phenotypically closely related to Africans, while Africans are not phenotypically related to Australian Blacks, but Australians are phentypically related to Mongoloid Asiatic people.
This suggest to me two different founder groups. We know that before the last Ice Age, the inhabitants of Europe were Grimaldi Negroes. It would appear to me that these Negroes were the ancestors of the European caucasoid group. Sometime during this Ice Age, the Grimaldi Negroes were depigmented and "evolved" into Proto-Caucasoids somewhere in Europe.
In Asia, the Proto-Mongoloid people some how evolved from Australian people who formerly lived on the Asian mainland. This would explain why Mongoloid people are phenotypically related to the Australians, but not Africans and Europeans.
This is just a theory. It is something I have been thinking about for over 20 years after I found out that under the skin we have two phenotypic groups African-European and Australian-Mongoloid/Asian.
Since it is a theory I am not going to debate it further. Its just something I believe can answer the questions posed by Tee85 that confound us all.
.
Posted by Clyde Winters (Member # 10129) on :
Advocates of the race does not exist idea are living in a dream world. They see the world as an ideal place where all the races live in harmony and no longer allow differences in ethnic and racial backgrounds to divide and separate us, as a result when they see biological researchers continue to use race in their research they ignore the research and believe that this research is......
Rasol
quote: moot monologue as it fails to address templeton, keita, wells, brace, or armegelos and fails to answer our questions...
since they have a close mind and walk in a dream state ignoring the reality in front of them. Instead of accepting the fact that some biologist choose to make race a key element in their research because it reflects reality, researchers who have embraced the declarations by the AAA (which I am a member), think that just by saying something is so, it is.
Then when the founder of genetic biology uses race in his research, Rasol viciously attacks him and reminds us that some people call him a hypocrite:
Rasol
quote:
My opinion of Sforza's non-scientific and inappropriate use of the term caucasian, properly a folk ethnicity define as follows -
Of or relating to the Caucasus region or its peoples, languages, or cultures. Of or relating to a group of three language families spoken in the region of the Caucasus mountains, including Chechen, Abkhaz, and the Kartvelian languages.
...is that it reflects his ideological need to keep Europeans united via racial euphemisms.
Sforza does not define caucasian, culturally, or linguistically and certainly not genetically.
He also does not use the term Negro.
Sforza has been criticised by other scholars in this respect for being somewhat biased conceptually, and even [it is implied], hypocritical.
However - whether Sforza is or is not a hypocrite, or biased, or personally does or does not believe in race or devil worship- is irrelevant to what he claims is proven via genetics.
Having admitted that Sforza uses race in his analysis of population movements you make the following confused statement
quote: Sforza does not claim that populations can be sub-divided into races. He specifically concurs with Templeton in this regard.
This is weird to say the least. How can you concur that Sforza, is using race to highlight the caucasian race to which he belongs and then say he agrees with Templeton, who says race does not exist.
To make this statement after admitting Sforza uses race in his work, shows to everyone in the forum the lengths you will go to to win a debate--make a lie the truth.
Wake up and smell the coffee, race continues to exist in biological research and society as confirmed by the numerous studies posted herein.
.
Posted by basicbows (Member # 10371) on :
However, the absence of sharp discontinuities in the neutral genetic diversity among human populations implies that, in practice, a large number of neutral markers will be required to identify the genetic ancestry of one individual - Proportioning Whole-Genome Single-Nucleotide–Polymorphism Diversity for the Identification of Geographic Population Structure and Genetic Ancestry
Rasol: Could you please give the citation for this study? Thanks.
Posted by basicbows (Member # 10371) on :
What they're saying,I think,is that you need a sufficient number of markers to detect population structure. It's not necessary to label "clusters" as races.
Posted by Supercar (Member # 6477) on :
Humans are at least 99.9% overall genetically identical, while the remaining .1% include whatever little variations humans sport. Only about 3% [if even that is not an overestimate] of human genom is selected for, the remaining appear to be largely neutral DNA.
No one has provided any distinctive parameters for human "races", and neither has Clyde.
Human variation is clinal, and hence, you simply cannot have demarcations. Moreover, there are variations within Ethnic groups and populations.
At least four different studies have been presented, discussing the flaws associated with forensic "predictions" based on social [hasn't been demonstrated biologically] typological thinking, thus vindicating Templeton's point. These have never been addressed, instead studies simply using "ethnic" terms, are passed off as vindication of discrete human "races". Even if we were to assume that some geneticists use "racial" terms, the question remains: have they proven existence of discrete human "races"? The answer is NO, otherwise we would have documentation on this already, and by whom, this was proven!
Posted by alTakruri (Member # 10195) on :
Race is an existing and powerfulsocial construct whose parameters vary from society to society. Only a few extreme phenotypical varieties would be viewed by all societies as members of a particular race.
For humans, race is not a viable scientifically demonstrated reality; i.e. sub-species.
All people belong to the fertile interbreeding species Homo sapiens sapiens. There are no sub-species as laid out by Linnaeus * Homo sapiens ferus (savage) * Homo sapiens americanus * Homo sapiens europeus * Homo sapiens asiaticus * Homo sapiens asser (negro) * Homo sapiens monstrous
Western race science began in the 17th century. Francois Bernier proposed four races * inhabitants of Europe and Western Asia * Negroes of Africa * Eastern Asiatics * Laplanders
Bradley three * Whites (bearded and beardless) * Negroes (straight-haired and wooly-haired) * Intermediate
Linnaeus' six were given above (I suppose racists belong to his 6th race).
Blumenbach lists five * Caucasian * Mongolian * Ethiopian * American * Malayan
Pickering eleven * Mongolian * Malay-Polynesian * Australian * Papuan * Negrito * Hindu * Negro * Nubian * Hottentot * Abyssinian * White
Constant Dumeril has six * Caucasian * Hyperborean * Mongolian * American * Malayan * Ethiopian
Huxley yielded 5 by 14 * Negroid ___ Bushman ___ Negro ___ Papuan * Australoid ___ Australian ___ Dravidian ___ Ethiopian * Mongoloid ___ Mongolian ___ Polynesian ___ Amerindian ___ Eskimo ___ Malayan * Xantocroid (Northern Europeans) * Melanochroid ___ Southern Europe ___ SW Asia, India, etc.
Entering into more contemporary times coming in the 20th century we have
Deniker with six * Wooly hair, Broad nose * Curly or Wavy hair * Wavy brown or black hair, dark eyes * Fair, wavy or straight hair, light eyes, reddish white skin * Straight or wavy hair, dark, black eyes * Straight hair
Dixon computed 27 possible combinations of three points of head breadth, head length, and nose width compromising down to eight primary types * Caspian * Mediterranean * Proto-Negroid * Proto-Australoid * Alpine * Ural * Palae-Alpine * Mongoloid
Haddon had three * Wooly haired * Smooth haired * Lank haired
Hooton gives the three that most only know about * White * Black * Yellow
Eickstedt has three * Europiform * Negriform * Mongoliform
Lester-Millot, four * Pygmy * Black * Yellow * White
Vallois, 4 by 26 * Australoid (2) * Black (7) * Yellow (8) * White (9)
Coon-Garn-Birdsell, 30 * Murrayian * Ainu * Alpine * NW European * NE European * Lapp * Forest Negro * Melanesian * Negrito * Bushman * Bantu * Sudanese * Carpentarian * Dravidian * Hamite * Hindu * Mediterranean * Nordic * North American Negro * South African Negro * Classic Mongoloid * North Chinese * SE Asiatic * Tibeto-Indonesian Mongoloid * Turkic * Marginal Amerindian * Central Amerindian * Ladino * Polynesian * Neo-Hawaiian
Now for everybody still here who can straighten up from their convulsive laughter at the ludicrous foregoing presentation, it's plain that anything but science is involved when it comes to race.
It's nothing but a mess of guesswork with no consensus of what race is or who belongs to which or even the number of racial categories or the criterion for establihing any.
But judging by the Coon listing if anthropologists and geneticists had continued they would inevitably found that each and every individual on the planet is a race unto themself.
Thus today we have population genetics not race science.
That social contruct and outmoded athropology terms appear in scientific reports, even when used by geneticists to label a given population, in no way can be construed that there are scientifically defined biological human sub-species. No, there are none.
Socially however, everywhere around the globe, one's supposed race and others' reactions to it will be a significant factor in their day to day life. Posted by rasol (Member # 4592) on :
quote:Race is an existing and powerful social construct whose parameters vary from society to society.
Only a few extreme phenotypical varieties would be viewed by all societies as members of a particular race.
For humans, race is not a viable scientifically demonstrated reality; i.e. sub-species.
^ intelligent post, cognizant and consistent with the scientific data.
Posted by Clyde Winters (Member # 10129) on :
Takruri presents a good case for the existence of race across nationalities. Science is defined as "systematized knowledge derived from observation, study, etc.". This definition makes it clear that the observations made by scientists concerning a phenomena such as race, may vary but the fact that this knowledge has been systematized makes it science. For example, look at how racial terms are used in the following scientific article:
quote:
Forensic value of the multicopy Y-STR marker DYS464
John M. Butler * , Richard Schoske 1 Biotechnology Division, National Institute of Standards and Technology, Gaithersburg, MD, USA Abstract. The tetranucleotide Y-chromosome short tandem repeat (Y-STR) marker, DYS464, first reported by Redd et al. [Forensic Sci. Int. 130 (2002) 97] appears to be the most polymorphic Y-STR marker discovered to date. A single primer pair can generate up to four distinct peaks over an allele range of 9–20 repeats. Allele calls can be made based on peaks that are present (conservative approach; C-type) or a combination of alleles and peak height ratios (expanded typing method; E- type). We have observed 113 C-types and 179 E-types in 679 males from three US populations. D 2003 Elsevier B.V. All rights reserved. Keywords: Y-STR; Y-chromosome; DYS464; Multicopy loci; DNA typing 1. Introduction DYS464 occurs at least four times in the highly palindromic region near the center of the long arm of the Y-chromosome [1–3]. In forensic casework applications where the amount of typable DNA material may be limited, the use of highly polymorphic markers is advantageous in order to limit the number of markers needed to distinguish unrelated individuals. Page 2 The primers VIC-CTTTGGGCTATGCCTCAGTTT and GCCATACCTGGGTAACAGA- GAGAC produce green-labeled amplicons in the size range of 242–286 bp for DYS464 alleles 9–20, while the primers 6FAM-AGTTTACGAGCTTTGGGCTATG and GTGGCAAGATCTCATTTCTTCAA generate blue dye-labeled polymerase chain reac- tion (PCR) products that are 327–367 bp in size. PCR conditions are as previously described for the Y-STR 20plex [5]. An allelic ladder was created for DYS464 (Fig. 1), which contains all of the major alleles as well as single-base variants observed in our population study [3]. 3. Results and discussion We observed 179 expanded types with DYS464 in 679 male samples from three different US population sets: 265 African–Americans, 262 Caucasians, and 152 His- panics.
Race is a key element in biological research. Biological researchers constantly use the term caucasian in reference to individuals and human populations. Lets look at the definitions of this term: Caucasian "A caucasoid person". Caucasoid: " of the major divisions of the human species whose members characteristically have skin color ranging from very light to brown...."
These definitions make it clear that use of this term implies discussion of race or the caucasoid human species. This term is frequently used in reference to the caucasoid species in numerous biological studies. Use of this term makes it clear race exist. Below are examples from different biological research papers.
Indigenous Puerto Rico: DNA evidence upsets established history By Rick Kearns
Reprinted with permission, from Indian Country Today Posted: October 06, 2003 - 1:34pm EST by: Rick Kearns / Correspondent / Indian Country Today
History is written by the conquerors. The Native peoples of North America know this all too well, as they are still trying to bring the truth to light. Now, their long-lost Caribbean cousins are beginning the same process.
It’s an uphill battle.
Most Puerto Ricans know, or think they know, their ethnic and racial history: a blending of Taino (Indian), Spanish and African. Students of the islands’ past have read the same account for over 300 years; that the Native people, and their societies, were killed off by the Spanish invaders by the 1600s. It was always noted though, how many of the original colonists married Taino women or had Taino concubines, producing the original mestizaje (mixture) that, when blended with African, would produce Puerto Ricans.
Those first unions, according to the conventional wisdom, explain why some Puerto Ricans have "a little bit" of Native heritage. Mainly we are Spanish, we are told, with a little African blood and far-away Taino ancestry.
But the order of that sequence will have to change.
Dr. Juan Martinez Cruzado, a geneticist from the University of Puerto Rico Mayaguez who designed an island-wide DNA survey, has just released the final numbers and analysis of the project, and these results tell a different story.
According to the study funded by the U.S. National Science Foundation, 61 percent of all Puerto Ricans have Amerindian mitochondrial DNA, 27 percent have African and 12 percent Caucasian. (Nuclear DNA, or the genetic material present in a gene’s nucleus, is inherited in equal parts from one’s father and mother. Mitochondrial DNA is inherited only from one’s mother and does not change or blend with other materials over time.) http://www.biomedcentral.com/1471-2350/6/30
High frequency of the IVS2-2A>G DNA sequence variation in SLC26A5, encoding the cochlear motor protein prestin, precludes its involvement in hereditary hearing loss Hsiao-Yuan Tang1 , Anping Xia1 , John S Oghalai1 , Fred A Pereira1, 2 and Raye L Alford1
Background Cochlear outer hair cells change their length in response to variations in membrane potential. This capability, called electromotility, is believed to enable the sensitivity and frequency selectivity of the mammalian cochlea. Prestin is a transmembrane protein required for electromotility. Homozygous prestin knockout mice are profoundly hearing impaired. In humans, a single nucleotide change in SLC26A5, encoding prestin, has been reported in association with hearing loss. This DNA sequence variation, IVS2-2A>G, occurs in the exon 3 splice acceptor site and is expected to abolish splicing of exon 3. Methods To further explore the relationship between hearing loss and the IVS2-2A>G transition, and assess allele frequency, genomic DNA from hearing impaired and control subjects was analyzed by DNA sequencing. SLC26A5 genomic DNA sequences from human, chimp, rat, mouse, zebrafish and fruit fly were aligned and compared for evolutionary conservation of the exon 3 splice acceptor site. Alternative splice acceptor sites within intron 2 of human SLC26A5 were sought using a splice site prediction program from the Berkeley Drosophila Genome Project. Results The IVS2-2A>G variant was found in a heterozygous state in 4 of 74 hearing impaired subjects of Hispanic, Caucasian or uncertain ethnicity and 4 of 150 Hispanic or Caucasian controls (p = 0.45). The IVS2-2A>G variant was not found in 106 subjects of Asian or African American descent. No homozygous subjects were identified (n = 330). Sequence alignment of SLC26A5 orthologs demonstrated that the A nucleotide at position IVS2-2 is invariant among several eukaryotic species. Sequence analysis also revealed five potential alternative splice acceptor sites in intron 2 of human SLC26A5.
http://www.ecacc.org.uk/default.asp?Reload=detail2.asp?itemid=92970 ECACC Releases all 5 Human Random Control (HRC) DNA (480 HRC individual DNAs) in Convenient 96 Well Panels Building on the success of the ECACC Human Random Control (HRC) DNA in genetics research (see selected publications list) ECACC has responded to customer demand and re-formatted all 480 HRC DNA samples into a more convenient 96 well format. This new development has been made possible by ECACC’s investment, during 2005, in automated liquid handling technologies. This development along with more efficient work practises has had the added benefit of substantially reducing the price of obtaining the whole 480 HRC DNA resources, bringing it within the scope of individual consumable budgets. The HRC DNA consists of authenticated, high quality purified human genomic DNA. Each of the available 480 samples is from a single individual, providing a control population of randomly selected, non-related UK Caucasian blood donors. The HRC DNA is available as a series of five panels each containing samples from 96 separate individuals in a convenient 8 x 12 well format. This is a readily available, cost effective and renewable source of standardised control DNA samples for use in a range of applications that include: • Population studies • Mutation analysis • SNP genotyping • Validation of technology • Assay development and validation • Association analysis • Comparative genomic hybridisation • Genomic DNA library construction http://www.funpecrp.com.br/gmr/year2002/vol2-1/gmr0004_full_text.htm Frequency of the hypervariable DNA loci D18S849, D3S1744, D12S1090 and D1S80 in a mixed ancestry population of Chilean blood donors M. Acuña1, H. Jorquera2, L. Cifuentes1 and L. Armanet3 1ICBM Genetic Program and 2Medical Technology School, Facultad de Medicina, Universidad de Chile, Casilla 70061, Santiago 7, Chile 3Forensic Medical Service, Santiago, Chile Corresponding author: M. Acuña E-mail: macuna@machi.med.uchile.cl Genet. Mol. Res. 1 (2): 139-146 (2002) Received April 11, 2002 Published June 27, 2002
Comparisons of D1S80 allele distribution between populations (Figure 2) using the ² test showed no significant differences between the Chilean population sample when compared with Southwestern US Hispanics and US Hispanics pooled (Zago et al., 1996; Huckenbeck et al., 1997). The research presented in this paper shows that the hypervariable DNA loci investigated are distinguishable from other Caucasian (Spanish), Black and Oriental populations, but that the D3S1744 locus is indistinguishable from the Caucasian population. All the loci studied are indistinguishable from USA Hispanic populations (Figures 2 and 3). This study provides the first database for DNA markers in low and middle socioeconomic strata in a Chilean population. The results presented indicate that the analysis of these loci may have useful applications in population genetics as well as in identity tests.
http://www.biomedcentral.com/1471-2415/5/5 A polymorphism at codon 31 of gene p21 is not associated with primary open angle glaucoma in Caucasians Thomas Ressiniotis1, 2 , Philip G Griffiths1 , Sharon M Keers2 , Patrick F Chinnery2 and Michael Birch1 1Department of Ophthalmology, Royal Victoria Infirmary, Newcastle upon Tyne, UK 2Department of Neurology, The Medical School, The University of Newcastle upon Tyne, UK
The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2415/5/5 Received 18 January 2005 Accepted 4 April 2005 Published 4 April 2005
Background Primary open angle glaucoma (POAG) is considered to be a neurodegenerative optic neuropathy, in which cell death occurs by apoptosis. p21, is an important protective component of the apoptotic pathway, regulating cellular arrest in the presence of DNA damage. An unstable or altered p21 protein could modify the cellular response to genomic injury and abolish the effect of p21. A previous study on a Chinese cohort suggested that the p21 codon 31 polymorphism may alter the state of apoptosis in glaucomatous optic neuropathy, failing to protect the ganglion cells.The aim of this study was to test the hypothesis that a p21 codon 31 polymorphism is associated with POAG on a Caucasian cohort. Methods 140 POAG patients and a control group of 73 healthy individuals were included in the study. All the subjects were of Caucasian origin. Genomic DNA was amplified by polymerase chain reaction, followed by enzymatic restriction fragment length polymorphism technique (PCR-RFLP). Patients and controls were genotyped for a single nucleotide polymorphism (C/A transversion) in the third base of codon 31 of p21, which leads to a serine (Ser)/arginine (Arg) substitution.
As a result, when we read in the scientific literature use of terms such as Negro, Black, Caucasian, and etc., scientist are using these terms to denote a sub-species of mankind. Terms that result from the observations made by scientists regarding differences within and among human beings.
Race does exist.
Takruri
quote: Race is an existing and powerful social construct whose parameters vary from society to society. Only a few extreme phenotypical varieties would be viewed by all societies as members of a particular race.
For humans, race is not a viable scientifically demonstrated reality; i.e. sub-species.
All people belong to the fertile interbreeding species Homo sapiens sapiens. There are no sub-species as laid out by Linnaeus * Homo sapiens ferus (savage) * Homo sapiens americanus * Homo sapiens europeus * Homo sapiens asiaticus * Homo sapiens asser (negro) * Homo sapiens monstrous
Western race science began in the 17th century. Francois Bernier proposed four races * inhabitants of Europe and Western Asia * Negroes of Africa * Eastern Asiatics * Laplanders
Bradley three * Whites (bearded and beardless) * Negroes (straight-haired and wooly-haired) * Intermediate
Linnaeus' six were given above (I suppose racists belong to his 6th race).
Blumenbach lists five * Caucasian * Mongolian * Ethiopian * American * Malayan
Pickering eleven * Mongolian * Malay-Polynesian * Australian * Papuan * Negrito * Hindu * Negro * Nubian * Hottentot * Abyssinian * White
Constant Dumeril has six * Caucasian * Hyperborean * Mongolian * American * Malayan * Ethiopian
Huxley yielded 5 by 14 * Negroid ___ Bushman ___ Negro ___ Papuan * Australoid ___ Australian ___ Dravidian ___ Ethiopian * Mongoloid ___ Mongolian ___ Polynesian ___ Amerindian ___ Eskimo ___ Malayan * Xantocroid (Northern Europeans) * Melanochroid ___ Southern Europe ___ SW Asia, India, etc.
Entering into more contemporary times coming in the 20th century we have
Deniker with six * Wooly hair, Broad nose * Curly or Wavy hair * Wavy brown or black hair, dark eyes * Fair, wavy or straight hair, light eyes, reddish white skin * Straight or wavy hair, dark, black eyes * Straight hair
Dixon computed 27 possible combinations of three points of head breadth, head length, and nose width compromising down to eight primary types * Caspian * Mediterranean * Proto-Negroid * Proto-Australoid * Alpine * Ural * Palae-Alpine * Mongoloid
Haddon had three * Wooly haired * Smooth haired * Lank haired
Hooton gives the three that most only know about * White * Black * Yellow
Eickstedt has three * Europiform * Negriform * Mongoliform
Lester-Millot, four * Pygmy * Black * Yellow * White
Vallois, 4 by 26 * Australoid (2) * Black (7) * Yellow (8) * White (9)
Coon-Garn-Birdsell, 30 * Murrayian * Ainu * Alpine * NW European * NE European * Lapp * Forest Negro * Melanesian * Negrito * Bushman * Bantu * Sudanese * Carpentarian * Dravidian * Hamite * Hindu * Mediterranean * Nordic * North American Negro * South African Negro * Classic Mongoloid * North Chinese * SE Asiatic * Tibeto-Indonesian Mongoloid * Turkic * Marginal Amerindian * Central Amerindian * Ladino * Polynesian * Neo-Hawaiian
Now for everybody still here who can straighten up from their convulsive laughter at the ludicrous foregoing presentation, it's plain that anything but science is involved when it comes to race.
It's nothing but a mess of guesswork with no consensus of what race is or who belongs to which or even the number of racial categories or the criterion for establihing any.
But judging by the Coon listing if anthropologists and geneticists had continued they would inevitably found that each and every individual on the planet is a race unto themself.
Thus today we have population genetics not race science.
That social contruct and outmoded athropology terms appear in scientific reports, even when used by geneticists to label a given population, in no way can be construed that there are scientifically defined biological human sub-species. No, there are none.
Socially however, everywhere around the globe, one's supposed race and others' reactions to it will be a significant factor in their day to day life.
Posted by rasol (Member # 4592) on :
quote:AlTakruri presents a good case for the existence of race across nationalities
Winters presents a good case of a completely defeated polemic semantics, and straw grasping.
Winters entire 'presentation' is reducible to two fallacies.
A non sequitur fallacy - he tries to convince himself that the mere precense of words like Hispanic or Caucasian in literature-- somehow valdiates 'race' scientifically.
And ad nauseum [repetition] fallacy - Winters ends every post by repeating his far fetched claims, although none of his posts actually contain *any specific proof* of his claims.
Winters is invited to respond with more repetition of more argumenative fallacies.
What else can he do?
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
Winters presents a good case of a completely defeated polemacist, grasping at straws.
Winters entire 'presentation' is reducible to two fallacies.
A non sequitur fallacy - words like Hispanic or Caucasian can be found in literature-- therefore 'race exists.'
And ad nauseum [repettition] fallacy - Winters ends every post by repeating his far fetched claims, although none of his posts actually contain specific proof of his claims. Thru mindless repettition Winters also avoids answering questions, or specifically addressing the data and conclusions which refute him.
I have presented the evidence which shows that scientists use race in their discourse.If my position was far fetched I would not be able to publish articles where race is used in biological discourse.
Rasol, like a child has turned to making negative personal comments towards my person because of his frustration that scientist continue to use race in their writing to denote sub species of mankind. Instead of attacking the message, why don't you write to scientific journals and tell them, they were wrong in publishing articles with racial terms within them.
Stop being childish, fallacy can not exist when valid and reliable citations are used to support a proposition. I have presented valid souces from the scientific literature.
As long as racial terms are used in scientific literature race exist.
.
Posted by rasol (Member # 4592) on :
quote:Rasol has turned to making negative personal comments towards my person
^ begging for sympathy is just another form of fallacy ->ad hominem whining.
my assessment is purely with regard to your argumentative fallacies - and *not* personal.
quote:As long as racial terms are used in scientific literature race exist.
^non sequitur, circular argument, and repetition fallacy. proves nothing.
Posted by Clyde Winters (Member # 10129) on :
As long as racial terms are used in scientific literature race exist. --------------------------------------------------------------------------------
^non sequitur, circular argument, and repetition fallacy. proves nothing...
... but the reality that race exist in the scientific literature. To prove that "race' is not part of the biological sciences you must prove that racial terms do not appear in biological research literature denoting a sub species.
You can not do this as pointed out above. Therefore race exist.
Rasol has turned to making negative personal comments towards my person --------------------------------------------------------------------------------
^ begging for sympathy is just another form of fallacy ->ad hominem whining.
This is not whining its a reflection of your character. Whenever you are confronted with evidence disputing your pet theories you attack the person personally as evident in your discourse with Topdog.
You have conditioned yourself to believe that because you hide behind an authority, the simple act of mentioning this authority will protect you from having to fully argue a matter through proposition development/building and accompanying citation of the evidence.
As a result, when someone demonstrates that there is another side to a matter and supports their contention with evidence you take offense and then out of frustration revert to personnal attack fallacy. We are all men and women in this forum you don't scare anybody with this behavior, it only indicates to others you can not handle the truth.
The evidence is clear. Race is part og the biological discuss. Use of this term in the literature indicate scientist use it to refer to sub species.
As a result, race exist.
.
Posted by rasol (Member # 4592) on :
quote:To prove that "race' is not part of the biological sciences you must prove that racial terms do not appear in biological research literature
That is and elementary argumentative fallacy and it is surprising that you keep repeating it.
Let's entertain your fallacious premise.
Pub-Med is a searchable online directory of biological research papers [several million in fact].
Your argument requires that any term found in scientific articles in Pub-Med are so demonstrated to be scientifically valid.
Searching "ghost" - we find 2380 references.
Searching "god" - we find 1890 references.
Searching "devil" - we find 380 references.
According to Winters:
Therefore ghosts exist. Therefore God exists. Therefore the devil exists.
In fact, mere precense of a term is not a scientific proof of a hypothesis.
To even imply otherwise is to relate profound lack of knowledge of the requirements of proof and/or falsification of theorem in science.
Dr. Winters, please learn how to make logical arguments, and so avoid elementary logical fallacies.
Thanks.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
Mere precense of a term is not proof of a hypothesis.
Dr. Winters, please learn the requirements necessary in making a logical argument.
Thanks.
You don't know what you are talking about. Let's look at the definition of hypothesis from Wikipedia, the free encyclopedia :
quote: A hypothesis is a suggested explanation of a phenomenon or reasoned proposal suggesting a possible correlation between multiple phenomena. The term is derived from the ancient Greek, hypotithenai meaning "to put under" or "to suppose." A scientific hypothesis must be testable and generally will be based upon previous observations or extensions of scientific theories.
Now I will show you how hypothesis building is done. First I make a hypothesis: If race exist, it will be part of the biological research literature.
To test this hypothesis I have conducted a content analysis of the biological research literature to determine if race is a part of the research literature. To confirm my hypothesis I have to only illustrate that use of race is evident in the biological research literature.
Above I have demonstrated that race is part of the biological discourse. The use of race in the biological literature confirms my hypothesis.
This evidence of race in the biological literature falsifies the idea race doesn't exist, because if it didn't exist, there would be an absence of race in the literature, but the inverse is reality.
Don't hate the player, learn to play the game. Using Authorities are fine but when you make an inappropriate hypothesis you have to live with the results.
I always advise my students to make a null hypothesis when ever possible. A affirmative or positivist hypothesis may sound great but if the evidence is lacking you have wasted valuable time conduting research.
If you wrote an article claiming that race did not exist, it would be summarily rejected because it can not be supported by the research literature which sees the frequent use of race in numerous research publications.
Get over your bias, race does exist.
.
Posted by rasol (Member # 4592) on :
quote:This is not whining its a reflection of your character.
Even if so, that would be and attack on my 'character', so by definition, you are now engaged in a personal attack, are you not?
Personal attacks are the petty handmaiden of all debate failure.
Having said that, please continue your attack.....
quote: Whenever you are confronted with evidence
We have presented evidence. You have presented none.
quote: disputing your pet theories
Actually the theory in question in this thread is provided by geneticist Doctor Alan Templeton, and further supported by the American Anthropological Association, and many other notable sources.
Against their pet theories you can only muster elementary logical fallacies that would be torn apart in any public school debating society.
quote:You have conditioned yourself to believe that because you hide behind an authority
But aren't you attacking me, right now, out of anger and frustration at your inability to refute the 'authorities' in question?
How can I hide behind them - when it is their thesis which is at issue in the 1st place?
Why not then, refute the authorities instead of attacking me personally?
Is it because you can't?
quote: the simple act of mentioning this authority will protect you
The purpose of referencing sources is to have you address their arguments.
Your purposes in deflecting the issue to "me" is to focus your anger in being unable to address the referenced sources into and attack on my 'character'.
quote:As a result, when someone demonstrates that there is another side to a matter and supports their contention with evidence
lo. you've presented no evidence. You can't because you don't have any. That's why you're attacking me personally, of course.
quote: you take offense and then out of frustration revert to personnal attack fallacy.
Actually you seem to be the offended party, and you are engaging in the personal attack.
So, attack me some more, if you think it will help..... Posted by rasol (Member # 4592) on :
quote: rasol:Mere precense of a term is not proof of a hypothesis.
Dr. Winters, please learn the requirements necessary in making a logical argument.
Thanks.
quote:Winters: You don't know what you are talking about. Let's look at the definition of hypothesis from Wikipedia, the free encyclopedia
Actually the issue at hand is proof of hypothesis and logical argument.
Of the former you have none, and of the later, you don't seem to understand how to go about it.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote: quote: -------------------------------------------------------------------------------- You have conditioned yourself to believe that because you hide behind an authority --------------------------------------------------------------------------------
But aren't you attacking me, right now, out of anger and frustration at your inability to refute the 'authorities' in question?
No I am not attacking you. I am just commenting on the fact that your negative interactions with people on this forum, who do not agree with you betray your character. This is an observation, not an attack.
I have refuted the hypothesis that "race doesn't exist". This was refuted by demonstrating that race is part of the discourse associated with biological research, therefore race does exist on researchers would not discuss it.
.
Posted by rasol (Member # 4592) on :
quote:Winters writes: No I am not attacking you.
False statement, when you make comments referring to....
quote:Winters writes: your character.
...that is by definition a personal attack.
Such personal attacks are also logical fallacies - ad hominem fallacy.
It seems this is something else about the requirements of logical discourse that you have not yet learned.
When you reduce yourself in this way Dr. Winters, you further negate your own 'arguments.'
You can only impress us with data, and cool level headed arguments, not by railing against someone elses character, and hoping to find some sort of sympathy response.
And no, you aren't going to distract us one bit from your complete failure to answer our questions, address the evidence, or substantiate your views.
Any more methods of distraction?
Posted by alTakruri (Member # 10195) on :
I made a non-ambigous readily understandable statement.
quote: "For humans, race is not a viable scientifically demonstrated reality; i.e. sub-species."
That anyone could misconstrue it and use it to back up a diametrically opposing argument is intentional distorton.
I further stated
quote: "All people belong to the fertile interbreeding species Homo sapiens sapiens."
As for instances of terms associated with common race terminology, I said
quote: "That social construct and outmoded athropology terms appear in scientific reports, even when used by geneticists to label a given population, in no way can be construed that there are scientifically defined biological human sub-species. No, there are none."
No one of reasonable intelligence with average reading comprehension skills could derive the below conclusion from anything I posted, and if they do I disavow it and oppose any such premise.
quote: "Takruri presents a good case for the existence of race across nationalities."
The author of that statement, who claims membership in the America Anthropological Association, also alleges the existence of human sub-species.
quote: "... we read in the scientific literature use of terms such as Negro, Black, Caucasian, and etc., scientist are using these terms to denote a sub-species of mankind."
This, of course, is something no professional anthropologist member of the AAA purport because it contradicts the science fields of zoology, biology, and physical anthropology.
Science classifies all life with a precise Latin name. This binary nomenclature includes genus and species. After the species level comes any sub-species. There were once two allopatric subspecies of humankind * Homo sapiens neanderthalis * Homo sapiens sapiens.
The former is extinct. Only the latter survives. All living humans belong to the same genus, species, and sub-species. Each and every one of us is a Homo sapiens sapiens. Genus _______ Homo species _______ sapiens sub-species ____ sapiens
No scientist, biologist, or physical anthropologist denies this. Thus any term employed by race proponents do not denote sub-species. To use the quoted examples, there are no such human subspecies as * Homo sapiens negro * Homo sapiens black * Homo sapiens caucasian * Homo sapiens and etc.
Race does not equal sub-species and this is why.
quote: "... some scholars interested in racial distinctions have found new grist for the racial differences mill, as geneticists have made important advances in sequencing the human genome (Crow, 2002).
Less prominent in this debate has been a discussion of what is meant by racial groups ... [are] such groups in fact, discrete, measurable, and scientifically meaningful.
The consensus among most scholars in fields such as evolutionary biology, anthropology, and other disciplines is that racial distinctions fail on all three counts -— that is,
* they are not genetically discrete, * are not reliably measured, * and are not scientifically meaningful."
You don't have any awareness at all of how hypothesis are formed and falsification takes place. Below is an example of the process:
quote: From Wikipedia, the free encyclopedia
In science and the philosophy of science, falsifiability, contingency, and defeasibility are properties of empirical statements that require them to admit of logical counterexamples. This stands in contradistinction to formal and mathematical statements that may be tautologies, that is, universally true by dint of definitions, axioms, and proofs. No empirical hypothesis, proposition, or theory can be considered scientific if it does not admit the possibility of a contrary case.
Falsifiable does not mean false. For a proposition to be falsifiable, it must be possible, at least in principle, to make an observation that would show the proposition to fall short of being a tautology, even if that observation is not actually made. The logical precondition of being able to observe something of a given description is that something of that description exists.
For example, the proposition 'all buffalo are brown' would be falsified by observing a white buffalo, which would in turn depend on there being a white buffalo somewhere in existence. A falsifiable proposition or theory must define in some way what is, or will be, forbidden by that proposition or theory. For example, in this case the existence of a white buffalo is forbidden by the proposition in question. The possibility in principle of observing a white buffalo as a counterexample to the general proposition is sufficient to qualify the proposition as falsifiable.
The proposition of this thread is: "Race doesn't exist" in science. The counter prosition is that "race does exist" in science.
This proposition was easily falsified because the biology literature is full of reference to race. Production of biological research articles where race is discussed was sufficient to qualify the proposition as falsified. This makes the following statement hogwash:
Rasol
quote:
It seems this is something else about the requirements of logical discourse that you have not yet learned.
When you reduce yourself in this way Dr. Winters, you further negate your own 'arguments.'
You can only impress us with data, and cool level headed arguments, not by railing against someone elses character, and hoping to find some sort of sympathy response.
And no, you aren't going to distract us one bit from your complete failure to answer our questions, address the evidence, or substantiate your views.
Any more methods of distraction?
It is hogwas because I have presented numerous citations (/data) of articles where race is discussed that falsify your argument race does not exist but you continue to claim otherwise.
Your continued efforts to make it appear that race does not exist in the biological literature and real world is the main distraction. I will not let you get away with making this claim when the literature says otherwise....
Race Exist...
.
.
Posted by Clyde Winters (Member # 10129) on :
Caucasian race From Wikipedia, the free encyclopedia Jump to: navigation, search
The term Caucasian race or Caucasian is used to refer to people whose ancestry can be traced back to Europe, North Africa, West Asia, South Asia and parts of Central Asia. It was once considered a useful taxonomical categorization of human racial groups based on a presumed common geographic and/or linguistic origin.
quote:
The consensus among most scholars in fields such as evolutionary biology, anthropology, and other disciplines is that racial distinctions fail on all three counts -— that is,
* they are not genetically discrete, * are not reliably measured, * and are not scientifically meaningful."
This quote makes it clear that most do no believe in racial distinctions. It does not say all. If there are any scientists that believe race exist. Race exist.
Takruri
quote:
Debunked "race science" was abandoned for population genetics because there're no human sub-species.
Race is not sub-species. Race is a social construct. "Race science" can only be a social science.
Below are science articles where race is discussed. This makes it clear that race is part of the science discourse.
[QUOTE]
Forensic value of the multicopy Y-STR marker DYS464
John M. Butler * , Richard Schoske 1 Biotechnology Division, National Institute of Standards and Technology, Gaithersburg, MD, USA Abstract. The tetranucleotide Y-chromosome short tandem repeat (Y-STR) marker, DYS464, first reported by Redd et al. [Forensic Sci. Int. 130 (2002) 97] appears to be the most polymorphic Y-STR marker discovered to date. A single primer pair can generate up to four distinct peaks over an allele range of 9–20 repeats. Allele calls can be made based on peaks that are present (conservative approach; C-type) or a combination of alleles and peak height ratios (expanded typing method; E- type). We have observed 113 C-types and 179 E-types in 679 males from three US populations. D 2003 Elsevier B.V. All rights reserved. Keywords: Y-STR; Y-chromosome; DYS464; Multicopy loci; DNA typing 1. Introduction DYS464 occurs at least four times in the highly palindromic region near the center of the long arm of the Y-chromosome [1–3]. In forensic casework applications where the amount of typable DNA material may be limited, the use of highly polymorphic markers is advantageous in order to limit the number of markers needed to distinguish unrelated individuals. Page 2 The primers VIC-CTTTGGGCTATGCCTCAGTTT and GCCATACCTGGGTAACAGA- GAGAC produce green-labeled amplicons in the size range of 242–286 bp for DYS464 alleles 9–20, while the primers 6FAM-AGTTTACGAGCTTTGGGCTATG and GTGGCAAGATCTCATTTCTTCAA generate blue dye-labeled polymerase chain reac- tion (PCR) products that are 327–367 bp in size. PCR conditions are as previously described for the Y-STR 20plex [5]. An allelic ladder was created for DYS464 (Fig. 1), which contains all of the major alleles as well as single-base variants observed in our population study [3]. 3. Results and discussion We observed 179 expanded types with DYS464 in 679 male samples from three different US population sets: 265 African–Americans, 262 Caucasians, and 152 His- panics.
Race is a key element in biological research. Biological researchers constantly use the term caucasian in reference to individuals and human populations. Lets look at the definitions of this term: Caucasian "A caucasoid person". Caucasoid: " of the major divisions of the human species whose members characteristically have skin color ranging from very light to brown...."
These definitions make it clear that use of this term implies discussion of race or the caucasoid human species. This term is frequently used in reference to the caucasoid species in numerous biological studies. Use of this term makes it clear race exist. Below are examples from different biological research papers.
Indigenous Puerto Rico: DNA evidence upsets established history By Rick Kearns
Reprinted with permission, from Indian Country Today Posted: October 06, 2003 - 1:34pm EST by: Rick Kearns / Correspondent / Indian Country Today
History is written by the conquerors. The Native peoples of North America know this all too well, as they are still trying to bring the truth to light. Now, their long-lost Caribbean cousins are beginning the same process.
It’s an uphill battle.
Most Puerto Ricans know, or think they know, their ethnic and racial history: a blending of Taino (Indian), Spanish and African. Students of the islands’ past have read the same account for over 300 years; that the Native people, and their societies, were killed off by the Spanish invaders by the 1600s. It was always noted though, how many of the original colonists married Taino women or had Taino concubines, producing the original mestizaje (mixture) that, when blended with African, would produce Puerto Ricans.
Those first unions, according to the conventional wisdom, explain why some Puerto Ricans have "a little bit" of Native heritage. Mainly we are Spanish, we are told, with a little African blood and far-away Taino ancestry.
But the order of that sequence will have to change.
Dr. Juan Martinez Cruzado, a geneticist from the University of Puerto Rico Mayaguez who designed an island-wide DNA survey, has just released the final numbers and analysis of the project, and these results tell a different story.
According to the study funded by the U.S. National Science Foundation, 61 percent of all Puerto Ricans have Amerindian mitochondrial DNA, 27 percent have African and 12 percent Caucasian. (Nuclear DNA, or the genetic material present in a gene’s nucleus, is inherited in equal parts from one’s father and mother. Mitochondrial DNA is inherited only from one’s mother and does not change or blend with other materials over time.) http://www.biomedcentral.com/1471-2350/6/30
High frequency of the IVS2-2A>G DNA sequence variation in SLC26A5, encoding the cochlear motor protein prestin, precludes its involvement in hereditary hearing loss Hsiao-Yuan Tang1 , Anping Xia1 , John S Oghalai1 , Fred A Pereira1, 2 and Raye L Alford1
Background Cochlear outer hair cells change their length in response to variations in membrane potential. This capability, called electromotility, is believed to enable the sensitivity and frequency selectivity of the mammalian cochlea. Prestin is a transmembrane protein required for electromotility. Homozygous prestin knockout mice are profoundly hearing impaired. In humans, a single nucleotide change in SLC26A5, encoding prestin, has been reported in association with hearing loss. This DNA sequence variation, IVS2-2A>G, occurs in the exon 3 splice acceptor site and is expected to abolish splicing of exon 3. Methods To further explore the relationship between hearing loss and the IVS2-2A>G transition, and assess allele frequency, genomic DNA from hearing impaired and control subjects was analyzed by DNA sequencing. SLC26A5 genomic DNA sequences from human, chimp, rat, mouse, zebrafish and fruit fly were aligned and compared for evolutionary conservation of the exon 3 splice acceptor site. Alternative splice acceptor sites within intron 2 of human SLC26A5 were sought using a splice site prediction program from the Berkeley Drosophila Genome Project. Results The IVS2-2A>G variant was found in a heterozygous state in 4 of 74 hearing impaired subjects of Hispanic, Caucasian or uncertain ethnicity and 4 of 150 Hispanic or Caucasian controls (p = 0.45). The IVS2-2A>G variant was not found in 106 subjects of Asian or African American descent. No homozygous subjects were identified (n = 330). Sequence alignment of SLC26A5 orthologs demonstrated that the A nucleotide at position IVS2-2 is invariant among several eukaryotic species. Sequence analysis also revealed five potential alternative splice acceptor sites in intron 2 of human SLC26A5.
http://www.ecacc.org.uk/default.asp?Reload=detail2.asp?itemid=92970 ECACC Releases all 5 Human Random Control (HRC) DNA (480 HRC individual DNAs) in Convenient 96 Well Panels Building on the success of the ECACC Human Random Control (HRC) DNA in genetics research (see selected publications list) ECACC has responded to customer demand and re-formatted all 480 HRC DNA samples into a more convenient 96 well format. This new development has been made possible by ECACC’s investment, during 2005, in automated liquid handling technologies. This development along with more efficient work practises has had the added benefit of substantially reducing the price of obtaining the whole 480 HRC DNA resources, bringing it within the scope of individual consumable budgets. The HRC DNA consists of authenticated, high quality purified human genomic DNA. Each of the available 480 samples is from a single individual, providing a control population of randomly selected, non-related UK Caucasian blood donors. The HRC DNA is available as a series of five panels each containing samples from 96 separate individuals in a convenient 8 x 12 well format. This is a readily available, cost effective and renewable source of standardised control DNA samples for use in a range of applications that include: • Population studies • Mutation analysis • SNP genotyping • Validation of technology • Assay development and validation • Association analysis • Comparative genomic hybridisation • Genomic DNA library construction http://www.funpecrp.com.br/gmr/year2002/vol2-1/gmr0004_full_text.htm Frequency of the hypervariable DNA loci D18S849, D3S1744, D12S1090 and D1S80 in a mixed ancestry population of Chilean blood donors M. Acuña1, H. Jorquera2, L. Cifuentes1 and L. Armanet3 1ICBM Genetic Program and 2Medical Technology School, Facultad de Medicina, Universidad de Chile, Casilla 70061, Santiago 7, Chile 3Forensic Medical Service, Santiago, Chile Corresponding author: M. Acuña E-mail: macuna@machi.med.uchile.cl Genet. Mol. Res. 1 (2): 139-146 (2002) Received April 11, 2002 Published June 27, 2002
Comparisons of D1S80 allele distribution between populations (Figure 2) using the ² test showed no significant differences between the Chilean population sample when compared with Southwestern US Hispanics and US Hispanics pooled (Zago et al., 1996; Huckenbeck et al., 1997). The research presented in this paper shows that the hypervariable DNA loci investigated are distinguishable from other Caucasian (Spanish), Black and Oriental populations, but that the D3S1744 locus is indistinguishable from the Caucasian population. All the loci studied are indistinguishable from USA Hispanic populations (Figures 2 and 3). This study provides the first database for DNA markers in low and middle socioeconomic strata in a Chilean population. The results presented indicate that the analysis of these loci may have useful applications in population genetics as well as in identity tests.
http://www.biomedcentral.com/1471-2415/5/5 A polymorphism at codon 31 of gene p21 is not associated with primary open angle glaucoma in Caucasians Thomas Ressiniotis1, 2 , Philip G Griffiths1 , Sharon M Keers2 , Patrick F Chinnery2 and Michael Birch1 1Department of Ophthalmology, Royal Victoria Infirmary, Newcastle upon Tyne, UK 2Department of Neurology, The Medical School, The University of Newcastle upon Tyne, UK
The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2415/5/5 Received 18 January 2005 Accepted 4 April 2005 Published 4 April 2005
Background Primary open angle glaucoma (POAG) is considered to be a neurodegenerative optic neuropathy, in which cell death occurs by apoptosis. p21, is an important protective component of the apoptotic pathway, regulating cellular arrest in the presence of DNA damage. An unstable or altered p21 protein could modify the cellular response to genomic injury and abolish the effect of p21. A previous study on a Chinese cohort suggested that the p21 codon 31 polymorphism may alter the state of apoptosis in glaucomatous optic neuropathy, failing to protect the ganglion cells.The aim of this study was to test the hypothesis that a p21 codon 31 polymorphism is associated with POAG on a Caucasian cohort. Methods 140 POAG patients and a control group of 73 healthy individuals were included in the study. All the subjects were of Caucasian origin. Genomic DNA was amplified by polymerase chain reaction, followed by enzymatic restriction fragment length polymorphism technique (PCR-RFLP). Patients and controls were genotyped for a single nucleotide polymorphism (C/A transversion) in the third base of codon 31 of p21, which leads to a serine (Ser)/arginine (Arg) substitution.
Race Exist Posted by alTakruri (Member # 10195) on :
Race is not a science defined sub-species.
Race exists as a social construct.
Population genetics is a science.
Butler and Schoske specifically denote their subjects as populations. Where do they specifically or explicitly use the term race?
quote: ... three different US population sets: * 265 African–Americans, * 262 Caucasians, and * 152 Hispanics.
If one choses to propose an African-American race, a Caucasian race, and a Hispanic race then one approaches Butler and Schoske with a priori race convictions in mind. Caucasian has been used to denote a race. To make African Americans a discrete racial entity or speakers of Spanish as a mother tongue a discrete racial entity is only to show the social construct nature of race as opposed to any supposed biology science nature of race.
Posted by rasol (Member # 4592) on :
A set of approximately 650 anonymous population samples from U.S. Caucasians, African Americans, and Hispanics, SELF DECLARED ETHNICITIES. Posted by Clyde Winters (Member # 10129) on :
Takruri
quote:
Population genetics is a science.
Right. Therefore, if geneticist use racial terms in their research, they are acknowledging race.
.
Posted by rasol (Member # 4592) on :
^ logical fallacy, circular argument, non sequitur.
Posted by rasol (Member # 4592) on :
Winters ref. to this article from the laymen encyclopedia:
quote:Jump to: navigation, search wikipedia The term Caucasian is used to refer to people whose ancestry can be traced back to Europe, North Africa, West Asia, South Asia and parts of Central Asia. It was once considered a useful taxonomical categorization of human racial groups
From the same article, what is it's current status?
quote: In places such as Europe, racial censuses are highly controversial and in some cases not used. Racial classifications have begun to take on the appearance of being arbitrary, based on the politics of the time.
In the United States, Caucasian is currently used primarily as a distinction loosely based on skin color alone for a group commonly referred to as Whites, as defined by the American government and Census Bureau.
In Europe, "Caucasian" refers exclusively to people who are from the Caucasus.
^
* caucsian as original reference to people from the caucasus = correct.
* race classifictions as arbitrary, political, inconsistant and controversial, and not used= correct.
Race catagories as scientifically valid?
Not in that article.
Keep googling, Dr. Winters.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote: Winters posts: Evaluation of Genetic Variation in Major U.S. Population Groups Using Human Identity Testing Markers
A set of approximately 650 anonymous population samples from U.S. Caucasians, African Americans, and Hispanics,
All discussed in a scientific research paper.
.
Posted by alTakruri (Member # 10195) on :
Rick Kearns explicitly uses the term "racial" but he is not a scientist. Relying on a journalist once again shows the social construct nature of race.
Cruzado is the scientist in Kearns article. Where does Cruzado specifically or explicitly use the term race in his study?
If one choses to propose a Puerto Rican race, an Amerindian race, an African race, or a Caucasian race, then one approaches Cruzado with a priori race convictions in mind. Excluding Boricuas, an island sub-nationality, all the others have been used to denote races. But as each is a geographic population doing so confirms race as a social construct not a biology science entity.
Population genetics is a science.
Race is not a science defined sub-species.
Race exists as a social construct.
Posted by alTakruri (Member # 10195) on :
Where does Tang specifically or explicitly use the term race? Tang et al specifically denote their subjects using the term ethnicity and descent.
quote: subjects of Hispanic, Caucasian or uncertain ethnicity . . . subjects of Asian or African American descent
Only a priori convictions about race can account for making ethnicity or descent synonymous terms for race.
We've examined Hispanic, Caucasian, and African-American in above posts. We'll add Asian to the list of geographic populations. Since geography is not biology and geography is a social science, Asians as a race shows race to be a social construct not a biological reality.
Race exists as a social construct.
Population genetics is a science.
Race is not a science defined sub-species.
Posted by Clyde Winters (Member # 10129) on :
Takruri
quote:
Cruzado is the scientist in Kearns article. Where does Cruzado specifically or explicitly use the term race in his study?
The Use of Mitochondrial DNA to Discover Pre-Columbian Migrations to the Caribbean: Results for Puerto Rico and Expectations for the Dominican Republic
Dr. Juan C. Martínez Cruzado
A slide show, for use with Internet Explorer, accompanies this paper PDF Version for printing 360 KB
In this study, we use Mitochrondrial DNA technology (mtDNA) to improve our understanding of the pre-Columbian migrations to the Antilles that gave rise to the Taínos. As a basis for our work, we need to review various studies, principally of the archaeological type, that have given us knowledge of the pre-Columbian migrations to the Greater Antilles. [1]
It is known that more than 8,000 years ago the Greater Antilles were inhabited by nomads who depended for their survival upon the foods that they could collect and the animals that they could hunt. That era is known as the Lithic Era, which is distinguished by the stone tools that these people made. [2]
Some 4,000 years later, we begin to note a great quantity of tools and adornments made of shells and some made of bone. That era is known as the Archaic Era, populated by nomads who appear to have subsisted principally on seafoods, but who also ate terrestrial products. It was not until some 2,200 years ago that a ceramic culture arrived in the Greater Antilles, consisting of agriculturalists who built permanent settlements near their areas of cultivation. [3]
Little is known about the migrations from which the nomads originated, better known as the pre-ceramic culture. Three routes have been identified by which there could have been migratory waves to the Greater Antilles: proceeding from the Florida Peninsula by means of Cuba, proceeding from the Yucatan Peninsula also by means of Cuba, and proceeding from the Orinoco Delta by means of the Lesser Antilles. Dental studies done by Dr. Edwin Crespo, as in other studies, suggest that there were at least two migratory waves to the Greater Antilles. For this reason, confirmation of the use of the routes does not necessarily indicate that the other routes were not also used. [4]
Distinct ceramic cultures existed in the Greater Antilles. Even before the time of Christ, on the island of Vieques, there already existed a Huecoid culture and Saladoid culture, clearly distinguishable by their ceramics, but also through other cultural aspects. For example, while the burials of the Saladoids can be found relatively easily, the remains of Huecoid bones have never been found. All that has been found is one milk tooth. For this reason, it is believed that the religions of both cultures could have contained very different elements. Furthermore the Huecoids were specialists in working with semi-precious stones, which they frequently sculpted in the form of animals. Among them the figure of a bird stands out that many have identified as the Andean condor, for which reason they attach a continental origin to this region. Deposits with ceramic elements very similar to those of the Huecoids have been found near the mouth of the Guapo River in Venezuela. From there they would have taken the maritime route eastward toward Puerto Rico, Vieques, and other islands in the Northeastern Caribbean. The Saladoids, on the other hand, migrated from the region of Saladero near the mouth of the Orinoco River by means of the Lesser Antilles until they arrived in the Greater Antilles. [5]
The Huecoid culture lasted some few hundred years, but the Saladoid culture, evolving with time, lasted until approximately the year A.D. 600. Certain evidence has been found in Puerto Rico that suggests great, natural events of a catastrophic nature that could have put an end to the Saladoid culture. What is certain is that a clearly distinct culture developed beginning from that date, the Ostionoid, which is divided into two stages known as pre-Taíno and Taíno. We do not know if the Ostionoid culture represents a marked cultural change of the Saladoid culture people due to the natural catastrophic events or some other type of event, or if it represents the arrival of a new migratory wave of Southamerican origin. [6]
In conclusion, the archaeological evidence can identify four pre-Columbian migrations to the Greater Antilles: two pre-ceramic and two ceramic. The actual number of pre-Columbian migrations very well might have been only four, but there could have been many more. [7]
We will see now what the mtDNA that we can extract from the contemporary inhabitants of the Major Antilles could offer us. The vast majority of our genetic material, perhaps better known as DNA, is found in the nucleus of the cell. The mtDNA, however, is not located in the nucleus of the cell but in an organelle known as the mitochondria. While nuclear DNA is inherited in equal parts from one’s father and mother, mtDNA is inherited only from one’s mother. It does not mix with that of the father and for that reason remains intact generation after generation, thus maintaining its original identity. That is to say, despite the intensive mestizaje (genetic “mixture”) that has characterized our region over the centuries, we Caribbeans have mtDNAs that have maintained their original identity and that can be identified as African, Indian, or Caucasian . Their identity depends upon the women in our genetic tree at the end of the strictly maternal ancestral line. If this great-great-great grandmother were indigenous, then the corresponding Caribbean would have an indigenous mtDNA. He or she would have inherited it intact from that great-great-great grandmother who lived through those terrible first years of the colonization by means of his or her great-great grandmothers, great grandmothers, and maternal grandmother. [8]
Posted by alTakruri (Member # 10195) on :
Likewise, where does Acuña specifically or explicitly employ the word race? Acuña et al refer to populations in speaking of sources for DNA samples.
quote: standardised control DNA samples for use in a range of applications that include: • Population studies
No word about racial studies or applications.
Posted by Clyde Winters (Member # 10129) on :
Takruri
quote:
-------------------------------------------------------------------------------- Where does Tang specifically or explicitly use the term race? Tang et al specifically denote their subjects using the term ethnicity and descent.
Tang H, Quertermous T, Rodriguez B, Kardia SL, Zhu X, Brown A, Pankow JS, Province MA, Hunt SC, Boerwinkle E, Schork NJ, Risch NJ.
Division of Public Health Sciences, Fred Hutchinson Cancer Research Center, Seattle, WA, USA.
We have analyzed genetic data for 326 microsatellite markers that were typed uniformly in a large multiethnic population-based sample of individuals as part of a study of the genetics of hypertension (Family Blood Pressure Program). Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic) and were recruited from 15 different geographic locales within the United States and Taiwan. Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories. Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity. On the other hand, we detected only modest genetic differentiation between different current geographic locales within each race/ethnicity group. Thus, ancient geographic ancestry, which is highly correlated with self-identified race/ethnicity--as opposed to current residence--is the major determinant of genetic structure in the U.S. population. Implications of this genetic structure for case-control association studies are discussed.
In this paper Tang was using genetics to explore ancestry. Since he is using genetics to explore racial ancestry the paper is concerned with biology, not geography.
Most importantly caucasian is a racial term it is not a geographical term. Caucasians live in many different geographic regions (Europe, Auatralia, Latin America and etc.) therefore the term can only be applied to race, not geography.
.
Posted by Clyde Winters (Member # 10129) on :
Takruri
quote: Likewise, where does Acuña specifically or explicitly employ the word race? Acuña et al refer to populations in speaking of sources for DNA samples.
Frequency of the hypervariable DNA loci D18S849, D3S1744, D12S1090 and D1S80 in a mixed ancestry population of Chilean blood donors M. Acuña1, H. Jorquera2, L. Cifuentes1 and L. Armanet3 1ICBM Genetic Program and 2Medical Technology School, Facultad de Medicina, Universidad de Chile, Casilla 70061, Santiago 7, Chile 3Forensic Medical Service, Santiago, Chile Corresponding author: M. Acuña E-mail: macuna@machi.med.uchile.cl Genet. Mol. Res. 1 (2): 139-146 (2002) Received April 11, 2002 Published June 27, 2002
Comparisons of D1S80 allele distribution between populations (Figure 2) using the ² test showed no significant differences between the Chilean population sample when compared with Southwestern US Hispanics and US Hispanics pooled (Zago et al., 1996; Huckenbeck et al., 1997). The research presented in this paper shows that the hypervariable DNA loci investigated are distinguishable from other Caucasian (Spanish), Black and Oriental populations, but that the D3S1744 locus is indistinguishable from the Caucasian population. All the loci studied are indistinguishable from USA Hispanic populations (Figures 2 and 3). This study provides the first database for DNA markers in low and middle socioeconomic strata in a Chilean population. The results presented indicate that the analysis of these loci may have useful applications in population genetics as well as in identity tests.
Figures 2 and 3 show the frequencies of the different alleles of the four hypervariable DNA loci in different populations. After combining allele classes to avoid low expected values, a c² homogeneity test for allele frequency distribution between the populations was performed. Most alleles were observed in all populations, with the most frequent alleles usually not differing for each population.
For the D18S849 locus the most frequent alleles for all five populations were 15, 16 and 17, with frequencies in the range of 13.6-41.7%. Our results for D18S849 in blood donors are very similar to those of US Hispanics (User's Manual; Lifecodes Corp.). The frequencies of different D3S1744 locus alleles in the five populations were similar, with allele 18 predominating. The c² test showed significant differences between the Chilean sample and US Black and US Oriental populations (User's Manual; Lifecodes Corp.).
The allele distributions for the D12S1090 locus were bimodal and very similar for the five populations, but a c² homogeneity test for allele frequency distribution between the Chilean population and US Black, US White and US Oriental populations showed significant differences for this locus (User's Manual; Lifecodes Corp.).
In the Webster's Dictionary the term black= Negro. In the same dictionary the definition for Negro="a member of the black race of mankind distinguished from members of other races.
In the same dictionary the definition for Oriental="a member of one of the peoples of the Orient; esp: a Chinese, Japanese or other Mongoloid.
In the Houghton Mifflin Dictionary Mongoloid is defined as: "of or concerning a major division of human species whose members chracteristically have yellowish-brown to white skin.....The definition of Negroid is: "of a major division of the human species whose members characteristically have brown to black skin....
Caucasian is a term that refers to the Caucasian race. There is no such thing as a caucasian, black or oriental population because the members of this racial group are situated throughout the world, instead of a specific geographical region.
The author of this article was clearly refering to race when he used these terms.
.
Posted by alTakruri (Member # 10195) on :
I could go on and on but none of the geneticists in the post of 01 June, 2006 07:12 AM addressed to me, use any variation of the word "race" themselves. They are explicit that their subjects are representatives of populations, or ethnicities, or descents.
None of them so much as allude to the anti-scientific concept that there are human sub-species.
The statement made that races are human sub-species is false ad invalid.
Race is not supported by biology sciences. Why? Because it is neither * discrete, * measurable, nor * scientifically meaningful.
Race is only supported by social science. Race is a social construct.
This is why the total failure to produce a quote from any of those geneticist where they themselves use any word derived from the word "race" to describe any of their subjects. It lacks scientific meaning and would immediately cause concerns of scientific methodology in the minds of their colleagues.
Posted by Supercar (Member # 6477) on :
Since Mr. Winters hasn't answered ANY of the questions or studies thus far posed here to him, can he at least answer these previous points I've made:
a)No one has provided any distinctive parameters for human "races", and neither has Clyde.
b)Even if we were to assume that some geneticists use "racial" terms, the question remains: have they proven existence of discrete human "races" UP-To-DATE?
Where have they made the case that it exists, and have PROVEN so, by providing the parameters that define their conclusions, and that has been acknowledged in the scientific community?
Posted by rasol (Member # 4592) on :
quote:Caucasian is a term that refers to the Caucasian race.
Your own wikipedia source refutes this Dr. Winters:
Caucasian -- is a geographical term, meaning relative or pertaining to the Caucasus region (Caucasia) of central Eurasia.
Caucasian may also refer to:
1 Caucasian race, racial/ethnic group
2 Languages of the Caucasus
3 A Caucasian, nickname for a White Russian (cocktail)
^ Hard to believe you are still stuck trying to argue that the use of the term caucasian is itself scientific proof that race exists.
Posted by Mansa Musa (Member # 6800) on :
I'm surprised at how far this topic dragged.
Obviously racial terms being used in scientific literature are not proof that those terms themselves are scientifically valid.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Mansa Musa: I'm surprised at how far this topic dragged.
...really a product of circular exchanges, not debates [since no answers on outstanding questions were provided from the end supposedly defending the biologically UNPROVEN concept of human "races"], encouraged by the undeserved patience of the other side, who have adequately substantiated the pseudo-scientific basis of such concept.
Posted by Clyde Winters (Member # 10129) on :
Race From Wikipedia, the free encyclopedia Jump to: navigation, search This article may benefit form being shortened by the use of summary style. Summary style moves large sections to sub-articles that are summarized in the main article. For other uses, see Race (disambiguation). The term race distinguishes a population of humans (or non-humans) from other populations. The most widely used human racial categories are based on visible traits (especially skin color and facial features), genes, and self-identification. Conceptions of race, as well as specific racial groupings, vary by culture and over time and are often controversial, for scientific reasons as well as their impact on social identity and identity politics. Legal definitions, common usage, and scientific meaning can all be conflated, causing confusion and controversy.
Webster's Dictionary defines race as "a group of people of common ancestry or stock". Descent is defined as 'derivation from an ancestor'.
Takruri
quote: I could go on and on but none of the geneticists in the post of 01 June, 2006 07:12 AM addressed to me, use any variation of the word "race" themselves. They are explicit that their subjects are representatives of populations, or ethnicities, or descents.
All of these terms are talking about races. The use of terms like population are also talking about the races that inhabit a particular region.
And when researchers are talking about caucasians, blacks and oriental they are also talking about races.
Supercar
quote: Since Mr. Winters hasn't answered ANY of the questions or studies thus far posed here to him, can he at least answer these previous points I've made:
a)No one has provided any distinctive parameters for human "races", and neither has Clyde.
b)Even if we were to assume that some geneticists use "racial" terms, the question remains: have they proven existence of discrete human "races" UP-To-DATE?
Where have they made the case that it exists, and have PROVEN so, by providing the parameters that define their conclusions, and that has been acknowledged in the scientific community?
Granted in none of the papers I cited do the authors discuss the genetic basis of race. This is due to the fact that their papers were not aimed at this objective.
But these papers do illustrate that genetics can use genetic markers to accurately aggregate individuals into races . This was not too surprising because templeton had made it clear that at least 15% of genetic variation could be traced to what could be interpreted as "racial" differences. This alone makes it clear that race exist. The only way one can claim races don't exist is to prove that their is no differences within individuals due to genetic variation. This along with the fact that Tang et al found that 95% of people in their study showed genetic cluster membership related to their self-identified race/ethnicity make it clear that genetics can determine race.
Topdog posted the following [/quote] Race doesn't matter.
In fact, it doesn't even exist in humans.
While that may sound like the idealistic decree of a minister or rabbi, it's actually the conclusion of an evolutionary and population biologist at Washington University.
Alan R. Templeton, Ph.D., professor of biology in Arts and Sciences, has analyzed DNA from global human populations that reveal the patterns of human evolution over the past one million years. He shows that while there is plenty of genetic variation in humans, most of the variation is individual variation. While between-population variation exists, it is either too small, which is a quantitative variation, or it is not the right type of qualitative variation -- it does not mark historical sublineages of humanity.
Using the latest molecular biology techniques, Templeton has analyzed millions of genetic sequences found in three distinct types of human DNA and concludes that, in the scientific sense, there is no such thing as race.
"Race is a real cultural, political and economic concept in society, but it is not a biological concept, and that unfortunately is what many people wrongfully consider to be the essence of race in humans -- genetic differences," Templeton said. "Evolutionary history is the key to understanding race, and new molecular biology techniques offer so much on recent evolutionary history. I wanted to bring some objectivity to the topic. This very objective analysis shows the outcome is not even a close call: There's nothing even like a really distinct subdivision of humanity."
Templeton used the same strategy to try to identify race in human populations that evolutionary and population biologists use for non-human species, from salamanders to chimpanzees. He treated human populations as if they were non-human populations.
"I'm not saying these results don't recognize genetic differences among human populations," he cautioned. "There are differences, but they don't define historical lineages that have persisted for a long time."
Templeton's paper, "Human Races: A Genetic and Evolutionary Perspective," is published in the fall 1998 issue of the American Anthropologist, an issue almost exclusively devoted to race. The new editor-in-chief of the American Anthropologist is Robert W. Sussman, Ph.D., professor of anthropology in Arts and Sciences.
"The folk concept of race in America is so ingrained as being biologically based and scientific that it is difficult to make people see otherwise," said Sussman, a biological anthropologist. "We live on the one-drop racial division --if you have one drop of black or Native American blood, you are considered black or Native American, but that doesn't cover one's physical characteristics.
"Templeton's paper," Sussman continued, "shows that if we were forced to divide people into groups using biological traits, we'd be in real trouble. Simple divisions are next to impossible to make scientifically, yet we have developed simplistic ways of dividing people socially."
[/quote]
In the papers I posted above the researchers divided people in to races to conduct their research. They described the genetic makeup of the people and its association with the identified race of the group. This clearly indicates that race exist as a variable in biological research.
The Tang study highlights the ability of genetics to correlate genetics with race. Tang et al noted that:
quote:
We have analyzed genetic data for 326 microsatellite markers that were typed uniformly in a large multiethnic population-based sample of individuals as part of a study of the genetics of hypertension (Family Blood Pressure Program). Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic) and were recruited from 15 different geographic locales within the United States and Taiwan. Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories. Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity. On the other hand, we detected only modest genetic differentiation between different current geographic locales within each race/ethnicity group. Thus, ancient geographic ancestry, which is highly correlated with self-identified race/ethnicity--as opposed to current residence--is the major determinant of genetic structure in the U.S. population. Implications of this genetic structure for case-control association studies are discussed.
The research finding that of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity makes it clear there are genetic parameters that geneticists can use to differiate between individuals belonging to different races.
This is not surprising because it was noted in the original post by Topdog that:
quote:
Single lineage Templeton analyzed genetic data from mitochondrial DNA, a form inherited only from the maternal side; Y chromosome DNA, paternally inherited DNA; and nuclear DNA, inherited from both sexes. His results showed that 85 percent of genetic variation in the human DNA was due to individual variation. A mere 15 percent could be traced to what could be interpreted as "racial" differences.
"The 15 percent is well below the threshold that is used to recognize race in other species," Templeton said. "In many other large mammalian species, we see rates of differentiation two or three times that of humans before the lineages are even recognized as races. Humans are one of the most genetically homogenous species we know of. There's lots of genetic variation in humanity, but it's basically at the individual level. The between-population variation is very, very minor."
The finding that 15% of genetic variation in the human DNA was due to individual variation relating to racial background make it clear that humans can be differiated by race. Moreover, the finding that 95% of the racial self-classifications in the Tang et al study correlated with the genetic profiles of members of each group make it clear that racial difference can be determined by genetics.
The fact that 1) Terms that refer to race: caucasian, black, oriental by writers of biological rseaerch, make it clear they were talking about race in their papers; 2) Templeton found that 15% of individual differiation via DNA was accountable to race in 1999; and 3) Tang et al, in a recent study of 3,636 subjects who self-identified their race, found that 95% of the subjects showed genetic cluster membership related to their self-identified race/ethnicity, make it clear that race is a biological concept.
We must conclude, given the evidence that race exist.
Posted by Clyde Winters (Member # 10129) on :
Mansa Musa
quote:
I'm surprised at how far this topic dragged.
Obviously racial terms being used in scientific literature are not proof that those terms themselves are scientifically valid.
You should not be so surprised this debate has lasted so long just about every post on ES is about effects of genetics and race on history.
Scientist are exact in their use of words. They have to be when explaining any phenomena. The fact that these scientist used race terms make it clear that they were talking about race in the research papers. They would not have used clearly identified racial terms, if they were not talking about race.
To disguise the substance of their papers they would have used neutral terms that relate to region. No, they talked about the race of their subjects because: Race exist.
.
Posted by Clyde Winters (Member # 10129) on :
Supercar
quote:
I'm surprised at how far this topic dragged.
Obviously racial terms being used in scientific literature are not proof that those terms themselves are scientifically valid.
I have answered all the questions posed on this thread:
[/QUOTE]The subject of this thread is does race exist. It was originally claimed that race does not exist based on Templeton:
quote:
"Race is a real cultural, political and economic concept in society, but it is not a biological concept, and that unfortunately is what many people wrongfully consider to be the essence of race in humans -- genetic differences," Templeton said. "Evolutionary history is the key to understanding race, and new molecular biology techniques offer so much on recent evolutionary history. I wanted to bring some objectivity to the topic. This very objective analysis shows the outcome is not even a close call: There's nothing even like a really distinct subdivision of humanity."
1)I have shown that this is untrue. I presented evidence that Forensic scientists continue to use "race" as a way to classify humans
2) I have presented evidence that even geneticist use race when discussing the haplotype and haplogroup of individuals and populations.
These facts indicate that Templeton is wrong scientist still recognize a distinct subdivision of humanity.
In your post on the Templeton statement that guides this thread you claim that it can only be refuted by answering the following questions:
Rasol
quote: 1) show us that different SNP markers can be used to systematically classify populations into races.
2) list the geneticist who support this theory with direct, clear statements to the effect that this is so.
3) present a study classifying Dravidians and Africans into a distinct race based upon specific SNP markers.
[/B]
But this is uncessary because they were not part of Templeton's statement. Bu I will answer them anyway.
1) show us that different SNP markers can be used to systematically classify populations into races.
It is not necessary to provide any specific SNP markers used to systematically classify populations into races. Research studies published by geneticists clearly indicate that they continue to use race to describe poulations in the research literature as I have pointed out in previous post that I will repose below.
[/b]
: Hum Immunol. 2006 Jan-Feb;67(1-2):73-84. Epub 2006 Apr 5. Related Articles, Links The haplotype structure of the human major histocompatibility complex.Alper CA, Larsen CE, Dubey DP, Awdeh ZL, Fici DA, Yunis EJ.CBR Institute for Biomedical Research, Boston, MA 02115, USA; Department of Pediatrics, Harvard Medical School, Boston, MA 02115, USA.There is great interest in the use of single-nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) analysis to localize human disease genes. The results suggest that the human genome, including the major histocompatibility complex (MHC), consists largely of 5- to 200-kb blocks of sequence fixity between which random recombination occurs. Direct determination of MHC haplotypes from family studies also demonstrates similar-sized blocks, but otherwise gives a very different picture, with a third to a half of Caucasian haplotypes fixed from HLA-B to HLA-DR/DQ (at least 1 Mb) as conserved extended haplotypes (CEHs), some of which encompass more than 3 Mb. These fixed haplotypes differ in frequency both in different Caucasian subpopulations and in Caucasian patients with HLA-associated diseases, complicating disease susceptibility gene localization. The inherent inability of LD analysis to "see" DNA fixity beyond three markers contributes to the failure of SNP/LD analysis to define in detail or even detect CEHs in the MHC and probably elsewhere in the genome. More importantly, the use of statistical analysis, rather than direct haplotype determination and counting, fails to reveal the details of haplotype structure essential for gene localization. Given the oversimplified picture of the MHC (and probably the rest of the genome) provided only by SNP/LD-defined blocks, it is questionable whether this approach will be of great help in disease susceptibility gene localization or identification.
Br J Haematol. 1997 Aug;98(2):356-64. Related Articles, Links
Specificity and sensitivity of RHD genotyping methods by PCR-based DNA amplification.
Aubin JT, Le Van Kim C, Mouro I, Colin Y, Bignozzi C, Brossard Y, Cartron JP.
Centre d'Hemobiologie Perinale, Paris, France.
We have compared the sensitivity and specificity of four PCR methods of RHD gene detection using different sets of primers located in the regions of highest divergence between the RHD and RHCE genes, notably exon 10 (method I), exon 7 (method II), exon 4 (method III) and intron 4 (method IV). Methods I-III were the most sensitive and gave a detectable signal with D-pos/D-neg mixtures containing only 0.001% D-positive cells. Moreover, method II could detect the equivalent DNA amount present in only three nucleated cells in the assay without hybridization of PCR products, whereas the sensitivity of the other methods was 10-50 times less. Investigation of D variants indicated that false-negative results were obtained with method II (D(IVb) variant), method III (D(VI) and DFR variants) and method IV (D(VI) variants), but not method I. Weak D (D(u)) was correctly detected as D-positive by all methods, but most cases of Rh(null) appeared as false-positives, as they carry normal RH genes that are not phenotypically expressed. Some false-positive results were obtained with method I in a few Caucasian DNA samples serotyped as RhD-neg but carrying a C- or E-allele, whereas a high incidence of false-positives was found among non-Caucasian Rh-negative samples by all methods. In the Caucasian population, however, we found a full correlation between the predicted genotype and observed phenotype at birth of 92 infants. Although we routinely use the four methods for RHD genotyping, a PCR strategy based on at least two methods is recommended.
Hum Immunol. 2006 Jan-Feb;67(1-2):125-39. Epub 2005 Nov 4. Related Articles, Links
Disease Relevant HLA Class II Alleles Isolated by Genotypic, Haplotypic, and Sequence Analysis in North American Caucasians With Pemphigus Vulgaris.
Lee E, Lendas KA, Chow S, Pirani Y, Gordon D, Dionisio R, Nguyen D, Spizuoco A, Fotino M, Zhang Y, Sinha AA.
Department of Dermatology, Weill Medical College of Cornell University, New York, NY.
Early studies of genetic susceptibility to pemphigus vulgaris (PV) showed associations between human leukocyte antigen (HLA) DR4 and DR6 and disease. The emergence of DNA sequencing techniques has implicated numerous DRB1 and DQB1 loci in various populations, leading to confusion regarding which exact alleles confer susceptibility. The strong linkage disequilibrium among DR and DQ HLA alleles further complicates the investigation of the true susceptibility loci. In this study, we report genotyping data for the largest sampling of North American Caucasian non-Jewish and Ashkenazi Jewish PV patients studied to date and compare our data with other population studies. To pinpoint true susceptibility, alleles among overrepresented sequences, we applied a step-wise reductionist analysis through (1) determination of the degree of linkage disequilibrium (LD) between purportedly associated alleles, (2) haplotype frequencies comparisons, and (3) primary sequence comparisons of disease-associated versus non-disease-associated alleles to identify crucial differences in amino acid residues in putative peptide binding pockets. Collectively, our data provide extended support for the hypothesis that the HLA associations in Caucasian PV patients map to DRB1*0402 and DQB1*0503 alone. Further structure-function studies will be required to define the exact mechanisms of HLA-mediated control of susceptibility and resistance to disease.
PMID: 16698434 [PubMed - in process]
Ann Hum Genet. 2006 May;70(Pt 3):350-9. Related Articles, Links
A comparison of individual genotyping and pooled DNA analysis for polymorphism validation prior to large-scale genetic studies.
Yang HC, Lin CH, Hung SI, Fann CS.
Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan 115.
Polymorphism validation is an important issue in genetic studies because only polymorphic markers provide useful information. We analyzed genetic data for 180 SNPs in the human major histocompatibility complex region in Caucasian and Taiwanese populations, and evaluated ethnic heterogeneity between these populations to illustrate the importance of polymorphism validation. An initial individual genotyping experiment (IGE) with 95 samples was compared with a DNA pooling allele-typing experiment (PAE) of 630 individuals for polymorphism validation based on authentic data sets. Afterwards, all samples were genotyped individually in a confirmation study. Under narrow (broad) polymorphism criteria, 24 (41) polymorphic SNPs in Caucasians could not be validated in the Taiwanese population, suggesting a 13% (23%) inconsistency rate and revealing a strong discrepancy between genetic backgrounds, probably due to ethnic heterogeneity. IGE yielded high sensitivity and specificity for polymorphism validation, but may be sensitive to sampling variation. PAE showed high sensitivity (97%) and specificity (100%) using a narrow polymorphism criterion, but reduced specificity (83%) using a broad criterion. Public domain polymorphism databases should therefore be used with caution and polymorphism validation should be performed routinely prior to conducting large-scale genetic studies. PAE is a cost-saving, reliable alternative to IGE for polymorphism validation, especially for a stringent polymorphism criterion.
2) list the geneticist who support this theory with direct, clear statements to the effect that this is so.
This question was already answered above when I provided the published papers where racial terms such as caucasian is frequently used for the "white'" race. Use of the term caucasian is a clear statement to the effect race continues to play a role in the research of geneticists as proven by the papers discussed above.
3) present a study classifying Dravidians and Africans into a distinct race based upon specific SNP markers.
You already mentioned one the Cavelli Sforza study.
Clyde Winters [quote]:I have never read where the geneticists have claimed that the Dravidians were Caucasian.
Rasol
quote: Cavelli Sforza has claimed this.
Since Sforza classifies the Dravidians as caucasian proves that geneticists use racial terms to describe populations. It refutes Templeton's claim that
Supercar
quote: Since Mr. Winters hasn't answered ANY of the questions or studies thus far posed here to him, can he at least answer these previous points I've made:
a)No one has provided any distinctive parameters for human "races", and neither has Clyde.
b)Even if we were to assume that some geneticists use "racial" terms, the question remains: have they proven existence of discrete human "races" UP-To-DATE?
Where have they made the case that it exists, and have PROVEN so, by providing the parameters that define their conclusions, and that has been acknowledged in the scientific community?
Granted in none of the papers I cited do the authors discuss the genetic basis of race. This is due to the fact that their papers were not aimed at this objective.
But these papers do illustrate that genetics can use genetic markers to accurately aggregate individuals into races . This was not too surprising because templeton had made it clear that at least 15% of genetic variation could be traced to what could be interpreted as "racial" differences. This alone makes it clear that race exist. The only way one can claim races don't exist is to prove that their is no differences within individuals due to genetic variation. This along with the fact that Tang et al found that 95% of people in their study showed genetic cluster membership related to their self-identified race/ethnicity make it clear that genetics can determine race.
quote:
"Race is a real cultural, political and economic concept in society, but it is not a biological concept, and that unfortunately is what many people wrongfully consider to be the essence of race in humans -- genetic differences," Templeton said. "Evolutionary history is the key to understanding race, and new molecular biology techniques offer so much on recent evolutionary history. I wanted to bring some objectivity to the topic. This very objective analysis shows the outcome is not even a close call: There's nothing even like a really distinct subdivision of humanity."
If their is no distinct subdivision of humanity into races:
1)why do geneticists continue to use racial terms in their research and even Sforza call the Dravidians caucasians?
2) How did Templeton find that 15% of genetic variation could be traced to what could be interpreted as "racial" differences
3) How did that 95% of people in the Tang et al study show genetic cluster membership related to their self-identified race/ethnicity.
The answer is: Race exist.
.
Posted by Clyde Winters (Member # 10129) on :
Supercar
quote: quote: -------------------------------------------------------------------------------- Originally posted by Clyde Winters:
Granted in none of the papers I cited do the authors discuss the genetic basis of race. --------------------------------------------------------------------------------
Case closed then. Nothing short of the said so-called "geneticist" advocates of "human races" actually proving the concept of human races, substitutes as proof of "human races" in biology. If so, provide one, UP-TO-DATE, and accepted by the scientific community as scientifically VALID!
You're right it is closed, we know that genetics can and does support the genetic basis of race. The articles did not discuss the genetic basis of race, but they did show that people can be aggregated into different races by individual genetic markers.
If you can use genetics to document a person's race. Genetics makes it clear that RACE EXIST!
.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Clyde Winters:
Granted in none of the papers I cited do the authors discuss the genetic basis of race.
Case closed then. Nothing short of the said so-called "geneticist" advocates of "human races" actually proving the concept of human races, substitutes as proof of "human races" in biology. If so, provide one, UP-TO-DATE, and accepted by the scientific community as scientifically VALID!
Posted by Djehuti (Member # 6698) on :
Of course, Winters is desperate to cling on to the purely social constructs of race.
It is the only way he can still maintain his fantasy of Yemeni originated Berbers and Saharan originated Dravidians! Ha! Posted by rasol (Member # 4592) on :
^ Or use iconography to sugggest that Ancient Japanese/Chinese are Negros and therefore belong to and African race.
What I am really interested in is getting Winters to see....that the entire structure of his discourse is and *EXACT PARALLEL* of white supremacist racism.
Posted by rasol (Member # 4592) on :
quote:Winters: a recent study of 3,636 subjects who self-identified their race, found that 95% of the subjects showed genetic cluster membership related to their self-identified ethnicity
Genomic Boundaries between Human Populations - Human Heredity 2006
We conclude that it is indeed possible to cluster genotypes according to geography, but no study so far identified unambiguously anything that can be regarded as a major genetic subdivision of humankind, and hence discontinuous models of human diversity are unsupported by data.
quote:Originally posted by Clyde Winters:
Granted in none of the papers I cited do the authors discuss the genetic basis of race.
Thank you. You surprise me, in admitting this, if belatedly, and impress me in doing so.
props.
Posted by alTakruri (Member # 10195) on :
But you can't.
Race isn't biological that's why no geneticist has produced even a single study that
1). states there is a biological reality called race 2). define race in scientific terms 3). gives a list of races 4). classifies discrete racial parameters 5). isolated genes that each race but no other races have
Hence, you can't use genetics to document a person's race. Genetics makes it clear that RACE DOES NOT EXIST on a genetic level!
quote:Originally posted by Clyde Winters: If you can use genetics to document a person's race. Genetics makes it clear that RACE EXIST!
Posted by alTakruri (Member # 10195) on :
From the Journal of American History review of the documentary Race—The Power of an Illusion.
quote: The most dazzling episode is the first, "The Difference between Us," written, produced, and directed by Christine Herbes-Sommers. Interweaving scientific demonstration and historical analysis, the program demolishes the assumption that race is an essential or genetic trait, showing it instead to be a cultural prism.
At center stage is a group of students whose teacher, Scott Bronson of Cold Springs Harbor Lab, leads them through an analysis of a small loop (a 350-letter sequence) of their own mitochondrial DNA . When the information is entered into a global database, the experiment demonstrates to the students, who initially group themselves by surface markers, that they actually have an astonishing geographic range of exact matches.
Posted by alTakruri (Member # 10195) on :
Race is not taught in science classes. Race is taught in sociology classes.
The Practice of Sociology and Biological definitions of race
June 24, 2005
How many races exist? * What is the difference between populations and race? * Who decides how populations should be bundled into races? * What do these question tell us about race?
Who decides how populations should be bundled into races? * Changing racial definitions in different states
What do the different definitions about the number of races tell us?
Number of Races? * 1 race, the human race, according to the current view of many modern biologists and social scientists * 4 or more according to the Census Bureau * 5 according to Blumenbach * Infinite number of races
Definitions of Race Racial categories are a creation only of society vs. Racial Categories are a biological fact
A biological definition of race:
quote: “The term “race” implies the existence of some nontrivial underlying hereditary features shared by a group of people and not present in other groups” –(Graves 2001:5)
What does modern biology say about race? What is the current biological view of race?
* Skin color really is only skin deep. Most traits are inherited independently from one another. The genes influencing skin color have nothing to do with the genes influencing hair form, eye shape, blood type, musical talent, athletic ability or forms of intelligence. Knowing someone’s skin color doesn’t necessarily tell you anything else about him or her.
* There is no concordance between skin color and other human characteristics.
What is the current biological view of race?
* Most variation is within, not between, "races." Of the small amount of total human variation, 85% exists within any local population, be they Italians, Kurds, Koreans or Cherokees. About 94% can be found within any continent. That means two random Koreans may be as genetically different as a Korean and an Italian.
What is the current biological view of race?
* Human subspecies don’t exist. Unlike many animals, modern humans simply haven’t been around long enough or isolated enough to evolve into separate subspecies or races. Despite surface appearances, we are one of the most similar of all species.
What is the current biological view of race?
* Race has no genetic basis. Not one characteristic, trait or even one gene distinguishes all the members of one so-called race from all the members of another so-called race.
What is the current biological view of race? * Race has no genetic basis. * Human subspecies don’t exist. * Skin color really is only skin deep. * Most variation is within, not between, "races."
Race as Biology: What do we know? * Race does not exist
Race as Historical and Social reality: What do we know? * Race is Real
Key points * Enormity of race as a historical and social reality * Emptiness of race as biology
Posted by Djehuti (Member # 6698) on :
quote:Originally posted by alTakruri:
* Most variation is within, not between, "races." Of the small amount of total human variation, 85% exists within any local population, be they Italians, Kurds, Koreans or Cherokees. About 94% can be found within any continent. That means two random Koreans may be as genetically different as a Korean and an Italian.
Unfortunately, people like Michael still try to limit the phenotypic diversity of certain populations and specifically those of Africa who possess the greatest genetic diversity since they are the source of all human diversity!!
Posted by Clyde Winters (Member # 10129) on :
Takruri
quote:
Race has no genetic basis. Not one characteristic, trait or even one gene distinguishes all the members of one so-called race from all the members of another so-called race.
This is false. Even Templeton found that 15% of individual differiation is accountable to DNA. Therefore you can not claim that there is not one gene that distinguishes all the members of one so-called race from all the members of another so-called race.
Takruri
quote: Hence, you can't use genetics to document a person's race. Genetics makes it clear that RACE DOES NOT EXIST on a genetic level!
This is false the fact that 1) Templeton found that 15% of individual differiation via DNA was accountable to race in 1999; and 2) Tang et al, in a recent study of 3,636 subjects who self-identified their race,[b] found that 95% of the subjects showed genetic cluster membership related to their self-identified race/ethnicity, make it clear that genetics can aggregate individuals by race .
Race does exist.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
What I am really interested in is getting Winters to see....that the entire structure of his discourse is and *EXACT PARALLEL* of white supremacist racism.
Rasol this is going a bit too far. I am not racist. I am just acknowledging that geneticists use race in their reseach, and as a result of the Tang et al study we know that the overwhelming majority of individuals who self-identified their race, showed genetic cluster membership related to their self-identified race/ethnicity.
The ability of genetics to match individuals of the same race make it clear that genetics can aggregate individuals by race . As a result, we know that to say races exist is not racism, it is just stating a reality based on contemporary genetic research.
As I observed in an earlier post don't attack the messager, I am only discussing the genetic research which recognizes race. In your own post you noted that must, but not all geneticists and anthropologists have abandoned the notion of race.
The research of Tang et al, suggest that geneticists have made great advances over the past six (6) years since the publication of the Templeton article. Now it appears geneticists can be more precise in using genetics to cluster individuals according to race and ethnicity.
These researchers know that race exist.
.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Clyde Winters:
This is false. Even Templeton found that 15% of individual differiation is accountable to DNA. Therefore you can not claim that there is not one gene that distinguishes all the members of one so-called race from all the members of another so-called race.
You make it falsely sound as though Templeton is in any way vindicating you, when it was Templeton's article in the opening notes, that you are supposedly arguing against. Lol.
What distinctive genes separate one human "race" from another one. Lay out their names and demonstrate how they are confined to a single "race", which is to be named, along with the groups involved in that race.
Posted by rasol (Member # 4592) on :
quote:Rasol this is going a bit too far. I am not racist.
Be careful Dr. Winters. I didn't say you were a racist.
While I am addressing the parallels in your argument to white supremacist racisms discourse, I don't believe you have any malice of heart towards any other people.
I believe you are well intended.
I won't comment on your judgement though, because that would possibly be 'personal'.
Posted by rasol (Member # 4592) on :
quote:Originally posted by Clyde Winters:
Even Templeton found that 15% of individual differiation is accountable to DNA.
quote:SuperCar writes: You make it falsely sound as though Templeton is in any way vindicating you, when it was Templeton's article in the opening notes, that you are supposedly arguing against. Lol.
And completely mistates Templeton and so misses Templeton's point:
85 percent of genetic variation in the human DNA was due to INDIVIDUAL variation.
The other 15% is the 'group' differentiation.
In biology, the greater the level of the former as opposed to the later, the less sense it makes to divide a species into a sub-species.
And that's another reason why biology recognises humans to be a single species, with no sub-species, or races.
hope this helps.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Supercar:
You make it falsely sound as though Templeton is in any way vindicating you, when it was Templeton's article in the opening notes, that you are supposedly arguing against. Lol.
...and you are using other studies in similar false manner.
a)Name the contemporary geneticists by name, whom YOU claim believe in biological human "races" through your "psycho analysis" of these folks,
b)CITE them on their own admission in their belief in the "existence" of discrete "human races"
c)CITE their work, where they claimed to have proven the concept of "human races",
Last but not least:
d)Show us that the above work, has reached a concensus of approval within the Scientific community!
And oh, btw, the following still stands:
What distinctive genes separate one human "race" from another one. Lay out their names and demonstrate how they are confined to a single "race", which is to be named, along with the groups involved in that race.
Good luck in producing the answers to these requests; you'll need it. Posted by Clyde Winters (Member # 10129) on :
Supercar
quote: quote:Originally posted by Supercar:
You make it falsely sound as though Templeton is in any way vindicating you, when it was Templeton's article in the opening notes, that you are supposedly arguing against. Lol.
...and you are using other studies in similar false manner.
a)Name the contemporary geneticists by name, whom YOU claim believe in biological human "races" through your "psycho analysis" of these folks,
b)CITE them on their own admission in their belief in the "existence" of discrete "human races"
c)CITE their work, where they claimed to have proven the concept of "human races",
Last but not least:
d)Show us that the above work, has reached a concensus of approval within the Scientific community!
And oh, btw, the following still stands:
What distinctive genes separate one human "race" from another one. Lay out their names and demonstrate how they are confined to a single "race", which is to be named, along with the groups involved in that race.
Good luck in producing the answers to these requests; you'll need it.
I am not going to continue to play this game. I have accurately critiqued the papers presented in this thread and they prove race exist. I have already proven that race exist. I have already answered all the questions I plan on answering. The questions you are asking have nothing to do with the question race doesn't exist. These questions involve primary research that I can not undertake because I have no expertise in this area or access to necessary DNA samples.
But I don't have to post the distinctive genes that separate one human race from the other, the fact that Tang et al was able to aggregate population according to race indicates that they exist, but you will have to ask him what genes he used to make this discovery.
You can never prove that race doesen't exist because geneticists continue to use race terms in their research and genetics can differiate people into races as proven bt Tang et al.
I will not waste my time answering questions that involve primary research on my part. This thread will go on forever. You have failed to prove that race doesn't exist because race does exist. Let's review the evidence I have presented in support of my hypothesis.
Let's look at the definition of hypothesis from Wikipedia, the free encyclopedia :
quote: A hypothesis is a suggested explanation of a phenomenon or reasoned proposal suggesting a possible correlation between multiple phenomena. The term is derived from the ancient Greek, hypotithenai meaning "to put under" or "to suppose." A scientific hypothesis must be testable and generally will be based upon previous observations or extensions of scientific theories.
Here is my hypothesis: If race exist, it will be part of the biological research literature.
To test this hypothesis I have conducted a content analysis of the biological research literature to determine if race is a part of the research literature. To confirm my hypothesis I have to only illustrate that use of race is evident in the biological research literature.
Throughout this thread and below I will demonstrate that race is part of the biological discourse. The use of race in the biological literature confirms my hypothesis.
This evidence of race in the biological literature falsifies the idea race doesn't exist, because if it didn't exist, there would be an absence of race in the literature, but the inverse is reality.
I have answered all the questions originally posed on this thread:
[/QUOTE]The subject of this thread is does race exist. It was originally claimed that race does not exist based on Templeton:
quote:
"Race is a real cultural, political and economic concept in society, but it is not a biological concept, and that unfortunately is what many people wrongfully consider to be the essence of race in humans -- genetic differences," Templeton said. "Evolutionary history is the key to understanding race, and new molecular biology techniques offer so much on recent evolutionary history. I wanted to bring some objectivity to the topic. This very objective analysis shows the outcome is not even a close call: There's nothing even like a really distinct subdivision of humanity."
1)I have shown that this is untrue. I presented evidence that Forensic scientists continue to use "race" as a way to classify humans
2) I have presented evidence that even geneticist use race when discussing the haplotype and haplogroup of individuals and populations.
These facts indicate that Templeton is wrong scientist still recognize a distinct subdivision of humanity.
In your post on the Templeton statement that guides this thread you claim that it can only be refuted by answering the following questions:
Rasol
quote: 1) show us that different SNP markers can be used to systematically classify populations into races.
2) list the geneticist who support this theory with direct, clear statements to the effect that this is so.
3) present a study classifying Dravidians and Africans into a distinct race based upon specific SNP markers.
[/B]
But this is uncessary because they were not part of Templeton's statement. Bu I will answer them anyway.
1) show us that different SNP markers can be used to systematically classify populations into races.
It is not necessary to provide any specific SNP markers used to systematically classify populations into races. Research studies published by geneticists clearly indicate that they continue to use race to describe poulations in the research literature as I have pointed out in previous post that I will repose below.
[/b]
: Hum Immunol. 2006 Jan-Feb;67(1-2):73-84. Epub 2006 Apr 5. Related Articles, Links The haplotype structure of the human major histocompatibility complex.Alper CA, Larsen CE, Dubey DP, Awdeh ZL, Fici DA, Yunis EJ.CBR Institute for Biomedical Research, Boston, MA 02115, USA; Department of Pediatrics, Harvard Medical School, Boston, MA 02115, USA.There is great interest in the use of single-nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) analysis to localize human disease genes. The results suggest that the human genome, including the major histocompatibility complex (MHC), consists largely of 5- to 200-kb blocks of sequence fixity between which random recombination occurs. Direct determination of MHC haplotypes from family studies also demonstrates similar-sized blocks, but otherwise gives a very different picture, with a third to a half of Caucasian haplotypes fixed from HLA-B to HLA-DR/DQ (at least 1 Mb) as conserved extended haplotypes (CEHs), some of which encompass more than 3 Mb. These fixed haplotypes differ in frequency both in different Caucasian subpopulations and in Caucasian patients with HLA-associated diseases, complicating disease susceptibility gene localization. The inherent inability of LD analysis to "see" DNA fixity beyond three markers contributes to the failure of SNP/LD analysis to define in detail or even detect CEHs in the MHC and probably elsewhere in the genome. More importantly, the use of statistical analysis, rather than direct haplotype determination and counting, fails to reveal the details of haplotype structure essential for gene localization. Given the oversimplified picture of the MHC (and probably the rest of the genome) provided only by SNP/LD-defined blocks, it is questionable whether this approach will be of great help in disease susceptibility gene localization or identification.
Br J Haematol. 1997 Aug;98(2):356-64. Related Articles, Links
Specificity and sensitivity of RHD genotyping methods by PCR-based DNA amplification.
Aubin JT, Le Van Kim C, Mouro I, Colin Y, Bignozzi C, Brossard Y, Cartron JP.
Centre d'Hemobiologie Perinale, Paris, France.
We have compared the sensitivity and specificity of four PCR methods of RHD gene detection using different sets of primers located in the regions of highest divergence between the RHD and RHCE genes, notably exon 10 (method I), exon 7 (method II), exon 4 (method III) and intron 4 (method IV). Methods I-III were the most sensitive and gave a detectable signal with D-pos/D-neg mixtures containing only 0.001% D-positive cells. Moreover, method II could detect the equivalent DNA amount present in only three nucleated cells in the assay without hybridization of PCR products, whereas the sensitivity of the other methods was 10-50 times less. Investigation of D variants indicated that false-negative results were obtained with method II (D(IVb) variant), method III (D(VI) and DFR variants) and method IV (D(VI) variants), but not method I. Weak D (D(u)) was correctly detected as D-positive by all methods, but most cases of Rh(null) appeared as false-positives, as they carry normal RH genes that are not phenotypically expressed. Some false-positive results were obtained with method I in a few Caucasian DNA samples serotyped as RhD-neg but carrying a C- or E-allele, whereas a high incidence of false-positives was found among non-Caucasian Rh-negative samples by all methods. In the Caucasian population, however, we found a full correlation between the predicted genotype and observed phenotype at birth of 92 infants. Although we routinely use the four methods for RHD genotyping, a PCR strategy based on at least two methods is recommended.
Hum Immunol. 2006 Jan-Feb;67(1-2):125-39. Epub 2005 Nov 4. Related Articles, Links
Disease Relevant HLA Class II Alleles Isolated by Genotypic, Haplotypic, and Sequence Analysis in North American Caucasians With Pemphigus Vulgaris.
Lee E, Lendas KA, Chow S, Pirani Y, Gordon D, Dionisio R, Nguyen D, Spizuoco A, Fotino M, Zhang Y, Sinha AA.
Department of Dermatology, Weill Medical College of Cornell University, New York, NY.
Early studies of genetic susceptibility to pemphigus vulgaris (PV) showed associations between human leukocyte antigen (HLA) DR4 and DR6 and disease. The emergence of DNA sequencing techniques has implicated numerous DRB1 and DQB1 loci in various populations, leading to confusion regarding which exact alleles confer susceptibility. The strong linkage disequilibrium among DR and DQ HLA alleles further complicates the investigation of the true susceptibility loci. In this study, we report genotyping data for the largest sampling of North American Caucasian non-Jewish and Ashkenazi Jewish PV patients studied to date and compare our data with other population studies. To pinpoint true susceptibility, alleles among overrepresented sequences, we applied a step-wise reductionist analysis through (1) determination of the degree of linkage disequilibrium (LD) between purportedly associated alleles, (2) haplotype frequencies comparisons, and (3) primary sequence comparisons of disease-associated versus non-disease-associated alleles to identify crucial differences in amino acid residues in putative peptide binding pockets. Collectively, our data provide extended support for the hypothesis that the HLA associations in Caucasian PV patients map to DRB1*0402 and DQB1*0503 alone. Further structure-function studies will be required to define the exact mechanisms of HLA-mediated control of susceptibility and resistance to disease.
PMID: 16698434 [PubMed - in process]
Ann Hum Genet. 2006 May;70(Pt 3):350-9. Related Articles, Links
A comparison of individual genotyping and pooled DNA analysis for polymorphism validation prior to large-scale genetic studies.
Yang HC, Lin CH, Hung SI, Fann CS.
Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan 115.
Polymorphism validation is an important issue in genetic studies because only polymorphic markers provide useful information. We analyzed genetic data for 180 SNPs in the human major histocompatibility complex region in Caucasian and Taiwanese populations, and evaluated ethnic heterogeneity between these populations to illustrate the importance of polymorphism validation. An initial individual genotyping experiment (IGE) with 95 samples was compared with a DNA pooling allele-typing experiment (PAE) of 630 individuals for polymorphism validation based on authentic data sets. Afterwards, all samples were genotyped individually in a confirmation study. Under narrow (broad) polymorphism criteria, 24 (41) polymorphic SNPs in Caucasians could not be validated in the Taiwanese population, suggesting a 13% (23%) inconsistency rate and revealing a strong discrepancy between genetic backgrounds, probably due to ethnic heterogeneity. IGE yielded high sensitivity and specificity for polymorphism validation, but may be sensitive to sampling variation. PAE showed high sensitivity (97%) and specificity (100%) using a narrow polymorphism criterion, but reduced specificity (83%) using a broad criterion. Public domain polymorphism databases should therefore be used with caution and polymorphism validation should be performed routinely prior to conducting large-scale genetic studies. PAE is a cost-saving, reliable alternative to IGE for polymorphism validation, especially for a stringent polymorphism criterion.
2) list the geneticist who support this theory with direct, clear statements to the effect that this is so.
This question was already answered above when I provided the published papers where racial terms such as caucasian is frequently used for the "white'" race. Use of the term caucasian is a clear statement to the effect race continues to play a role in the research of geneticists as proven by the papers discussed above.
3) present a study classifying Dravidians and Africans into a distinct race based upon specific SNP markers.
You already mentioned one the Cavelli Sforza study.
Clyde Winters [quote]:I have never read where the geneticists have claimed that the Dravidians were Caucasian.
Rasol
quote: Cavelli Sforza has claimed this.
Since Sforza classifies the Dravidians as caucasian proves that geneticists use racial terms to describe populations. It refutes Templeton's claim that
Supercar
quote: Since Mr. Winters hasn't answered ANY of the questions or studies thus far posed here to him, can he at least answer these previous points I've made:
a)No one has provided any distinctive parameters for human "races", and neither has Clyde.
b)Even if we were to assume that some geneticists use "racial" terms, the question remains: have they proven existence of discrete human "races" UP-To-DATE?
Where have they made the case that it exists, and have PROVEN so, by providing the parameters that define their conclusions, and that has been acknowledged in the scientific community?
Granted in none of the papers I cited do the authors discuss the genetic basis of race. This is due to the fact that their papers were not aimed at this objective.
But these papers do illustrate that genetics can use genetic markers to accurately aggregate individuals into races . This was not too surprising because templeton had made it clear that at least 15% of genetic variation could be traced to what could be interpreted as "racial" differences. This alone makes it clear that race exist. The only way one can claim races don't exist is to prove that their is no differences within individuals due to genetic variation. This along with the fact that Tang et al found that 95% of people in their study showed genetic cluster membership related to their self-identified race/ethnicity make it clear that genetics can determine race.
quote:
"Race is a real cultural, political and economic concept in society, but it is not a biological concept, and that unfortunately is what many people wrongfully consider to be the essence of race in humans -- genetic differences," Templeton said. "Evolutionary history is the key to understanding race, and new molecular biology techniques offer so much on recent evolutionary history. I wanted to bring some objectivity to the topic. This very objective analysis shows the outcome is not even a close call: There's nothing even like a really distinct subdivision of humanity."
If their is no distinct subdivision of humanity into races:
1)why do geneticists continue to use racial terms in their research and even Sforza call the Dravidians caucasians?
2) How did Templeton find that 15% of genetic variation could be traced to what could be interpreted as "racial" differences
3) How did that 95% of people in the Tang et al study show genetic cluster membership related to their self-identified race/ethnicity.
The answer is: Race exist.
.
Posted by rasol (Member # 4592) on :
^ Repetition fallacy exists. Posted by Tee85 (Member # 10823) on :
So, were basically ALL the SAME right????
Humans are not different from each other right????
Posted by alTakruri (Member # 10195) on :
We have cited studies, documentaries, even a sociology class lecture all explicitly saying there are no human sub-species and that race is not biological/genetic in that there are no genes that only one so-called "race" has that no other so-called "races" have. Nor do genes controlling colour get inherited in a set controlling other physical features, natural abilities, or any other traits ascribed to race.
When the biological race proponent is asked to produce citations from reputable sources he not only is unable to do so but says he will not do the same simple research we have done in presenting our sources.
As has been done since 1658 all he can do is mistake, geographic defined population, skin-colour, nationality, ethnicity, etc., for biological genetic sub-species.
He flusters and spams the same reports we have conclusively shown to not support his contentions but rather negate them. He dogmatically repeats his mantra "race exists" as if we haven't acknowledged the fact that race exists only as a scientifically meaningless social construct.
Because he holds this dogma like an article of religious faith and because all of his works rely on race thought, he feels he can never concede that race is not genetic, else his race based conclusions rest on a falsehood. But this isn't necessarily so. He can still use his races, though no school will probably allow him to teach so, but must realize that when he does so he's talking sociology not science.
Posted by Clyde Winters (Member # 10129) on :
Takruri
quote:
When the biological race proponent is asked to produce citations from reputable sources he not only is unable to do so but says he will not do the same simple research we have done in presenting our sources.
This is hogwash. The articles cited thus far are from refutable sources.
Takruri
quote:
Cruzado is the scientist in Kearns article. Where does Cruzado specifically or explicitly use the term race in his study?
The Use of Mitochondrial DNA to Discover Pre-Columbian Migrations to the Caribbean: Results for Puerto Rico and Expectations for the Dominican Republic
Dr. Juan C. Martínez Cruzado
A slide show, for use with Internet Explorer, accompanies this paper PDF Version for printing 360 KB
In this study, we use Mitochrondrial DNA technology (mtDNA) to improve our understanding of the pre-Columbian migrations to the Antilles that gave rise to the Taínos. As a basis for our work, we need to review various studies, principally of the archaeological type, that have given us knowledge of the pre-Columbian migrations to the Greater Antilles. [1]
It is known that more than 8,000 years ago the Greater Antilles were inhabited by nomads who depended for their survival upon the foods that they could collect and the animals that they could hunt. That era is known as the Lithic Era, which is distinguished by the stone tools that these people made. [2]
Some 4,000 years later, we begin to note a great quantity of tools and adornments made of shells and some made of bone. That era is known as the Archaic Era, populated by nomads who appear to have subsisted principally on seafoods, but who also ate terrestrial products. It was not until some 2,200 years ago that a ceramic culture arrived in the Greater Antilles, consisting of agriculturalists who built permanent settlements near their areas of cultivation. [3]
Little is known about the migrations from which the nomads originated, better known as the pre-ceramic culture. Three routes have been identified by which there could have been migratory waves to the Greater Antilles: proceeding from the Florida Peninsula by means of Cuba, proceeding from the Yucatan Peninsula also by means of Cuba, and proceeding from the Orinoco Delta by means of the Lesser Antilles. Dental studies done by Dr. Edwin Crespo, as in other studies, suggest that there were at least two migratory waves to the Greater Antilles. For this reason, confirmation of the use of the routes does not necessarily indicate that the other routes were not also used. [4]
Distinct ceramic cultures existed in the Greater Antilles. Even before the time of Christ, on the island of Vieques, there already existed a Huecoid culture and Saladoid culture, clearly distinguishable by their ceramics, but also through other cultural aspects. For example, while the burials of the Saladoids can be found relatively easily, the remains of Huecoid bones have never been found. All that has been found is one milk tooth. For this reason, it is believed that the religions of both cultures could have contained very different elements. Furthermore the Huecoids were specialists in working with semi-precious stones, which they frequently sculpted in the form of animals. Among them the figure of a bird stands out that many have identified as the Andean condor, for which reason they attach a continental origin to this region. Deposits with ceramic elements very similar to those of the Huecoids have been found near the mouth of the Guapo River in Venezuela. From there they would have taken the maritime route eastward toward Puerto Rico, Vieques, and other islands in the Northeastern Caribbean. The Saladoids, on the other hand, migrated from the region of Saladero near the mouth of the Orinoco River by means of the Lesser Antilles until they arrived in the Greater Antilles. [5]
The Huecoid culture lasted some few hundred years, but the Saladoid culture, evolving with time, lasted until approximately the year A.D. 600. Certain evidence has been found in Puerto Rico that suggests great, natural events of a catastrophic nature that could have put an end to the Saladoid culture. What is certain is that a clearly distinct culture developed beginning from that date, the Ostionoid, which is divided into two stages known as pre-Taíno and Taíno. We do not know if the Ostionoid culture represents a marked cultural change of the Saladoid culture people due to the natural catastrophic events or some other type of event, or if it represents the arrival of a new migratory wave of Southamerican origin. [6]
In conclusion, the archaeological evidence can identify four pre-Columbian migrations to the Greater Antilles: two pre-ceramic and two ceramic. The actual number of pre-Columbian migrations very well might have been only four, but there could have been many more. [7]
We will see now what the mtDNA that we can extract from the contemporary inhabitants of the Major Antilles could offer us. The vast majority of our genetic material, perhaps better known as DNA, is found in the nucleus of the cell. The mtDNA, however, is not located in the nucleus of the cell but in an organelle known as the mitochondria. While nuclear DNA is inherited in equal parts from one’s father and mother, mtDNA is inherited only from one’s mother. It does not mix with that of the father and for that reason remains intact generation after generation, thus maintaining its original identity. That is to say, despite the intensive mestizaje (genetic “mixture”) that has characterized our region over the centuries, we Caribbeans have mtDNAs that have maintained their original identity and that can be identified as African, Indian, or Caucasian . Their identity depends upon the women in our genetic tree at the end of the strictly maternal ancestral line. If this great-great-great grandmother were indigenous, then the corresponding Caribbean would have an indigenous mtDNA. He or she would have inherited it intact from that great-great-great grandmother who lived through those terrible first years of the colonization by means of his or her great-great grandmothers, great grandmothers, and maternal grandmother. [8]
Takruri
quote:
-------------------------------------------------------------------------------- Where does Tang specifically or explicitly use the term race? Tang et al specifically denote their subjects using the term ethnicity and descent.
Tang H, Quertermous T, Rodriguez B, Kardia SL, Zhu X, Brown A, Pankow JS, Province MA, Hunt SC, Boerwinkle E, Schork NJ, Risch NJ.
Division of Public Health Sciences, Fred Hutchinson Cancer Research Center, Seattle, WA, USA.
We have analyzed genetic data for 326 microsatellite markers that were typed uniformly in a large multiethnic population-based sample of individuals as part of a study of the genetics of hypertension (Family Blood Pressure Program). Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic) and were recruited from 15 different geographic locales within the United States and Taiwan. Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories. Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity. On the other hand, we detected only modest genetic differentiation between different current geographic locales within each race/ethnicity group. Thus, ancient geographic ancestry, which is highly correlated with self-identified race/ethnicity--as opposed to current residence--is the major determinant of genetic structure in the U.S. population. Implications of this genetic structure for case-control association studies are discussed.
In this paper Tang was using genetics to explore ancestry. Since he is using genetics to explore racial ancestry the paper is concerned with biology, not geography.
Most importantly caucasian is a racial term it is not a geographical term. Caucasians live in many different geographic regions (Europe, Auatralia, Latin America and etc.) therefore the term can only be applied to race, not geography.
Takruri
quote: Likewise, where does Acuña specifically or explicitly employ the word race? Acuña et al refer to populations in speaking of sources for DNA samples.
Frequency of the hypervariable DNA loci D18S849, D3S1744, D12S1090 and D1S80 in a mixed ancestry population of Chilean blood donors M. Acuña1, H. Jorquera2, L. Cifuentes1 and L. Armanet3 1ICBM Genetic Program and 2Medical Technology School, Facultad de Medicina, Universidad de Chile, Casilla 70061, Santiago 7, Chile 3Forensic Medical Service, Santiago, Chile Corresponding author: M. Acuña E-mail: macuna@machi.med.uchile.cl Genet. Mol. Res. 1 (2): 139-146 (2002) Received April 11, 2002 Published June 27, 2002
Comparisons of D1S80 allele distribution between populations (Figure 2) using the ² test showed no significant differences between the Chilean population sample when compared with Southwestern US Hispanics and US Hispanics pooled (Zago et al., 1996; Huckenbeck et al., 1997). The research presented in this paper shows that the hypervariable DNA loci investigated are distinguishable from other Caucasian (Spanish), Black and Oriental populations, but that the D3S1744 locus is indistinguishable from the Caucasian population. All the loci studied are indistinguishable from USA Hispanic populations (Figures 2 and 3). This study provides the first database for DNA markers in low and middle socioeconomic strata in a Chilean population. The results presented indicate that the analysis of these loci may have useful applications in population genetics as well as in identity tests.
Figures 2 and 3 show the frequencies of the different alleles of the four hypervariable DNA loci in different populations. After combining allele classes to avoid low expected values, a c² homogeneity test for allele frequency distribution between the populations was performed. Most alleles were observed in all populations, with the most frequent alleles usually not differing for each population.
For the D18S849 locus the most frequent alleles for all five populations were 15, 16 and 17, with frequencies in the range of 13.6-41.7%. Our results for D18S849 in blood donors are very similar to those of US Hispanics (User's Manual; Lifecodes Corp.). The frequencies of different D3S1744 locus alleles in the five populations were similar, with allele 18 predominating. The c² test showed significant differences between the Chilean sample and US Black and US Oriental populations (User's Manual; Lifecodes Corp.).
The allele distributions for the D12S1090 locus were bimodal and very similar for the five populations, but a c² homogeneity test for allele frequency distribution between the Chilean population and US Black, US White and US Oriental populations showed significant differences for this locus (User's Manual; Lifecodes Corp.).
In the Webster's Dictionary the term black= Negro. In the same dictionary the definition for Negro="a member of the black race of mankind distinguished from members of other races.
In the same dictionary the definition for Oriental="a member of one of the peoples of the Orient; esp: a Chinese, Japanese or other Mongoloid.
In the Houghton Mifflin Dictionary Mongoloid is defined as: "of or concerning a major division of human species whose members chracteristically have yellowish-brown to white skin.....The definition of Negroid is: "of a major division of the human species whose members characteristically have brown to black skin....
Caucasian is a term that refers to the Caucasian race. There is no such thing as a caucasian, black or oriental population because the members of this racial group are situated throughout the world, instead of a specific geographical region.
The author of this article was clearly refering to race when he used these terms.
Takruri
quote:
Race has no genetic basis. Not one characteristic, trait or even one gene distinguishes all the members of one so-called race from all the members of another so-called race.
This is false. Even Templeton found that 15% of individual differiation is accountable to DNA. Therefore you can not claim that there is not one gene that distinguishes all the members of one so-called race from all the members of another so-called race.
Takruri
quote: Hence, you can't use genetics to document a person's race. Genetics makes it clear that RACE DOES NOT EXIST on a genetic level!
This is false the fact that 1) Templeton found that 15% of individual differiation via DNA was accountable to race in 1999; and 2) Tang et al, in a recent study of 3,636 subjects who self-identified their race,[b] found that 95% of the subjects showed genetic cluster membership related to their self-identified race/ethnicity, make it clear that genetics can aggregate individuals by race .
Race does exist.
.
Posted by Clyde Winters (Member # 10129) on :
Takruri
quote:
He flusters and spams the same reports we have conclusively shown to not support his contentions but rather negate them. He dogmatically repeats his mantra "race exists" as if we haven't acknowledged the fact that race exists only as a scientifically meaningless social construct.
Please conclusively show how each of the following articles do not support the proposition that race exist.
: Hum Immunol. 2006 Jan-Feb;67(1-2):73-84. Epub 2006 Apr 5. Related Articles, Links The haplotype structure of the human major histocompatibility complex.Alper CA, Larsen CE, Dubey DP, Awdeh ZL, Fici DA, Yunis EJ.CBR Institute for Biomedical Research, Boston, MA 02115, USA; Department of Pediatrics, Harvard Medical School, Boston, MA 02115, USA.There is great interest in the use of single-nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) analysis to localize human disease genes. The results suggest that the human genome, including the major histocompatibility complex (MHC), consists largely of 5- to 200-kb blocks of sequence fixity between which random recombination occurs. Direct determination of MHC haplotypes from family studies also demonstrates similar-sized blocks, but otherwise gives a very different picture, with a third to a half of Caucasian haplotypes fixed from HLA-B to HLA-DR/DQ (at least 1 Mb) as conserved extended haplotypes (CEHs), some of which encompass more than 3 Mb. These fixed haplotypes differ in frequency both in different Caucasian subpopulations and in Caucasian patients with HLA-associated diseases, complicating disease susceptibility gene localization. The inherent inability of LD analysis to "see" DNA fixity beyond three markers contributes to the failure of SNP/LD analysis to define in detail or even detect CEHs in the MHC and probably elsewhere in the genome. More importantly, the use of statistical analysis, rather than direct haplotype determination and counting, fails to reveal the details of haplotype structure essential for gene localization. Given the oversimplified picture of the MHC (and probably the rest of the genome) provided only by SNP/LD-defined blocks, it is questionable whether this approach will be of great help in disease susceptibility gene localization or identification.
Br J Haematol. 1997 Aug;98(2):356-64. Related Articles, Links
Specificity and sensitivity of RHD genotyping methods by PCR-based DNA amplification.
Aubin JT, Le Van Kim C, Mouro I, Colin Y, Bignozzi C, Brossard Y, Cartron JP.
Centre d'Hemobiologie Perinale, Paris, France.
We have compared the sensitivity and specificity of four PCR methods of RHD gene detection using different sets of primers located in the regions of highest divergence between the RHD and RHCE genes, notably exon 10 (method I), exon 7 (method II), exon 4 (method III) and intron 4 (method IV). Methods I-III were the most sensitive and gave a detectable signal with D-pos/D-neg mixtures containing only 0.001% D-positive cells. Moreover, method II could detect the equivalent DNA amount present in only three nucleated cells in the assay without hybridization of PCR products, whereas the sensitivity of the other methods was 10-50 times less. Investigation of D variants indicated that false-negative results were obtained with method II (D(IVb) variant), method III (D(VI) and DFR variants) and method IV (D(VI) variants), but not method I. Weak D (D(u)) was correctly detected as D-positive by all methods, but most cases of Rh(null) appeared as false-positives, as they carry normal RH genes that are not phenotypically expressed. Some false-positive results were obtained with method I in a few Caucasian DNA samples serotyped as RhD-neg but carrying a C- or E-allele, whereas a high incidence of false-positives was found among non-Caucasian Rh-negative samples by all methods. In the Caucasian population, however, we found a full correlation between the predicted genotype and observed phenotype at birth of 92 infants. Although we routinely use the four methods for RHD genotyping, a PCR strategy based on at least two methods is recommended.
Hum Immunol. 2006 Jan-Feb;67(1-2):125-39. Epub 2005 Nov 4. Related Articles, Links
Disease Relevant HLA Class II Alleles Isolated by Genotypic, Haplotypic, and Sequence Analysis in North American Caucasians With Pemphigus Vulgaris.
Lee E, Lendas KA, Chow S, Pirani Y, Gordon D, Dionisio R, Nguyen D, Spizuoco A, Fotino M, Zhang Y, Sinha AA.
Department of Dermatology, Weill Medical College of Cornell University, New York, NY.
Early studies of genetic susceptibility to pemphigus vulgaris (PV) showed associations between human leukocyte antigen (HLA) DR4 and DR6 and disease. The emergence of DNA sequencing techniques has implicated numerous DRB1 and DQB1 loci in various populations, leading to confusion regarding which exact alleles confer susceptibility. The strong linkage disequilibrium among DR and DQ HLA alleles further complicates the investigation of the true susceptibility loci. In this study, we report genotyping data for the largest sampling of North American Caucasian non-Jewish and Ashkenazi Jewish PV patients studied to date and compare our data with other population studies. To pinpoint true susceptibility, alleles among overrepresented sequences, we applied a step-wise reductionist analysis through (1) determination of the degree of linkage disequilibrium (LD) between purportedly associated alleles, (2) haplotype frequencies comparisons, and (3) primary sequence comparisons of disease-associated versus non-disease-associated alleles to identify crucial differences in amino acid residues in putative peptide binding pockets. Collectively, our data provide extended support for the hypothesis that the HLA associations in Caucasian PV patients map to DRB1*0402 and DQB1*0503 alone. Further structure-function studies will be required to define the exact mechanisms of HLA-mediated control of susceptibility and resistance to disease.
PMID: 16698434 [PubMed - in process]
Ann Hum Genet. 2006 May;70(Pt 3):350-9. Related Articles, Links
A comparison of individual genotyping and pooled DNA analysis for polymorphism validation prior to large-scale genetic studies.
Yang HC, Lin CH, Hung SI, Fann CS.
Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan 115.
Polymorphism validation is an important issue in genetic studies because only polymorphic markers provide useful information. We analyzed genetic data for 180 SNPs in the human major histocompatibility complex region in Caucasian and Taiwanese populations, and evaluated ethnic heterogeneity between these populations to illustrate the importance of polymorphism validation. An initial individual genotyping experiment (IGE) with 95 samples was compared with a DNA pooling allele-typing experiment (PAE) of 630 individuals for polymorphism validation based on authentic data sets. Afterwards, all samples were genotyped individually in a confirmation study. Under narrow (broad) polymorphism criteria, 24 (41) polymorphic SNPs in Caucasians could not be validated in the Taiwanese population, suggesting a 13% (23%) inconsistency rate and revealing a strong discrepancy between genetic backgrounds, probably due to ethnic heterogeneity. IGE yielded high sensitivity and specificity for polymorphism validation, but may be sensitive to sampling variation. PAE showed high sensitivity (97%) and specificity (100%) using a narrow polymorphism criterion, but reduced specificity (83%) using a broad criterion. Public domain polymorphism databases should therefore be used with caution and polymorphism validation should be performed routinely prior to conducting large-scale genetic studies. PAE is a cost-saving, reliable alternative to IGE for polymorphism validation, especially for a stringent polymorphism criterion.
.
Forensic value of the multicopy Y-STR marker DYS464
John M. Butler * , Richard Schoske 1 Biotechnology Division, National Institute of Standards and Technology, Gaithersburg, MD, USA Abstract. The tetranucleotide Y-chromosome short tandem repeat (Y-STR) marker, DYS464, first reported by Redd et al. [Forensic Sci. Int. 130 (2002) 97] appears to be the most polymorphic Y-STR marker discovered to date. A single primer pair can generate up to four distinct peaks over an allele range of 9–20 repeats. Allele calls can be made based on peaks that are present (conservative approach; C-type) or a combination of alleles and peak height ratios (expanded typing method; E- type). We have observed 113 C-types and 179 E-types in 679 males from three US populations. D 2003 Elsevier B.V. All rights reserved. Keywords: Y-STR; Y-chromosome; DYS464; Multicopy loci; DNA typing 1. Introduction DYS464 occurs at least four times in the highly palindromic region near the center of the long arm of the Y-chromosome [1–3]. In forensic casework applications where the amount of typable DNA material may be limited, the use of highly polymorphic markers is advantageous in order to limit the number of markers needed to distinguish unrelated individuals. 2. Materials and methods A total of 679 unique male DNA samples from three different US populations [4] were typed with DYS464 along with 21 additional Y-chromosome short tandem repeat (Y-STR) markers [3]. Only the DYS464 results are described in this report. Two novel DYS464 primer pairs, which differ from those originally described by Redd et al. [2], were used. 0531-5131/ D 2003 Elsevier B.V. All rights reserved. doi:10.1016/S0531-5131(03)01713-8 $ Points of view are those of the authors and do not necessarily represent the position of the US Departments of Justice or Defense. Certain commercial equipment, instruments, and materials are identified in order to specify experimental procedures as completely as possible. In no case does such identification imply a recommendation or endorsement by the National Institute of Standards and Technology, nor does it imply that any of the materials, instruments, or equipment identified are necessarily the best available for the purpose. * Corresponding author. Tel.: +1-301-975-4049; fax: +1-301-975-8505. E-mail address: john.butler@nist.gov (J.M. Butler). 1 Current address: Armed Forces Institute of Pathology, Washington, DC, USA. www.ics-elsevier.com International Congress Series 1261 (2004) 278–280
Page 2 The primers VIC-CTTTGGGCTATGCCTCAGTTT and GCCATACCTGGGTAACAGA- GAGAC produce green-labeled amplicons in the size range of 242–286 bp for DYS464 alleles 9–20, while the primers 6FAM-AGTTTACGAGCTTTGGGCTATG and GTGGCAAGATCTCATTTCTTCAA generate blue dye-labeled polymerase chain reac- tion (PCR) products that are 327–367 bp in size. PCR conditions are as previously described for the Y-STR 20plex [5]. An allelic ladder was created for DYS464 (Fig. 1), which contains all of the major alleles as well as single-base variants observed in our population study [3]. 3. Results and discussion We observed 179 expanded types with DYS464 in 679 male samples from three different US population sets: 265 African–Americans, 262 Caucasians, and 152 His- panics. The addition of peak height information (E-type) to just allele calls (C-type) can result in an expansion in the number of types observed (e.g., Fig. 2). The most common types are 15,15,17,17, which occurs in 10.6% of this data set, and 15,15,16,17, which occurs in 7.5%. All other DYS464 types are found at less than the 5% level, with over half of the observed types occurring only once (92 of 179 observed). If the DYS464 data are collapsed to C-types (conservative typing method), then 113 allele calls are observed in these 679 males. By way of comparison to other DNA typing markers in the same data set, DYS385 exhibited only 56 different types and FGA, the single best autosomal STR examined, had only 78 different genotypes. Furthermore, the four single-copy Y-STRs DYS19, DYS391, DYS392, and DYS393, when combined, only produced 93 different Fig. 1. NIST allelic ladder for DYS464 produced from eight different DNA samples. The variant alleles 14.3, 15.1, and 15.3 are helpful as a tool for measuring single-base resolution in electrophoretic systems. Fig. 2. Example of four samples with the same conservative DYS464 type, 14,15,18, which can be separated from one another by considering their expanded type through peak height variation. J.M. Butler, R. Schoske / International Congress Series 1261 (2004) 278–280 279
Page 3 haplotypes. Thus, DYS464 is more polymorphic than DYS385, the previously considered best multicopy Y-STR, and four single-copy Y-STRs in combination. A human Y- chromosome DNA profiling standard, NIST Standard Reference Material (SRM) 2395, is available and contains DYS464 information on its five male samples (see http:// www.nist.gov/srm). This SRM will enable laboratories worldwide to accurately calibrate their DYS464 typing results. Acknowledgements This work was supported by research funds from the US National Institute of Justice through Interagency Agreement 1999-IJ-R-094 with the NIST Office of Law Enforcement Standards. Much of this work was performed while R.S. was a graduate student at the NIST and the American University through funding from the US Air Force. The technical assistance and suggestions of Peter Vallone, David Duewer, Margaret Kline, and Jan Redman from our group at the NIST and Alan Redd from the University of Arizona are gratefully acknowledged. References [1] J.M. Butler, Recent developments in Y-short tandem repeat and Y-single nucleotide polymorphism analysis, Forensic Sci. Rev. 15 (2003) 91–111. [2] A.J. Redd, A.B. Agellon, V.A. Kearney, T. Karafet, P. de Knijff, H. Park, J.M. Butler, M.F. Hammer, Forensic value of fourteen novel STRs on the human Y chromosome, Forensic Sci. Int. 130 (2002) 97–111. [3] R. Schoske, P.M. Vallone, M.C. Kline, J.W. Redman, J.M. Butler, High-throughput Y-STR typing of U.S. populations with 27 regions of the Y chromosome using two multiplex PCR assays, Forensic Sci. Int. (In press). [4] J.M. Butler, R. Schoske, P.M. Vallone, J.W. Redman, M.C. Kline, Allele frequencies for 15 autosomal STR loci on U.S. Caucasian, African American, and Hispanic populations, J. Forensic Sci. 48 (4) (2003) 908–911. [5] J.M. Butler, R. Schoske, P.M. Vallone, M.C. Kline, A.J. Redd, M.F. Hammer, A novel multiplex for simultaneous amplification of 20 Y chromosome STR markers, Forensic Sci. Int. 129 (2002) 10–24. J.M. Butler, R. Schoske / International Congress Series 1261 (2004) 278–280 280
J Forensic Sci, July 2004, Vol. 49, No. 4 Paper ID JFS2003303 Available online at: www.astm.org Peter M. Vallone,1 Ph.D. and John M. Butler,1 Ph.D. Y-SNP Typing of U.S. African American and Caucasian Samples Using Allele-Specific Hybridization and Primer Extension∗ ABSTRACT: Multiplex analysis of genetic markers has become increasingly important in a number of fields, including DNA diagnostics and human identity testing. Two methods for examination of single nucleotide polymorphisms (SNPs) with a potential for a high degree of multiplex analysis of markers are primer extension with fluorescence detection, and allele-specific hybridization using flow cytometry. In this paper, we examined 50 different SNPs on the Y-chromosome using three primer extension multiplexes and five hybridization multiplex assays. For certain loci, the allele-specific hybridization method exhibited sizable background signal from the absent alternate allele. However, 100% concordance (>2000 alleles) was observed in ten markers that were typed using both methods. A total of 18 unique haplogroups out of a possible 45 were observed in a group of 229 U.S. African American and Caucasian males with the majority of samples being assigned into 2 of the 18 haplogroups. KEYWORDS: forensic science, Y-chromosome, single nucleotide polymorphism, SNP typing, Y-SNPs, SNaPshot, primer extension, Luminex, allele-specific hybridization In recent years, single nucleotide polymorphisms (SNPs) have become more widely used in a variety of applications, including medical diagnostics, population genetics, and human identity testing (1,2). The ability to analyze a number of SNP markers in parallel relies on multiplex amplification and detection formats (3). Two SNP detection formats capable of multiplex analysis are allelespecific primer extension (ASPE) and allele-specific hybridization (ASH), which we use here to examine variation along the Y-chromosome. The lack of recombination along most of the Y-chromosome makes it a useful tool in human evolutionary studies and assessing male migration patterns (4–10). Y-chromosome markers have also been used in attempts to address some interesting historical questions (11,12). Analysis of Y-SNP markers has typically been done with manual techniques such as restriction digestion of PCR products (10,13) or by procedures that can only examine one or two markers simultaneously such as allele-specific PCR (7), denaturing high performance liquid chromatography (5), melting curve analysis (14), and real-time PCR (15). More recently, microarrays (16), time-of-flight mass spectrometry (17), and fluorescent primer extension (10,18) have been applied to Y-SNP analysis in order to type multiple markers in parallel. In an effort to evaluate the usefulness of Y-chromosome SNP markers for human identity applications, we constructed several novel multiplex ASPE assays and utilized a new commercial ASH 1 Biotechnology Division, National Institute of Standards and Technology, Gaithersburg, MD 20899-8311. ∗ Contribution of the U.S. National Institute of Standards and Technology. Certain commercial equipment, instruments, and materials are identified in order to specify experimental procedures as completely as possible. In no case does such identification imply a recommendation or endorsement by the National Institute of Standards and Technology nor does it imply that any of the materials, instruments, or equipment identified are necessarily the best available for the purpose. Received 6 Sept. 2003; and in revised form 21 Dec. 2003, 6 March 2004. accepted 6 March 2004; published XXXX. kit to type 50 Y-SNP markers in more than 200 individuals. In addition, by examining ten of the Y-SNPs with both methods, we were able to assess concordance in more than 2000 allele calls between primer extension and hybridization approaches. Methods U.S. African American and Caucasian DNA Samples Anonymous liquid blood samples with self-identified ethnicities were purchased from Interstate Blood Bank, Inc. (Memphis, TN) and Millennium Biotech, Inc. (Ft. Lauderdale, FL) and extracted using a modified salting out procedure (19). Carll Ladd from the Connecticut Forensic Laboratory (Meriden, CT) kindly provided extracted DNA for 20 U.S. Caucasian and 20 African American samples usedas part of this study. TheextractedDNAwas quantified using ultraviolet (UV) spectrophotometry followed by a PicoGreen assay (20) to adjust concentrations to approximately 1 ng/µL. All samples were examined with 15 autosomal short tandem repeats and the amelogenin sex-typing marker using the AmpF_STR Identifiler Kit to verify that each sample was unique (21). A total of 229 male samples were typed (115 African Americans and 114 Caucasians). Y-SNP Markers A total of 50 Y-chromosome biallelic markers were used to cover all 18 major haplogroups (A-R) recognized by the Y-chromosome consortium (YCC) (22,23). Table 1 contains a summary of the YSNP markers used in this study according to their physical position along theY-chromosome. These positions were identified using amplicon sequences for the 50 Y-SNPs with the BLAST-Like Alignment Tool (BLAT): http://genome.ucsc.edu/cgi-bin/hgBlat. Of the 50 Y-SNPs, 18 was typed by three hexaplex allele specific primer extension assays. An additional set of 42 Y-SNP loci was typed by an ASH assay described below. Ten of the Y-SNP loci probed were redundant between the two sets. Copyright C_ 2004 by ASTM International, 100 Barr Harbor Drive, PO Box C700, West Conshohocken, PA 19428-2959. 723
J Forensic Sci, Mar. 2005, Vol. 50, No. 2 Paper ID JFS2004293 Available online at: www.astm.org TECHNICAL NOTE Margaret C. Kline,1 M.S.; Peter M. Vallone,1 Ph.D.; Janette W. Redman;1 David L. Duewer,2 Ph.D.; Cassandra D. Calloway,3,4 M.S.; and John M. Butler,1 Ph.D. Mitochondrial DNA Typing Screens with Control Region and Coding Region SNPs∗
ABSTRACT: Mitochondrial DNA (mtDNA) analysis has found an important niche in forensic DNA typing. It is used with highly degraded samples or low-copy number materials such as might be found from shed hair or bones exposed to severe environmental conditions. The primary advantage of mtDNA is that it is present in high copy number within cells and therefore more likely to be recovered from highly degraded specimens. A major disadvantage to traditional forensic mtDNA analysis is that it is time-consuming and labor-intensive to generate and review the 610 nucleotides of sequence information commonly targeted in hypervariable regions I and II (HVI and HVII) of the control region. In addition, common haplotypes exist in HVI/HVII mtDNA sequences that can reduce the ability to differentiate two unrelated samples. In this report we describe the utility of two newly available screening assays for rapid exclusion of non-matching samples. The LINEAR ARRAY mtDNA HVI/HVII Region-Sequencing Typing Kit (Roche Applied Science, Indianapolis, IN) was used to type 666 individuals from U.S. Caucasian, African American, and Hispanic groups. Processing of the LINEAR ARRAY probe panels “mito strips” was automated on a ProfiBlot workstation. Observable variation in 666 individuals is reported and frequencies of the mitotypes within and between populations are presented. Samples exhibiting the most common Caucasian mitotype were subdivided with a multiplexed amplification and detection assay using eleven single nucleotide polymorphisms in the mitochondrial genome. These types of screening assays should enable more rapid evaluation of forensic casework samples such that only samples not excluded would be subjected to further characterization through full HVI/HVII mtDNA sequence analysis. KEYWORDS: forensic science, DNA typing, mtDNA, SSO probes, mitochondrial DNA coding region, primer extension For the past decade, DNA sequencing of hypervariable regions I (HVI) and II (HVII) in the control region of mitochondrial DNA (mtDNA) has been useful in forensic casework for the analysis of human remains when nuclear DNA systems fail due to low amounts of DNA or highly degraded specimens (1–3). However, considerable effort and expense are required to develop a full HVI and HVII mtDNA sequence (typically positions 16024–16365 and 1 Biotechnology Division, National Institute of Standards and Technology, Gaithersburg, MD 20899. 2 Analytical Chemistry Division, National Institute of Standards and Technology, Gaithersburg, MD 20899. 3 Department of Human Genetics, Roche Molecular Systems, Alameda, CA 94501. 4 Comparative Biochemistry Group, University of California, Berkeley, CA. ∗ Contribution of the U.S. National Institute of Standards and Technology. Not subject to copyright. Certain commercial equipment, instruments and materials are identified in order to specify experimental procedures as completely as possible. In no case does such identification imply a recommendation or endorsement by the National Institute of Standards and Technology nor does it imply that any of the materials, instruments or equipment identified are necessarily the best available for the purpose. † Parts of this work were presented at the 2003 International Symposium on Human Identification, Phoenix, Arizona, and at the 2004 Annual Meeting of the American Academy of Forensic Sciences, Dallas, Texas. ‡ National Institute of Justice (NIJ) funded this work in part through an interagency agreement with the NIST Office of Law Enforcement Standards and NIJ grant 95-IJ-CX-0014 to Roche Molecular Systems. Received 31 July 2004; and in revised form 16 Oct. 2004; accepted 16 Oct. 2004; published 2 Feb. 2005. 73–340 are examined). Hence, several mtDNA screening methods have been developed (4–9). These screening methods permit rapid resolution of non-matching samples allowing a laboratory to focus more attention on full-sequencing of samples that cannot be resolved from one another with the screening method. Alternatively, laboratories without DNA sequencing capabilities or expertise can perform mtDNAtyping with a screening method and then send only those samples that are not excluded to a private or public laboratory for full HVI/HVII sequencing. This report details a number of inter-related technologies associated with the use of the newly available Linear Array Mitochondrial DNA HVI/HVII Region-Sequence Typing Kit (Roche Applied Science, Indianapolis, IN). The utility of a new microchip CE method for quantifying PCR products that are then hybridized to immobilized sequence specific oligonucleotide (SSO) probes is demonstrated. A semi-automated sample processing method for the Linear Arrays was developed and is demonstrated. The utility of this mtDNA typing kit is demonstrated by differentiating several hundred unrelated individuals from U.S. Caucasian, African American, and Hispanic groups. These results are compared to previous work with similar mtDNA SSO typing probes. The presence of multiple signals within a probe region resulting from sequence heteroplasmy is described as is the absence of signal within a probe region resulting from failed hybridization of PCR products due to additional destabilizing polymorphisms. In addition, a new coding region single nucleotide polymorphism (SNP) assay was employed to help subdivide 51 individuals possessing the most common Caucasian mtDNA haplotype (10,11). Copyright C_ 2005 by ASTM International, 100 Barr Harbor Drive, PO Box C700, West Conshohocken, PA 19428-2959. 377
378 JOURNAL OF FORENSIC SCIENCES Materials and Methods The steps involved in typing the control region SNPs with the mtDNA Linear Arrays are: DNA extraction/quantification, PCR amplification, PCR product quantification, hybridization of the PCR products to the Linear Arrays, detection with colored precipitate, interpretation of results for each sample, comparison of Linear Array results to other samples, and subdividing into groupings. Those samples possessing the most common Caucasian type were also processed with an additional coding region SNP assay as described below. DNA Samples A total of 666 DNA samples that had previously been extracted from whole blood were evaluated in this study. These samples, purchased from Interstate Blood Bank Inc. (Memphis, TN), are assumed to be unrelated and were classified into U.S. Caucasian (N =286), African American (N =252), or Hispanic (N =128) groups based on self-declaration. All samples possess unique STR profiles as determined previously with the AmpF_STR Identifier STR kit (Applied Biosystems, Foster City, CA) (12). Bloods were extracted by a modified “saltout” procedure (13). Portions of the genomic extracts were quantified by UV measurement on a Cary Bio 100 double-beam spectrophotometer (Varian Analytical Instruments, Walnut Creek, CA). Based on the UV/260 quantification, the samples were diluted to a nominal 1 ng/µL (14,15). The concentration of the diluted sample was verified by Pico Green quantitation to be between 0.5 ng/µL and 1.5 ng/µL (16). PCR Amplification One µL of each sample extract (≈1 ng/µL) was amplified using the mtDNA HVI/HVII Primer mix and mtDNA PCR Reaction Mix supplied by Roche Molecular Systems (Alameda, CA) as part of a beta-test of the Linear Array Mitochondrial DNA HVI/HVII Region-Sequence Typing kit. This kit is now available from Roche Applied Sciences (Indianapolis, IN) in the same format as described in this work (catalog number 03-527-867-001). Samples are amplified in a duplex PCR that simultaneously generates PCR products for HVI (positions 15975-16418) and HVII (positions 15–429). The HVI primers amplify an approximately 444 bp PCR product using the following primers: Forward (F15975-15993B) 5_-biotin-CTCCACCATTAGCACCCAA-3_ Reverse (R16418-16401B) 5_-biotin-ATTTCACGGAGGATGGTG-3_ The HVII primers amplify an approximately 416 bp PCR product using the following primers: Forward (F15-34B) 5_-biotin-CACCCTATTAACCACTCACG-3_ Reverse (R429-410B) 5_-biotin-CTGTTAAAAGTGCATACCGC-3_ Since 1 ng of genomic DNA was used rather than the “Kit” recommended 5 pg (based on nuclear DNA quantification), the number of amplification cycles was reduced from the recommended protocol. Whereas the standard protocol calls for 34–38 cycles, only 28 cycles were run in order to yield PCR products in the desired concentration range (see below). The PCR parameters used with a GeneAmp 9700 thermal cycler (Applied Biosystems) were: 94◦C for 14 min, 28 cycles of {92◦C for 15 s, 59◦C for 30 s, and 72◦C for 30 s}, final extension 72◦C for 10 min, and hold at 10◦C until the products could be removed from the thermal cycler. Amplification and typing of 11 SNP sites outside the HVI/HVII Region was performed using the multiplex amplification and allelespecific primer extension assay as previously published (11). These sites include SNPs at positions 3010, 4580, 4793, 5004, 7028, 7202, 10211, 12858, 14470 in the coding region and at positions 477 and 16519 in theVariable Regions (control region outside of HVI/HVII) that help differentiate the most common Caucasian Haplotype (10). Post-PCR Quantification Forty of the PCR products were quantified by loading 4 µL on to an agarose (3% mass NuSieve, 1% mass SeaKem GTG, Cambrex Bio Science Rockland, Inc., Rockland, ME) yield gel stained with ethidium bromide and imaged/analyzed with a FMBIO III plus (MiraiBio Inc., Alameda, CA). A yield gel quantification standard was supplied from Roche Molecular Systems as part of the beta-site test, which is the same as the DNA Molecular Weight Marker XIV 100 bp ladder available from Roche Applied Sciences (catalog number 1-721-933). A DNA Low Mass Ladder (catalog number 10068-013, Invitrogen, Carlsbad, CA) was also used for PCR product size estimation and quantification. All 666 HVI/HVII PCR products were quantified using the Agilent 2100 Bioanalyzer Lab Chip system (Agilent Technologies, Palo Alto, CA) and 1 µL of each PCR product according to the manufacturer’s protocols. The Agilent 2100 standard ladder calibrates for base pair (bp) sizing, and quantification for up to 12 samples per run (17). Two DNA fragments, 15 bp and 1500 bp, are added in each tested sample as internal standards to quantify PCR product amounts. Quantitation results were imported to an Excel spreadsheet in order to calculate the appropriate quantity of the PCR product to add to each Linear Array probe panel. Typically addition of ≈50 ng total amplified product to each probe panel was targeted. Control Region SNP Typing Manufacturer protocols for the Linear Arrays were followed in processing the HVI/HVII PCR products through hybridization to a nylon membrane containing specific probe sequences (Fig. 1). Allele-specific hybridization of the amplified DNA is detected using an enzymatic conversion of a soluble, colorless substrate to a blue-colored precipitate with the detection chemistry originally described by Saiki et al. (18). Cambridge Reference Sequence (19, 20) positions 16093, 16126, 16129, 16270, 16278, 16304, 16309, 16311, and 16362 from HVI and positions 73, 146, 150, 152, 189, 195, 198, 200, and 247 from HVII are probed in this assay. Samples were processed both manually (120 samples) and using a SLT ProfiBlot workstation (Tecan US, Research Triangle Park, NC) (remaining 446 samples). Steps in the developed Profiblot protocol are listed in Table 1. All reagents required for processing are pre-loaded onto the Tecan Profiblot. Up to 24 probe panels can be processed simultaneously in a 2 h run. The wash solution is placed in a heated/stirred heat block to maintain the required 55◦C temperature for hybridization. After the Linear Array probe panels are added to the tray, the Profiblot SLT instrument dispenses the
Mitochondrial DNA: Coding Region SNP Assay Development
Participants: Peter M. Vallone, Michael D. Coble, Margaret C. Kline, and John M. Butler (AFDIL participants: Rebecca Just and Thomas Parsons)
Project Timeframe: 2001 to present
Purpose: The development of multiplex primer extension assays to probe coding region mitochondrial SNPs to help resolve common mitotypes.
Progress: The typing of single nucleotide polymorphisms (SNPs) located throughout the mitochondrial genome (mtGenome) allows for differentiation between individuals possessing an identical HV1/HV2 sequence. A set of 11 SNPs selected for distinguishing individuals of the most common Caucasian HV1/HV2 mitotype were incorporated in an allele-specific primer extension assay. The 11-plex assay probed SNPs located at positions 477, 3010, 4580, 4793, 5004, 7028, 7202, 10211, 12858, 14470 and 16519 in the mtGenome. The assay was optimized for multiplex detection of these SNPs. Primers were designed to allow for the simultaneous polymerase chain reaction (PCR) amplification of 11 unique regions in the mtGenome. Locus specific primers of varying lengths were employed in multiplex primer extension reactions. Extension primers binding 5’ adjacent to the SNP site of interest were enzymatically extended using fluorescently labeled dideoxynucleotides (ddNTPs). Resolution and detection of each extended fragment were achieved by analysis on a capillary-based electrophoresis (CE) platform. The electrophoretic mobility for the extension primers was compared in denaturing POP4 and POP6 CE running buffers. Empirical adjustment of extension primer concentrations resulted in even signal intensity for the 11 loci probed. The development of the mtSNP 11-plex assay has resulted in an accurate method for typing sequence variant mtSNPs on a platform common to forensic laboratories.
We are currently developing additional multiplex SNP panels to resolve other common mitotypes (Caucasian, Hispanic, and African American).
Publications Resulting From This Project: Kline, M.C., Vallone, P.M., Redman, J.W., Duewer, D.L., Calloway, C.D., and Butler, J.M. (2005) Mitochondrial DNA typing screens with control region and coding region SNPs. J. Forensic Sci. 50(2): 377-385.
Just, R.S., Irwin, J.A., O'Callaghan, J.E., Saunier, J.L., Coble, M.D., Vallone, P.M., Butler, J.M., Barritt, S.M., and Parsons, T.J. (2004) Toward increased utility of mtDNA in forensic identifications. Forensic Sci. Int. 146S: S147-S149.
Vallone, P.M., Just, R.S., Coble, M.D., Butler, J.M., and Parsons, T.J. (2004) A multiplex allele-specific primer extension assay for forensically informative SNPs distributed throughout the mitochondrial genome. Int. J. Legal Med. 118: 147-157.
Coble, M.D., Just, R.S., O'Callaghan, J.E., Letmanyi, I.H., Peterson, C.T., Irwin, J.A., Parsons, T.J. (2004) Single nucleotide polymorphisms over the entire mtDNA genome that increase the power of forensic testing in Caucasians. Int. J. Legal Med. 118: 137-146.
.
Posted by Djehuti (Member # 6698) on :
Let me try to make things a little simpler for Clyde here. What geneticists use to identify populations are genetic markers, but such markers DO NOT necessarily correspond to any specific phenotypes.
The major reason why 'races' don't exist is because there is no group of people who share genes that are unique to that people.
Thus this Andamanese person here..
has the same phenotype as certain Africans, but he is the most genetically distant to Africans and is closer related to Asians!
This Fulani man here..
shares certain features one might associate with Europeans (caucazoids), but he an indigenous/black African.
Because phenotypic traits are NOT unique to certain populations AND because they do NOT correspond to lineage, therefor race does NOT exist.
Clyde, I challenge you to email the authors you cite to back up your claims (even though they don't)!
You know just as well as I do that the reason why you argue against the FACTS is that they debunk your whole notion of black Dravidians being Africans!!
Get a grip! Posted by alTakruri (Member # 10195) on :
This response shows you don't the meaning of the word "reputable", in my reply, from the word "refutable" in your animated rejoinder.
Soo eee, soo eee, piggy piggy piggy. Time for another bath.
quote:Originally posted by Clyde Winters: Takruri
quote:
When the biological race proponent is asked to produce citations from **[i]reputable[i]** sources he not only is unable to do so but says he will not do the same simple research we have done in presenting our sources.
This is hogwash. The articles cited thus far are from refutable sources.
Posted by Clyde Winters (Member # 10129) on :
Takruri
quote: This response shows you don't the meaning of the word "reputable", in my reply, from the word "refutable" in your animated rejoinder.
Soo eee, soo eee, piggy piggy piggy. Time for another bath.
I agree bathe in the truth and properly explain to the readers of this thread how the works cited fail to show race in biological research as you claim. Right now the dirty little secret piggy, piggy is you can't handle the truth.
.
Posted by alTakruri (Member # 10195) on :
Instead of spamming us with the entire article just quote the author's use of the word "race" or any of its derivatives.
In the section you enbolded
quote:That is to say, despite the intensive mestizaje (genetic “mixture”) that has characterized our region over the centuries, we Caribbeans have mtDNAs that have maintained their original identity and that can be identified as African, Indian, or Caucasian .[/b]neither the word race nor its derivatives is anywhere to be found.
Caribbean, Africa, India, and Caucasus are all geographic entitities thus Caribbean, African, Indian, and Caucasian refer to geographic populations. But that's not even the point or what I'm asking for.
Cite geneticists writing the word "race" or its derivitives (races, racial, etc.) to themselves describe their report subjects.
quote:Originally posted by Clyde Winters: Takruri [QUOTE]
Cruzado is the scientist in Kearns article. Where does Cruzado specifically or explicitly use the term race in his study?
The Use of Mitochondrial DNA to Discover Pre-Columbian Migrations to the Caribbean: Results for Puerto Rico and Expectations for the Dominican Republic
Dr. Juan C. Martínez Cruzado
Posted by alTakruri (Member # 10195) on :
This is close but it looks like the subjects identified themselves using popular racial categories whereas the geneticists used
quote:ancient geographic ancestry.
Of their listed four major groups, * white is a colour * African American is a nationality * East Asian is geographic population * Hispanic is a language based ethnicity
Since Spanish is a language of the whites there must be great overlap in the genetic clusters of those two groups.
African Americans are known to have white parents among them ranging in time from the 17th century until right now. There must be overlap in the genetic clusters of those two groups.
Hispanics have partial African ancestry both in Iberia and the Americas. African Americans are basically somewhat miscegenated Africans in the USA. Though African Americans and Iberians are more likely to have African ancestors from the same African micro-locus, as compared to the Americas Hispanics, there must be some genetic overlap of African Americans and Hispanics.
If there were Pilupunus in the study were they East Asian or Hispanic? Their self-identification would alter the weight of assigned clustering.
The fact that the report approximates genetic clusters with ancient geographic ancestry shows there is no discrete gene for either and that racial self-identification amounted to no more than pre-1492 geographically defined populations.
quote:Originally posted by Clyde Winters: Takruri
quote:
Where does Tang specifically or explicitly use the term race? Tang et al specifically denote their subjects using the term ethnicity and descent.
Subjects identified themselves as belonging to one of four major[/b] racial/ethnic groups (white, African American, East Asian, and Hispanic) and were recruited from 15 different geographic locales within the United States and Taiwan. Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories. Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity. On the other hand, we detected only modest genetic differentiation between different current geographic locales within each race/ethnicity group. Thus, ancient geographic ancestry[b], which is highly correlated with self-identified race/ethnicity--as opposed to current residence--is the major determinant of genetic structure in the U.S. population.
Posted by Clyde Winters (Member # 10129) on :
Takruri
quote:
This is close but it looks like the subjects identified themselves into popular racial categories whereas the geneticists used quote: -------------------------------------------------------------------------------- ancient geographic ancestry --------------------------------------------------------------------------------
quote: -------------------------------------------------------------------------------- Originally posted by Clyde Winters:
Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic) and were recruited from 15 different geographic locales within the United States and Taiwan. Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories.[b] Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity. On the other hand, we detected only modest genetic differentiation between different current geographic locales within each race/ethnicity group. Thus, ancient geographic ancestry, which is highly correlated with self-identified race/ethnicity--as opposed to current residence--is the major determinant of genetic structure in the U.S. population.
I have placed in bold the place where Tang et al use the word race.
The most significant aspect of this quote is the following: "Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity". This quote makes it clear that genetics can aggregate individuals by race.
.
Posted by alTakruri (Member # 10195) on :
Reread my above additions to analysis of Tang. They are aggregated by ancient geographic ancestry, Tang's conclusion you conveniently decided not to hi-lite in bold.
Ancient geographic ancestry is the major determinant of genetic structure.
quote: ... ancient geographic ancestry, which is highly correlated with self-identified race/ethnicity--as opposed to current residence--is the major determinant of genetic structure in the U.S. population.
Posted by alTakruri (Member # 10195) on :
I was not calling you a piggy. I was making fun of the word hogwash.
quote:Originally posted by Clyde Winters: Takruri
quote: This response shows you don't the meaning of the word "reputable", in my reply, from the word "refutable" in your animated rejoinder.
Soo eee, soo eee, piggy piggy piggy. Time for another bath.
I agree bathe in the truth and properly explain to the readers of this thread how the works cited fail to show race in biological research as you claim. Right now the dirty little secret piggy, piggy is you can't handle the truth.
.
Posted by alTakruri (Member # 10195) on :
Where is the word race (etc.) in your hi-lited section?
quote:Originally posted by Clyde Winters:
Takruri
quote: Likewise, where does Acuña specifically or explicitly employ the word race? Acuña et al refer to populations in speaking of sources for DNA samples.
The research presented in this paper shows that the hypervariable DNA loci investigated are distinguishable from other Caucasian (Spanish), Black and Oriental populations, but that the D3S1744 locus is indistinguishable from the Caucasian population.
Posted by Clyde Winters (Member # 10129) on :
Takruri
quote: Reread my above additions to analysis of Tang. They are aggregated by ancient geographic ancestry, Tang's conclusion you conveniently decided not to hi-lite in bold.
Ancient geographic ancestry is the major determinant of genetic structure.
... ancient geographic ancestry, which is highly correlated with self-identified race/ethnicity--as opposed to current residence--is the major determinant of genetic structure in the U.S. population.
The conclusion was two fold, the statement you highlighted was only half of the conclusion:
quote: Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories. Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity. On the other hand, we detected only modest genetic differentiation between different current geographic locales within each race/ethnicity group. Thus, ancient geographic ancestry, which is highly correlated with self-identified race/ethnicity--as opposed to current residence--is the major determinant of genetic structure in the U.S. population.
.
Posted by Clyde Winters (Member # 10129) on :
Takruri
quote:
Where is the word race (etc.) in your hi-lited section?
quote: -------------------------------------------------------------------------------- Originally posted by Clyde Winters:
The research presented in this paper shows that the hypervariable DNA loci investigated are distinguishable from other Caucasian (Spanish), Black and Oriental populations, but that the D3S1744 locus is indistinguishable from the Caucasian population. --------------------------------------------------------------------------------
Caucasian and Black are terms that denote races.
.
Posted by alTakruri (Member # 10195) on :
So there are no Caucasus Mountains whose inhabitants are Caucasians and whose language is Caucasian.
You mean Blumenbach never examined such Caucasian a skull and just made up the word Caucasian out of the ether?
quote:Originally posted by Clyde Winters:
Most importantly [/b]caucasian is a racial term it is not a geographical term. Caucasians live in many different geographic regions (Europe, Auatralia, Latin America and etc.) therefore the term can only be applied to race, not geography[/b].
Posted by alTakruri (Member # 10195) on :
No distraction please stay on point.
Again, since you've forgotten my questioning, I'm asking for geneticists explicitly writing the word race (etc.) in describing the subjects of their reports.
Such does not appear in this report you cite.
quote:Originally posted by Clyde Winters: Takruri
quote:
Where is the word race (etc.) in your hi-lited section?
quote: -------------------------------------------------------------------------------- Originally posted by Clyde Winters:
The research presented in this paper shows that the hypervariable DNA loci investigated are distinguishable from other Caucasian (Spanish), Black and Oriental populations, but that the D3S1744 locus is indistinguishable from the Caucasian population. --------------------------------------------------------------------------------
Caucasian and Black are terms that denote races.
.
Posted by Djehuti (Member # 6698) on :
Again.
quote:Originally posted by Djehuti: The major reason why 'races' don't exist is because there is no group of people who share genes that are unique to that people.
Thus this Andamanese person here..
has the same phenotype as certain Africans, but he is the most genetically distant to Africans and is closer related to Asians!
This Fulani man here..
shares certain features one might associate with Europeans (caucazoids), but he an indigenous/black African.
Because phenotypic traits are NOT unique to certain populations AND because they do NOT correspond to lineage, therefor race does NOT exist.
Clyde, I challenge you to email the authors you cite to back up your claims (even though they don't)!
You know just as well as I do that the reason why you argue against the FACTS is that they debunk your whole notion of black Dravidians being Africans!!
Get a grip!
Posted by kenndo (Member # 4846) on :
quote:Originally posted by alTakruri: This is close but it looks like the subjects identified themselves using popular racial categories whereas the geneticists used
quote:ancient geographic ancestry.
Of their listed four major groups, * white is a colour * African American is a nationality * East Asian is geographic population * Hispanic is a language based ethnicity
Since Spanish is a language of the whites there must be great overlap in the genetic clusters of those two groups.
African Americans are known to have white parents among them ranging in time from the 17th century until right now. There must be overlap in the genetic clusters of those two groups.
Hispanics have partial African ancestry both in Iberia and the Americas. African Americans are basically somewhat miscegenated Africans in the USA. Though African Americans and Iberians are more likely to have African ancestors from the same African micro-locus, as compared to the Americas Hispanics, there must be some genetic overlap of African Americans and Hispanics.
If there were Pilupunus in the study were they East Asian or Hispanic? Their self-identification would alter the weight of assigned clustering.
The fact that the report approximates genetic clusters with ancient geographic ancestry shows there is no discrete gene for either and that racial self-identification amounted to no more than pre-1492 geographically defined populations.
quote:Originally posted by Clyde Winters: Takruri
quote:
Where does Tang specifically or explicitly use the term race? Tang et al specifically denote their subjects using the term ethnicity and descent.
Subjects identified themselves as belonging to one of four major[/b] racial/ethnic groups (white, African American, East Asian, and Hispanic) and were recruited from 15 different geographic locales within the United States and Taiwan. Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories. Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity. On the other hand, we detected only modest genetic differentiation between different current geographic locales within each race/ethnicity group. Thus, ancient geographic ancestry[b], which is highly correlated with self-identified race/ethnicity--as opposed to current residence--is the major determinant of genetic structure in the U.S. population.
of course the form of mixture of african americans with some form of white admixture past or recent(those with very little,some or alot of white mixture) is only around or up to 67%,while the native american mixture is alittle higher(up 80% of african american are known to have some form of native american blood)the rest of the african american group(about 20%) are known to have no other form of racial mixture at all(example some folks i know and they well tell you )and it was on a pbs special and talks i had recently with mark shiver a dna expert(who was on tv)and his job it is to test racial mixture among groups and to track down peolpes past.
hispanics depending on which ones tend to have more native american blood on average than african(example-mexico,peru,chile,guatemala,costa rica etc.)
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Clyde Winters:
Supercar
quote::Originally posted by Supercar:
You make it falsely sound as though Templeton is in any way vindicating you, when it was Templeton's article in the opening notes, that you are supposedly arguing against. Lol.
...and you are using other studies in similar false manner.
a)Name the contemporary geneticists by name, whom YOU claim believe in biological human "races" through your "psycho analysis" of these folks,
b)CITE them on their own admission in their belief in the "existence" of discrete "human races"
c)CITE their work, where they claimed to have proven the concept of "human races",
Last but not least:
d)Show us that the above work, has reached a concensus of approval within the Scientific community!
And oh, btw, the following still stands:
What distinctive genes separate one human "race" from another one. Lay out their names and demonstrate how they are confined to a single "race", which is to be named, along with the groups involved in that race.
Good luck in producing the answers to these requests; you'll need it.
I am not going to continue to play this game.
These are non-negotiable requests for you to prove your basis. The only one playing games here, is yourself. Produce the answers for the "requests" herein, or admit that it is games like this that you are playing with me, that has caused the Scholarly community to dismiss you.
Posted by alTakruri (Member # 10195) on :
Overlaps exist between the groups I pointed out for the reasons I pointed out. Purity is a racialist's concept. You will not find SNPs and STRs limited to any one geographic population, skin colour grouping, hair type grouping, etc.
How much Amerind "blood" do Spaniards have? Are Spaniards Hispanic or are Spaniards white? If so, why? If not, why not?
What about Filipinos? How much Amerind "blood" in them? Are they Hispanic or East Asian?
This is why Hispanic is a useless term in either the colour, the racial social construct, or the geographic population genetics sense.
And how can it be comparing apples to apples (Jonathan, Granny Smith, Juicy Delicious) when one category is colour, another is nationality, the next is lingual cultural, and the last is geographic?
Posted by Clyde Winters (Member # 10129) on :
Supercar
quote:
quote:Originally posted by Clyde Winters:
Supercar
quote::Originally posted by Supercar:
You make it falsely sound as though Templeton is in any way vindicating you, when it was Templeton's article in the opening notes, that you are supposedly arguing against. Lol.
...and you are using other studies in similar false manner.
a)Name the contemporary geneticists by name, whom YOU claim believe in biological human "races" through your "psycho analysis" of these folks,
b)CITE them on their own admission in their belief in the "existence" of discrete "human races"
c)CITE their work, where they claimed to have proven the concept of "human races",
Last but not least:
d)Show us that the above work, has reached a concensus of approval within the Scientific community!
And oh, btw, the following still stands:
What distinctive genes separate one human "race" from another one. Lay out their names and demonstrate how they are confined to a single "race", which is to be named, along with the groups involved in that race.
Good luck in producing the answers to these requests; you'll need it.
I am not going to continue to play this game.
These are non-negotiable requests for you to prove your basis. The only one playing games here, is yourself. Produce the answers for the "requests" herein, or admit that it is games like this that you are playing with me, that has caused the Scholarly community to dismiss you.
I have already confirmed that race is part of the discourse in genetic research. Just because you refuse to admit it is fine with me the fact that the fact that 1) Templeton found that 15% of individual differiation via DNA was accountable to race in 1999; and 2) Tang et al, in a recent study of 3,636 subjects who self-identified their race,[b] found that 95% of the subjects showed genetic cluster membership related to their self-identified race/ethnicity, make it clear that genetics can aggregate individuals by race . This along with geneticist using racial terms in their research along with Sforza using racial terms to decribe the Dravidian people as caucasian, prove that: Race Exist.
.
Posted by rasol (Member # 4592) on :
^More proof that Repetition Fallacy Exists.
Posted by rasol (Member # 4592) on :
quote:Originally posted by alTakruri: Overlaps exist between the groups I pointed out for the reasons I pointed out. Purity is a racialist's concept. You will not find SNPs and STRs limited to any one geographic population, skin colour grouping, hair type grouping, etc.
How much Amerind "blood" do Spaniards have? Are Spaniards Hispanic or are Spaniards white? If so, why? If not, why not? What about Filipinos? How much Amerind "blood" in them? Are they Hispanic or East Asian?
^ Correct, and as you will certainly get no answers from Winters, let's use the lack of answers as and excuse to 'get the answers from those that have them':
Races really have no meaning biologically, certainly not genetically. Now, if you’re asking, “Do I have ancestors who came from the indigenous groups living in North America?” we could address that. But at the moment it’s very difficult to talk about dividing your genome up into 17 percent whatever. - Harvard biologist, Spencer Wells
Winters is invited to post the usual non-sequiturs, and ad nauseam fallacies, in response, or I should say, non-response, to Wells.......
Posted by alTakruri (Member # 10195) on :
Please at least tell us this.
1). What is race (biologically)?
2). How many biologically defined races are there?
3). List the names of these biologically defined races.
Posted by Djehuti (Member # 6698) on :
quote:Originally posted by rasol: ^More proof that Repetition Fallacy Exists.
LOL @ Clyde's desperation! Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
Please at least tell us this.
1). What is race (biologically)?
2). How many biologically defined races are there?
3). List the names of these biologically defined races.
An examination of the genetic literature clearly in dicates the races recognized by biologist.
quote:
J Forensic Sci, Mar. 2005, Vol. 50, No. 2 Paper ID JFS2004293 Available online at: www.astm.org TECHNICAL NOTE Margaret C. Kline,1 M.S.; Peter M. Vallone,1 Ph.D.; Janette W. Redman;1 David L. Duewer,2 Ph.D.; Cassandra D. Calloway,3,4 M.S.; and John M. Butler,1 Ph.D. Mitochondrial DNA Typing Screens with Control Region and Coding Region SNPs∗
ABSTRACT: Mitochondrial DNA (mtDNA) analysis has found an important niche in forensic DNA typing. It is used with highly degraded samples or low-copy number materials such as might be found from shed hair or bones exposed to severe environmental conditions. The primary advantage of mtDNA is that it is present in high copy number within cells and therefore more likely to be recovered from highly degraded specimens. A major disadvantage to traditional forensic mtDNA analysis is that it is time-consuming and labor-intensive to generate and review the 610 nucleotides of sequence information commonly targeted in hypervariable regions I and II (HVI and HVII) of the control region. In addition, common haplotypes exist in HVI/HVII mtDNA sequences that can reduce the ability to differentiate two unrelated samples. In this report we describe the utility of two newly available screening assays for rapid exclusion of non-matching samples. The LINEAR ARRAY mtDNA HVI/HVII Region-Sequencing Typing Kit (Roche Applied Science, Indianapolis, IN) was used to type 666 individuals from U.S. Caucasian, African American, and Hispanic groups. Processing of the LINEAR ARRAY probe panels “mito strips” was automated on a ProfiBlot workstation. Observable variation in 666 individuals is reported and frequencies of the mitotypes within and between populations are presented. Samples exhibiting the most common Caucasian mitotype were subdivided with a multiplexed amplification and detection assay using eleven single nucleotide polymorphisms in the mitochondrial genome. These types of screening assays should enable more rapid evaluation of forensic casework samples such that only samples not excluded would be subjected to further characterization through full HVI/HVII mtDNA sequence analysis.
This paper makes it clear that a popular race used in biological research is caucasian.
.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Clyde Winters:
Supercar
quote:
quote:Originally posted by Clyde Winters:
Supercar
quote::Originally posted by Supercar:
You make it falsely sound as though Templeton is in any way vindicating you, when it was Templeton's article in the opening notes, that you are supposedly arguing against. Lol.
...and you are using other studies in similar false manner.
a)Name the contemporary geneticists by name, whom YOU claim believe in biological human "races" through your "psycho analysis" of these folks,
b)CITE them on their own admission in their belief in the "existence" of discrete "human races"
c)CITE their work, where they claimed to have proven the concept of "human races",
Last but not least:
d)Show us that the above work, has reached a concensus of approval within the Scientific community!
And oh, btw, the following still stands:
What distinctive genes separate one human "race" from another one. Lay out their names and demonstrate how they are confined to a single "race", which is to be named, along with the groups involved in that race.
Good luck in producing the answers to these requests; you'll need it.
I am not going to continue to play this game.
These are non-negotiable requests for you to prove your basis. The only one playing games here, is yourself. Produce the answers for the "requests" herein, or admit that it is games like this that you are playing with me, that has caused the Scholarly community to dismiss you.
I have already confirmed that race is part of the discourse in genetic research.
You've confirmed nothing; just wishful thinking based on your "pyschic" powers that you claim to be exercising on several geneticists, who don't support your claim that human 'races' exist. If they did, you would have fulfilled my requests above.
quote:Winters:
Just because you refuse to admit it is fine with me the fact that the fact that 1) Templeton found that 15% of individual differiation via DNA was accountable to race in 1999; and 2) Tang et al, in a recent study of 3,636 subjects who self-identified their race,[b] found that 95% of the subjects showed genetic cluster membership related to their self-identified race/ethnicity, make it clear that genetics can aggregate individuals by race . This along with geneticist using racial terms in their research along with Sforza using racial terms to decribe the Dravidian people as caucasian, prove that: Race Exist.
Circular argumentation on jibberish above isn't going to save the day. Produce the answers to the aforementioned requests, or be dismissed. Case in point, can you even demonstrate that Sforza isn't part of the AAPA?
Posted by Clyde Winters (Member # 10129) on :
Supercar
quote:
quote:Winters:
Just because you refuse to admit it is fine with me the fact that the fact that 1) Templeton found that 15% of individual differiation via DNA was accountable to race in 1999; and 2) Tang et al, in a recent study of 3,636 subjects who self-identified their race, found that 95% of the subjects showed genetic cluster membership related to their self-identified race/ethnicity, make it clear that genetics can aggregate individuals by race . This along with geneticist using racial terms in their research along with Sforza using racial terms to decribe the Dravidian people as caucasian, prove that: Race Exist.
Circular argumentation on jibberish above isn't going to save the day. Produce the answers to the aforementioned requests, or be dismissed. Case in point, can you even demonstrate that Sforza isn't part of the AAPA?
[b] There is no such thing as circular argumentation. The arguments I have made have been based on reliable premises that race exist because geneticist and other biologists use race in their research; and as a result race exist.
The language in this premise is specific and concrete. And there is a tight connection between the premise: biologists use terms relating to race in their research; and my conclusion: therefore race exist.
I clearly presented definitions of mongoloid , caucasian and black that indicate that these terms refer to races. Sticking to clear meanings for the race terms has allowed me to avoid the classical fallacy of 'equivocation'.
I supported this premise by presenting examples from scientific articles discussing genetics where the researchers clearly used words that relate to race. In addition I presented specific examples of the correlation of race and genetics by researchers such as Tang et al , that indicate that genetics can aggregate individuals into racial groups.
Sforza is the father of genetic archaeology. He is already on record as saying that the Dravidians were caucasian so there is no way he can say that he doesn't believe in race.
Given the construction of my arguments there is firm support for the existence of race in genetic research, because race exist.
.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Clyde Winters:
There is no such thing as circular argumentation.
You are right, may be I should call it what it actually is; trolling!
Since you've chosen the path of "circular arguments", I will keep pressing for the following:
You make it falsely sound as though Templeton is in any way vindicating you, when it was Templeton's article in the opening notes, that you are supposedly arguing against. Lol.
...and you are using other studies in similar false manner.
A)Name the contemporary geneticists by name, whom YOU claim believe in biological human "races" through your "psycho analysis" of these folks,
B)CITE them on their own admission in their belief in the "existence" of discrete "human races"
C)CITE their work, where they claimed to have proven the concept of "human races",
Last but not least:
d)Show us that the above work, has reached a concensus of approval within the Scientific community!
And oh, btw, the following still stands:
What distinctive genes separate one human "race" from another one. Lay out their names and demonstrate how they are confined to a single "race", which is to be named, along with the groups involved in that race.
Good luck in producing the answers to these requests; you'll need it.
Produce the answers to the aforementioned requests, or be dismissed.
Demonstrate that Sforza isn't part of the AAPA, and that Sforza has proven the concept of human races.
Ps - The foundations for genetics have long been present before Sforza came to the scene, even though it didn’t reach the kind of maturity in usage as is now done. Need to at least go through some basic readings, to understand the science even remotely.
Posted by Clyde Winters (Member # 10129) on :
Supercar
quote:
Ps - The foundations for genetics have long been present before Sforza came to the scene, even though it didn’t reach the kind of maturity in usage as is now done. Need to at least go through some basic readings, to understand the science even remotely.
This quote is a good example why conversing with you is a waste of time. You don't pay attention to what you read. I never said Sforza was the founder of genetics, I said he was the founder of genetic archaeology/anthropology.
It doesn't matter if Sforza belongs to the AAPA or ABCD. You are trying to use the fallacy of argument by question.
You are asking questions that have nothing to do with the original thread question: ' race doesn't exist', in an attempt to drag this thread on forever. You will not fool me with fallacy of moving the goal post, in an attempt to make it appear I have not successfully addressed the premise of this thread 'race doesn't exist'.
I will not be duped by this fallacious argument when I have already confirmed that race exist and is part of the linguistics of genetic research.
Due to your frustration in not being able to prove that the sources I have presented are: 1) not written by scientists,2) do not relate to genetic research and 3) were not published in reputable peer reviewed journals you have attempted to make the fallacious argument of burden of proof, by declaring that if I fail to answer a series of questions that have nothing to do with this thread you win this debate by default.
You have fell back on these fallacious arguments because of the fallacy of the general rule.
Since certain organizations (you have affiliated with because they make you feel you are a member of the status quo) have asserted that race no longer exist, you assumed that I would not be able to find researchers/geneticists who continued to use race in biological research.
Because you only read selective biological research you were swayed by the fallacy of authority, into thinking that there could not be any biological literature where geneticist use race. This is surprising because the literature posted in this thread made it clear that some anthropologist and geneticists (especially forensic scientists) continue to see race as a valid variable in genetics research.
This was a fallacy of the general rule because, even in the Templeton paper and a citation by Rasol,it was made clear that "must" but not "all" anthropologists and geneticists believe that race doesn't exist. The fact that there are some researchers who continue to believe that race is a valid variable in biological research meant that the proposition race doesn't exist could be falsified because all biologists have not signed on to this belief. Given this reality it was predicted that I could find biological research in which race was a variable. This prediction was confirmed by the articles I have posted in this thread indicating that race exist in biological research.
I will not allow you to use this special pleading: authorities say race does not exist so it must not exist, to cause the readers of this thread to forget the examples of race in biological research I have discussed previously.
There is no ambiguity in my premise and conclusion. The arguments I have made have been based on reliable premises that race exist, because geneticist and other biologists use race as an important variable in their research; and as a result race exist.
The language in this premise is specific and concrete. And there is a tight connection between the premise: biologists use terms relating to race in their research; and my conclusion: therefore race exist.
I clearly presented definitions of mongoloid , caucasian and black that indicate that these terms refer to races. Sticking to clear meanings for the race terms has allowed me to avoid the classical fallacy of 'equivocation'.
Therefore I will not even pay further attention to your fallacious arguments of 1) authority,2)burden of proof, 3)fallacy of the general rule and 4) argument by question.
I have met the burden of confirmation necessary to falsify the theme of this thread '...Race doesn't exist..the fact that 1) Templeton found that 15% of individual differiation via DNA was accountable to race in 1999; and 2) Tang et al, in a recent study of 3,636 subjects who self-identified their race, found that 95% of the subjects showed genetic cluster membership related to their self-identified race/ethnicity, make it clear that genetics can aggregate individuals by race .
This along with geneticist using racial terms in their research along with Sforza using racial terms to decribe the Dravidian people as caucasian, prove that: Race Exist.
.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Clyde Winters:
This quote is a good example why conversing with you is a waste of time. You don't pay attention to what you read. I never said Sforza was the founder of genetics, I said he was the founder of genetic archaeology/anthropology.
Makes no sense whatsoever.
quote:Clyde:
It doesn't matter if Sforza belongs to the AAPA or ABCD. You are trying to use the fallacy of argument by question.
What is ridiculous is your lack of seriousness, in the hopes to divert attention from lack of material to your baseless claims. In case you are not aware of it, AAPA stands for American Association of Physical Anthropologists. And no, we don't want to know what your "ABCD" means - it is plain jibberish; it shows just how serious you are about your position.
And yes, it does matter if it has been demonstrated that Sforza is part of the AAPA, because we know the AAPA's stand on this issue, and it doesn't bode well for your bogus argument.
quote:Clyde:
You are asking questions that have nothing to do with the original thread question: ' race doesn't exist'
Tell me how asking you to prove that "human races does exist" is not within the realm of the topic of your supposed argument against the claim made in the intro thread about "human races not being scientifically or biologically valid"
quote:Clyde:
in an attempt to drag this thread on forever. You will not fool me with fallacy of moving the goal post, in an attempt to make it appear I have not successfully addressed the premise of this thread 'race doesn't exist'.
Your dancing around without answering the following, will not fool me with your trifling attempt to move the goal post:
Since you've chosen the path of "circular arguments", I will keep pressing for the following:
You make it falsely sound as though Templeton is in any way vindicating you, when it was Templeton's article in the opening notes, that you are supposedly arguing against. Lol.
...and you are using other studies in similar false manner.
A)Name the contemporary geneticists by name, whom YOU claim believe in biological human "races" through your "psycho analysis" of these folks,
B)CITE them on their own admission in their belief in the "existence" of discrete "human races"
C)CITE their work, where they claimed to have proven the concept of "human races",
Last but not least:
d)Show us that the above work, has reached a concensus of approval within the Scientific community!
And oh, btw, the following still stands:
What distinctive genes separate one human "race" from another one. Lay out their names and demonstrate how they are confined to a single "race", which is to be named, along with the groups involved in that race.
Good luck in producing the answers to these requests; you'll need it.
Produce the answers to the aforementioned requests, or be dismissed.
Demonstrate that Sforza isn't part of the AAPA, and that Sforza has proven the concept of human races.
quote:Clyde:
I will not be duped by this fallacious argument when I have already confirmed that race exist and is part of the linguistics of genetic research.
In wonderland you may believe you've confirmed something, but getting back to the real world, you've accomplished zip.
Posted by Tee85 (Member # 10823) on :
If race doesn;t exist then, how do we know that the ancient Egyptian were "black"??? What characteristics would we have to go by to prove that?
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Tee85: If race doesn;t exist then, how do we know that the ancient Egyptian were "black"???
Because their base lineages are of "tropical African" extraction, show strong cranial affinities with contemporary sub-Saharan African groups, and their skeletal remains have demonstrated their "super tropical" body plans. In the African tropics, dark skin is the natural adaptation, not pigmentless or highly low pigmented skin.
quote:Tee85: What characteristics would we have to go by to prove that?
You need to understand that just because it is claimed that "human races" don't exist biologically, that this doesn't mean that there are no genetic or physical variations among humans. Human variation however occurs within and outside populations and ethnic groups. Also, human variation is clinal in nature, which means you cannot form a physical demarcation on the said variations.
Posted by Tee85 (Member # 10823) on :
cool.
Posted by Clyde Winters (Member # 10129) on :
Supercar
quote: quote:Originally posted by Tee85: If race doesn;t exist then, how do we know that the ancient Egyptian were "black"???
Because their base lineages are of "tropical African" extraction, show strong cranial affinities with contemporary sub-Saharan African groups, and their skeletal remains have demonstrated their "super tropical" body plans. In the African tropics, dark skin is the natural adaptation, not pigmentless or highly low pigmented skin.
quote:Tee85: What characteristics would we have to go by to prove that?
You need to understand that just because it is claimed that "human races" don't exist biologically, that this doesn't mean that there are no genetic or physical variations among humans. Human variation however occurs within and outside populations and ethnic groups. Also, human variation is clinal in nature, which means you cannot form a physical demarcation on the said variations.
You are a hypocrite. You also believe race exist. This is supported by the fact that you claim that the Egyptians were black, because their " Because their base lineages are of "tropical African" extraction, show strong cranial affinities with contemporary sub-Saharan African groups, and their skeletal remains have demonstrated their "super tropical" body plans. In the African tropics, dark skin is the natural adaptation, not pigmentless or highly low pigmented skin."
Your correlation of black, a race term, to tropical African body plan and dark skin makes it clear that you are using race to describe a biological phenomena. You can not use a race term to describe biological phenomena, unless 'race exist. Shame on you pretending to defend the notion that race doesn't exist, and then turn around and claim that Sub-Saharan Africans are black, a term that denotes race not population, since people on the Asian continent that live in tropical areas are also highly pigmented.
.
Posted by Clyde Winters (Member # 10129) on :
Supercar
quote: quote:Originally posted by Tee85: If race doesn;t exist then, how do we know that the ancient Egyptian were "black"???
Because their base lineages are of "tropical African" extraction, show strong cranial affinities with contemporary sub-Saharan African groups, and their skeletal remains have demonstrated their "super tropical" body plans. In the African tropics, dark skin is the natural adaptation, not pigmentless or highly low pigmented skin.
quote:Tee85: What characteristics would we have to go by to prove that?
You need to understand that just because it is claimed that "human races" don't exist biologically, that this doesn't mean that there are no genetic or physical variations among humans. Human variation however occurs within and outside populations and ethnic groups. Also, human variation is clinal in nature, which means you cannot form a physical demarcation on the said variations.
Supercar you are a hypocrite. Thanks Tee85 for showing that Supercar is a hypocrite.
You state that "human variation is clinal in nature, which means you cannot form a physical demarcation on the said variations ", yet you declare that you know that the Egyptians were 'blacks" because they live in Sub-Saharan Africa. There are many different populations living in sub-Saharan Africa of Eurasian extraction. To declare the Egyptians were blacks, a racial term because they had a tropical body form and dark skin, knowing full well that European whites live in sub-Saharan Africa: Southwest Africa, Zimbabwe, Kenya,and South Africa, and East Indians live in Sub-Saharan Africa, shows that you believe race is a biological variable.
Here it is you are demanding "proof", that race exist, and then you turn around and agree that the Egyptians were black, because they live in the tropics, have a tropical body shape, and are highly pigmented.
You are no novice in genetic anthropology. You know that if one does not believe in race, they will use neutral terms to refer to populations based on that populations geographical location. There is no scientific reason to claim that the Egyptians were 'black'--a term denoting race, that makes someone declared a black, a Negroid, a subspecies of man.
Your acknowledgement that the Egyptians were "blacks" shows you believe that genetics can classify people into races. This is why I refused to answer any of the questions you recently posted to this forum,because I recognized that they were fallacious arguments.
How dare you attempt to rise the bar in this debate simply so you can make yourself feel you are right when you believe that the Egyptians belonged to the black race, an idea that does not agree with the thread theme: race doesn't exist. Shame on you. Its hypocrites like you who make it clear: Race exist.
Supercar
quote:
quote:Originally posted by Clyde Winters:
This quote is a good example why conversing with you is a waste of time. You don't pay attention to what you read. I never said Sforza was the founder of genetics, I said he was the founder of genetic archaeology/anthropology.
Makes no sense whatsoever.
quote:Clyde:
It doesn't matter if Sforza belongs to the AAPA or ABCD. You are trying to use the fallacy of argument by question.
What is ridiculous is your lack of seriousness, in the hopes to divert attention from lack of material to your baseless claims. In case you are not aware of it, AAPA stands for American Association of Physical Anthropologists. And no, we don't want to know what your "ABCD" means - it is plain jibberish; it shows just how serious you are about your position.
And yes, it does matter if it has been demonstrated that Sforza is part of the AAPA, because we know the AAPA's stand on this issue, and it doesn't bode well for your bogus argument.
quote:Clyde:
You are asking questions that have nothing to do with the original thread question: ' race doesn't exist'
Tell me how asking you to prove that "human races does exist" is not within the realm of the topic of your supposed argument against the claim made in the intro thread about "human races not being scientifically or biologically valid"
quote:Clyde:
in an attempt to drag this thread on forever. You will not fool me with fallacy of moving the goal post, in an attempt to make it appear I have not successfully addressed the premise of this thread 'race doesn't exist'.
Your dancing around without answering the following, will not fool me with your trifling attempt to move the goal post:
Since you've chosen the path of "circular arguments", I will keep pressing for the following:
You make it falsely sound as though Templeton is in any way vindicating you, when it was Templeton's article in the opening notes, that you are supposedly arguing against. Lol.
...and you are using other studies in similar false manner.
A)Name the contemporary geneticists by name, whom YOU claim believe in biological human "races" through your "psycho analysis" of these folks,
B)CITE them on their own admission in their belief in the "existence" of discrete "human races"
C)CITE their work, where they claimed to have proven the concept of "human races",
Last but not least:
d)Show us that the above work, has reached a concensus of approval within the Scientific community!
And oh, btw, the following still stands:
What distinctive genes separate one human "race" from another one. Lay out their names and demonstrate how they are confined to a single "race", which is to be named, along with the groups involved in that race.
Good luck in producing the answers to these requests; you'll need it.
Produce the answers to the aforementioned requests, or be dismissed.
Demonstrate that Sforza isn't part of the AAPA, and that Sforza has proven the concept of human races.
quote:Clyde:
I will not be duped by this fallacious argument when I have already confirmed that race exist and is part of the linguistics of genetic research.
In wonderland you may believe you've confirmed something, but getting back to the real world, you've accomplished zip.
Posted by Tee85 (Member # 10823) on :
Just for the record, I am Black and I do believe the Ancient Egyptians were Black.
My question was a valid one and I did NOT mean for Clyde Winters to take that and ruuuuuuun with it.--No offense Clyde.
Posted by Clyde Winters (Member # 10129) on :
Tee85
quote: Just for the record, I am Black and I do believe the Ancient Egyptians were Black.
My question was a valid one and I did NOT mean for Clyde Winters to take that and ruuuuuuun with it.--No offense Clyde.
No offense taken. I also believe that the Egyptians, Sumerians. Elamites and Dravidians were all members of the Black race.
But it is wrong for someone to jump on people when they use the term 'black' in reference to a race; and then agree with use of the term when they feel like it.
But as I have attempted to point out in this thread many biological researchers constantly refer to race in their writing, just like Supercar did in his response to you. I respect Supercar, and will continue to support his propositions that are supported by the evidence. Frankly, I believe he has "skills".
Having said this, I repeat, the proposition race doesn't exist, can never be totally accepted because of the existence of diversity within and among populations within the same region. As a result, if you are conducting a biological study of individuals in the U.S., you can not refer to the subjects in the study simply as U.S. population, because of the racial diversity within the U.S. population, which has come from diverse geographical regions to settle the U.S.A. To be exact, a scientist will have to examine the individual members of the sample population, and place them into racial categories, so we can see the full spectrum of corellation between genes and specific individuals and groups.
Tee85, you're right, its "cool" that Supercar can "prove" the Egyptians were Black, because Race Exist.
.
Posted by Djehuti (Member # 6698) on :
quote:Originally posted by Clyde Winters: No offense taken. I also believe that the Egyptians, Sumerians. Elamites and Dravidians were all members of the Black race.
All black, but Egyptians are of recent African ancestry while the others are not which is why biological 'racial' groups do not really exist!!
quote:But it is wrong for someone to jump on people when they use the term 'black' in reference to a race; and then agree with use of the term when they feel like it.
Of course it is wrong, because 'black' is NOT a race but a reference to skin color!! Something which your brain simply cannot grasp.
quote:But as I have attempted to point out in this thread many biological researchers constantly refer to race in their writing, just like Supercar did in his response to you. I respect Supercar, and will continue to support his propositions that are supported by the evidence. Frankly, I believe he has "skills".
Nope. Biological researchers refer to specific populations and/or descriptions of certain phyical traits but NOT actual 'races'!
quote:Having said this, I repeat, the proposition race doesn't exist, can never be totally accepted because of the existence of diversity within and among populations within the same region. As a result, if you are conducting a biological study of individuals in the U.S., you can not refer to the subjects in the study simply as U.S. population, because of the racial diversity within the U.S. population, which has come from diverse geographical regions to settle the U.S.A. To be exact, a scientist will have to examine the individual members of the sample population, and place them into racial categories, so we can see the full spectrum of corellation between genes and specific individuals and groups.
Which is why race doesn't exist-- simply because the phenotypical diversity DOES NOT reflect overall ancestry, which is the very definition of race.
Meaning that 'race' does not really exist pure and simple!
I pity you Clyde.
Tee85, you're right, its "cool" that Supercar can "prove" the Egyptians were Black, because Race Exist.
. [/QB][/QUOTE]
Posted by BroG (Member # 10844) on :
I have observed this debate for days and finally feel the need to put in my two cents. I am not nearly as smart or as studied as most of the posters here so I am not going to engage in intellectual debates. But common sense has me strongly suspecting that these scholars who are advocating "no race" theories are simply trying to disempower those who have finally proven that the hated "darker races" were the folk who created civilization. Is it not strange that just as the old racist assumptions have been overturned, particularly about black folk, that now they are crying "race does not exist!" Now that we know that the so called "Nubians" and the so called "'Egyptians" were mostly the same people, a dark race of people, suddenly they want us to stop using the term race. Ultimately I agree we are all part the same race called humanity, but as long as "race" is a historical, social and geopolitical reality, I will still identify as a person of the black African race and study and interpret history from that standpoint. I will not fall into a social politicl trap designed to disempower non-white people when we are suddenly asserting ourselves by telling the truth about our history. While this debate is going on,the mainstream scholarly powers are still devoted, I can assure you, to a race based ideology called "white supremecy." This is the reason for their bald faced lies about the geograpy and population movements in the ancient Nile valley. White Supremacy! I urge the posters on this thread not to fall into this trap. Peace.
Posted by rasol (Member # 4592) on :
quote:But common sense has me strongly suspecting that these scholars who are advocating "no race" theories are simply trying to disempower those who have finally proven that the hated "darker races" were the folk who created civilization
You will never defeat white supremacist racism by advocating race-science with circular arguments and non-sequiturs as Winters has.
Common sense should tell you that.
But let's say it doesn't.
I'm going to play devil's advocate with you, and put your common sense to the test.
You agree with Dr. Winters that race is a science - because of the circular argument that 'race terms' are mentioned in science literature.
Well "IQ" - the theory of innate intelligence as measured in IQ tests also is mentioned in such literature.
In these studies - Blacks have lower IQ's usually much lower than Whites, and Asians.
Therefore, using Dr. Winters 'race-exist' circular argument as the basis of our faux-proof, we can conclude:
the Black race is intellectually inferior to the Asian and the white race.
Correct?
For the Black advocates of race-science.
Here's your trophy: IQ and Race Posted by Djehuti (Member # 6698) on :
^^Then again, folks like Michael, ABE, Evil-Euro, Abozo, and others seem blow up the theory of whites having high IQs! LMFO Posted by rasol (Member # 4592) on :
^ Yes but the flip side is "afrocentrics" so called, who repeat the fallacies of white supremacist scholarship, because they lack the individual creativity to completely rethink crude 'eurocentric' ideas about race.
They remind me of the slaves who, when freed, begin enslaving one another.
Slavery is all they were taught.
So slavery is all they know.
Slavery is mental...not just physical.
Posted by mike rozier (Member # 10852) on :
what if the first people were in the middle east like the Bible says....
and as people left that area thier looks changed? like some people became black because they have been around the equator for so long, and some people became white because they lived up in northern climates.....
but because humans have not been around as long as aminals they haven't evolved as much like a polar bear who has white fur for camoflage, but has black skin to retain heat..
thus amnimals were created before man, thus had a longer time to evole to their different envioroments...
Posted by BroG (Member # 10844) on :
I never said I agreed with Dr. Winters or any of the other mentioned scholars about the race issue. I agree with the ancient dwellers along the Nile who called themselves black, the Kamites. I suspect they had similar social and geopolitical reasons for calling themselves black and it is good enough for me too. On a side note, I don't agree with any IQ test because it is apparent to me that there are other forms of "intelligence" that human beings have access to that cannot be tested by these means. The ancient dwellers on the Nile and other blacks in high civilization apparently had access to these forms of intelligence. Their accomplishments are the proof of this. I do not think they knew these things because of "dark race superiority" but because they were the inheritors of knowledge based upon a certain non-destructive and inclusive way of interacting with nature. A point of view I think is available to all humankind. Oh, and Rasol, the fact that you don't think enemies can be defeated using circular rhetoric shows what should be an embarrasing naivety on your part. I suggest you read a book called "The Price" by Maciavelli. And study the tactics of the Bush administration's Carl Rove. I refuse to give up this power.
Posted by BroG (Member # 10844) on :
Oops, sorry Rasol the book is called "The Prince." And often you do have to use the tactics of your enslavers to set yourself free.
Posted by rasol (Member # 4592) on :
Bro G, i've read Machiavelli's the Prince.
Niccolo Machiavelli believed in using lies as a tactic of statecraft.
And Machiavelli did *not* believe in freedom.
Posted by rasol (Member # 4592) on :
quote:I never said I agreed with Dr. Winters or any of the other mentioned scholars about the race issue.
I'm glad you cleared that up.
quote:I agree with the ancient dwellers along the Nile who called themselves black, the Kamites.
That is absolutely correct.
quote: I suspect they had similar social and geopolitical reasons for calling themselves black and it is good enough for me too.
Nothing wrong with that. Posted by BroG (Member # 10844) on :
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
You will never defeat white supremacist racism by advocating race-science with circular arguments and non-sequiturs as Winters has.
Common sense should tell you that.
But let's say it doesn't.
I'm going to play devil's advocate with you, and put your common sense to the test.
You agree with Dr. Winters that race is a science - because of the circular argument that 'race terms' are mentioned in science literature.
Well "IQ" - the theory of innate intelligence as measured in IQ tests also is mentioned in such literature.
In these studies - Blacks have lower IQ's usually much lower than Whites, and Asians.
Therefore, using Dr. Winters 'race-exist' circular argument as the basis of our faux-proof, we can conclude:
the Black race is intellectually inferior to the Asian and the white race.
Correct?
This is a fallacy of bad analogy. Race is a constant: you are either Negroid, Caucasoid or Mongoloid; IQ on the otherhand can go up or down depending up the base line knowledge of the examinee. There is a myth that IQ is hereditary. An IQ is simpoly a score obtained by an individual in a specific testing situation and on a specific "intelligence" test. As a result, most IQ test fail to measure our intelligence they measure things such as the effect of past learning experience(s). Thusly, because Blacks usually attend poor performing schools that have less vigorous curriculum , may lead to such students having a low IQ.
Race is fixed, If you are Black or white today, you will be Black or white tomorrow. Research makes it clear that IQ is not fixed. In fact Flynn examined data from 14 countries in 1987 found that countries have seen massive gains in IQ in each of these countries over the past 50 years. The ability of these countries to increase IQ is known as the Flynn effect.
The research makes it clear that IQ is related to schools and the learning obtained by the students. This use of argument from spurious similiarity between race and IQ does not prove that race doesn't exist. Race is immutable it does not change. Therefore race exist.
I have presented papers that prove race is a variable in biological research.
: Hum Immunol. 2006 Jan-Feb;67(1-2):73-84. Epub 2006 Apr 5. Related Articles, Links The haplotype structure of the human major histocompatibility complex.Alper CA, Larsen CE, Dubey DP, Awdeh ZL, Fici DA, Yunis EJ.CBR Institute for Biomedical Research, Boston, MA 02115, USA; Department of Pediatrics, Harvard Medical School, Boston, MA 02115, USA.There is great interest in the use of single-nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) analysis to localize human disease genes. The results suggest that the human genome, including the major histocompatibility complex (MHC), consists largely of 5- to 200-kb blocks of sequence fixity between which random recombination occurs. Direct determination of MHC haplotypes from family studies also demonstrates similar-sized blocks, but otherwise gives a very different picture, with a third to a half of Caucasian haplotypes fixed from HLA-B to HLA-DR/DQ (at least 1 Mb) as conserved extended haplotypes (CEHs), some of which encompass more than 3 Mb. These fixed haplotypes differ in frequency both in different Caucasian subpopulations and in Caucasian patients with HLA-associated diseases, complicating disease susceptibility gene localization. The inherent inability of LD analysis to "see" DNA fixity beyond three markers contributes to the failure of SNP/LD analysis to define in detail or even detect CEHs in the MHC and probably elsewhere in the genome. More importantly, the use of statistical analysis, rather than direct haplotype determination and counting, fails to reveal the details of haplotype structure essential for gene localization. Given the oversimplified picture of the MHC (and probably the rest of the genome) provided only by SNP/LD-defined blocks, it is questionable whether this approach will be of great help in disease susceptibility gene localization or identification.
Br J Haematol. 1997 Aug;98(2):356-64. Related Articles, Links
Specificity and sensitivity of RHD genotyping methods by PCR-based DNA amplification.
Aubin JT, Le Van Kim C, Mouro I, Colin Y, Bignozzi C, Brossard Y, Cartron JP.
Centre d'Hemobiologie Perinale, Paris, France.
We have compared the sensitivity and specificity of four PCR methods of RHD gene detection using different sets of primers located in the regions of highest divergence between the RHD and RHCE genes, notably exon 10 (method I), exon 7 (method II), exon 4 (method III) and intron 4 (method IV). Methods I-III were the most sensitive and gave a detectable signal with D-pos/D-neg mixtures containing only 0.001% D-positive cells. Moreover, method II could detect the equivalent DNA amount present in only three nucleated cells in the assay without hybridization of PCR products, whereas the sensitivity of the other methods was 10-50 times less. Investigation of D variants indicated that false-negative results were obtained with method II (D(IVb) variant), method III (D(VI) and DFR variants) and method IV (D(VI) variants), but not method I. Weak D (D(u)) was correctly detected as D-positive by all methods, but most cases of Rh(null) appeared as false-positives, as they carry normal RH genes that are not phenotypically expressed. Some false-positive results were obtained with method I in a few Caucasian DNA samples serotyped as RhD-neg but carrying a C- or E-allele, whereas a high incidence of false-positives was found among non-Caucasian Rh-negative samples by all methods. In the Caucasian population, however, we found a full correlation between the predicted genotype and observed phenotype at birth of 92 infants. Although we routinely use the four methods for RHD genotyping, a PCR strategy based on at least two methods is recommended.
Hum Immunol. 2006 Jan-Feb;67(1-2):125-39. Epub 2005 Nov 4. Related Articles, Links
Disease Relevant HLA Class II Alleles Isolated by Genotypic, Haplotypic, and Sequence Analysis in North American Caucasians With Pemphigus Vulgaris.
Lee E, Lendas KA, Chow S, Pirani Y, Gordon D, Dionisio R, Nguyen D, Spizuoco A, Fotino M, Zhang Y, Sinha AA.
Department of Dermatology, Weill Medical College of Cornell University, New York, NY.
Early studies of genetic susceptibility to pemphigus vulgaris (PV) showed associations between human leukocyte antigen (HLA) DR4 and DR6 and disease. The emergence of DNA sequencing techniques has implicated numerous DRB1 and DQB1 loci in various populations, leading to confusion regarding which exact alleles confer susceptibility. The strong linkage disequilibrium among DR and DQ HLA alleles further complicates the investigation of the true susceptibility loci. In this study, we report genotyping data for the largest sampling of North American Caucasian non-Jewish and Ashkenazi Jewish PV patients studied to date and compare our data with other population studies. To pinpoint true susceptibility, alleles among overrepresented sequences, we applied a step-wise reductionist analysis through (1) determination of the degree of linkage disequilibrium (LD) between purportedly associated alleles, (2) haplotype frequencies comparisons, and (3) primary sequence comparisons of disease-associated versus non-disease-associated alleles to identify crucial differences in amino acid residues in putative peptide binding pockets. Collectively, our data provide extended support for the hypothesis that the HLA associations in Caucasian PV patients map to DRB1*0402 and DQB1*0503 alone. Further structure-function studies will be required to define the exact mechanisms of HLA-mediated control of susceptibility and resistance to disease.
PMID: 16698434 [PubMed - in process]
Ann Hum Genet. 2006 May;70(Pt 3):350-9. Related Articles, Links
A comparison of individual genotyping and pooled DNA analysis for polymorphism validation prior to large-scale genetic studies.
Yang HC, Lin CH, Hung SI, Fann CS.
Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan 115.
Polymorphism validation is an important issue in genetic studies because only polymorphic markers provide useful information. We analyzed genetic data for 180 SNPs in the human major histocompatibility complex region in Caucasian and Taiwanese populations, and evaluated ethnic heterogeneity between these populations to illustrate the importance of polymorphism validation. An initial individual genotyping experiment (IGE) with 95 samples was compared with a DNA pooling allele-typing experiment (PAE) of 630 individuals for polymorphism validation based on authentic data sets. Afterwards, all samples were genotyped individually in a confirmation study. Under narrow (broad) polymorphism criteria, 24 (41) polymorphic SNPs in Caucasians could not be validated in the Taiwanese population, suggesting a 13% (23%) inconsistency rate and revealing a strong discrepancy between genetic backgrounds, probably due to ethnic heterogeneity. IGE yielded high sensitivity and specificity for polymorphism validation, but may be sensitive to sampling variation. PAE showed high sensitivity (97%) and specificity (100%) using a narrow polymorphism criterion, but reduced specificity (83%) using a broad criterion. Public domain polymorphism databases should therefore be used with caution and polymorphism validation should be performed routinely prior to conducting large-scale genetic studies. PAE is a cost-saving, reliable alternative to IGE for polymorphism validation, especially for a stringent polymorphism criterion.
.
Forensic value of the multicopy Y-STR marker DYS464
John M. Butler * , Richard Schoske 1 Biotechnology Division, National Institute of Standards and Technology, Gaithersburg, MD, USA Abstract. The tetranucleotide Y-chromosome short tandem repeat (Y-STR) marker, DYS464, first reported by Redd et al. [Forensic Sci. Int. 130 (2002) 97] appears to be the most polymorphic Y-STR marker discovered to date. A single primer pair can generate up to four distinct peaks over an allele range of 9–20 repeats. Allele calls can be made based on peaks that are present (conservative approach; C-type) or a combination of alleles and peak height ratios (expanded typing method; E- type). We have observed 113 C-types and 179 E-types in 679 males from three US populations. D 2003 Elsevier B.V. All rights reserved. Keywords: Y-STR; Y-chromosome; DYS464; Multicopy loci; DNA typing 1. Introduction DYS464 occurs at least four times in the highly palindromic region near the center of the long arm of the Y-chromosome [1–3]. In forensic casework applications where the amount of typable DNA material may be limited, the use of highly polymorphic markers is advantageous in order to limit the number of markers needed to distinguish unrelated individuals. 2. Materials and methods A total of 679 unique male DNA samples from three different US populations [4] were typed with DYS464 along with 21 additional Y-chromosome short tandem repeat (Y-STR) markers [3]. Only the DYS464 results are described in this report. Two novel DYS464 primer pairs, which differ from those originally described by Redd et al. [2], were used. 0531-5131/ D 2003 Elsevier B.V. All rights reserved. doi:10.1016/S0531-5131(03)01713-8 $ Points of view are those of the authors and do not necessarily represent the position of the US Departments of Justice or Defense. Certain commercial equipment, instruments, and materials are identified in order to specify experimental procedures as completely as possible. In no case does such identification imply a recommendation or endorsement by the National Institute of Standards and Technology, nor does it imply that any of the materials, instruments, or equipment identified are necessarily the best available for the purpose. * Corresponding author. Tel.: +1-301-975-4049; fax: +1-301-975-8505. E-mail address: john.butler@nist.gov (J.M. Butler). 1 Current address: Armed Forces Institute of Pathology, Washington, DC, USA. www.ics-elsevier.com International Congress Series 1261 (2004) 278–280
Page 2 The primers VIC-CTTTGGGCTATGCCTCAGTTT and GCCATACCTGGGTAACAGA- GAGAC produce green-labeled amplicons in the size range of 242–286 bp for DYS464 alleles 9–20, while the primers 6FAM-AGTTTACGAGCTTTGGGCTATG and GTGGCAAGATCTCATTTCTTCAA generate blue dye-labeled polymerase chain reac- tion (PCR) products that are 327–367 bp in size. PCR conditions are as previously described for the Y-STR 20plex [5]. An allelic ladder was created for DYS464 (Fig. 1), which contains all of the major alleles as well as single-base variants observed in our population study [3]. 3. Results and discussion We observed 179 expanded types with DYS464 in 679 male samples from three different US population sets: 265 African–Americans, 262 Caucasians, and 152 His- panics. The addition of peak height information (E-type) to just allele calls (C-type) can result in an expansion in the number of types observed (e.g., Fig. 2). The most common types are 15,15,17,17, which occurs in 10.6% of this data set, and 15,15,16,17, which occurs in 7.5%. All other DYS464 types are found at less than the 5% level, with over half of the observed types occurring only once (92 of 179 observed). If the DYS464 data are collapsed to C-types (conservative typing method), then 113 allele calls are observed in these 679 males. By way of comparison to other DNA typing markers in the same data set, DYS385 exhibited only 56 different types and FGA, the single best autosomal STR examined, had only 78 different genotypes. Furthermore, the four single-copy Y-STRs DYS19, DYS391, DYS392, and DYS393, when combined, only produced 93 different Fig. 1. NIST allelic ladder for DYS464 produced from eight different DNA samples. The variant alleles 14.3, 15.1, and 15.3 are helpful as a tool for measuring single-base resolution in electrophoretic systems. Fig. 2. Example of four samples with the same conservative DYS464 type, 14,15,18, which can be separated from one another by considering their expanded type through peak height variation. J.M. Butler, R. Schoske / International Congress Series 1261 (2004) 278–280 279
Page 3 haplotypes. Thus, DYS464 is more polymorphic than DYS385, the previously considered best multicopy Y-STR, and four single-copy Y-STRs in combination. A human Y- chromosome DNA profiling standard, NIST Standard Reference Material (SRM) 2395, is available and contains DYS464 information on its five male samples (see http:// www.nist.gov/srm). This SRM will enable laboratories worldwide to accurately calibrate their DYS464 typing results. Acknowledgements This work was supported by research funds from the US National Institute of Justice through Interagency Agreement 1999-IJ-R-094 with the NIST Office of Law Enforcement Standards. Much of this work was performed while R.S. was a graduate student at the NIST and the American University through funding from the US Air Force. The technical assistance and suggestions of Peter Vallone, David Duewer, Margaret Kline, and Jan Redman from our group at the NIST and Alan Redd from the University of Arizona are gratefully acknowledged. References [1] J.M. Butler, Recent developments in Y-short tandem repeat and Y-single nucleotide polymorphism analysis, Forensic Sci. Rev. 15 (2003) 91–111. [2] A.J. Redd, A.B. Agellon, V.A. Kearney, T. Karafet, P. de Knijff, H. Park, J.M. Butler, M.F. Hammer, Forensic value of fourteen novel STRs on the human Y chromosome, Forensic Sci. Int. 130 (2002) 97–111. [3] R. Schoske, P.M. Vallone, M.C. Kline, J.W. Redman, J.M. Butler, High-throughput Y-STR typing of U.S. populations with 27 regions of the Y chromosome using two multiplex PCR assays, Forensic Sci. Int. (In press). [4] J.M. Butler, R. Schoske, P.M. Vallone, J.W. Redman, M.C. Kline, Allele frequencies for 15 autosomal STR loci on U.S. Caucasian, African American, and Hispanic populations, J. Forensic Sci. 48 (4) (2003) 908–911. [5] J.M. Butler, R. Schoske, P.M. Vallone, M.C. Kline, A.J. Redd, M.F. Hammer, A novel multiplex for simultaneous amplification of 20 Y chromosome STR markers, Forensic Sci. Int. 129 (2002) 10–24. J.M. Butler, R. Schoske / International Congress Series 1261 (2004) 278–280 280
J Forensic Sci, July 2004, Vol. 49, No. 4 Paper ID JFS2003303 Available online at: www.astm.org Peter M. Vallone,1 Ph.D. and John M. Butler,1 Ph.D. Y-SNP Typing of U.S. African American and Caucasian Samples Using Allele-Specific Hybridization and Primer Extension∗ ABSTRACT: Multiplex analysis of genetic markers has become increasingly important in a number of fields, including DNA diagnostics and human identity testing. Two methods for examination of single nucleotide polymorphisms (SNPs) with a potential for a high degree of multiplex analysis of markers are primer extension with fluorescence detection, and allele-specific hybridization using flow cytometry. In this paper, we examined 50 different SNPs on the Y-chromosome using three primer extension multiplexes and five hybridization multiplex assays. For certain loci, the allele-specific hybridization method exhibited sizable background signal from the absent alternate allele. However, 100% concordance (>2000 alleles) was observed in ten markers that were typed using both methods. A total of 18 unique haplogroups out of a possible 45 were observed in a group of 229 U.S. African American and Caucasian males with the majority of samples being assigned into 2 of the 18 haplogroups. KEYWORDS: forensic science, Y-chromosome, single nucleotide polymorphism, SNP typing, Y-SNPs, SNaPshot, primer extension, Luminex, allele-specific hybridization In recent years, single nucleotide polymorphisms (SNPs) have become more widely used in a variety of applications, including medical diagnostics, population genetics, and human identity testing (1,2). The ability to analyze a number of SNP markers in parallel relies on multiplex amplification and detection formats (3). Two SNP detection formats capable of multiplex analysis are allelespecific primer extension (ASPE) and allele-specific hybridization (ASH), which we use here to examine variation along the Y-chromosome. The lack of recombination along most of the Y-chromosome makes it a useful tool in human evolutionary studies and assessing male migration patterns (4–10). Y-chromosome markers have also been used in attempts to address some interesting historical questions (11,12). Analysis of Y-SNP markers has typically been done with manual techniques such as restriction digestion of PCR products (10,13) or by procedures that can only examine one or two markers simultaneously such as allele-specific PCR (7), denaturing high performance liquid chromatography (5), melting curve analysis (14), and real-time PCR (15). More recently, microarrays (16), time-of-flight mass spectrometry (17), and fluorescent primer extension (10,18) have been applied to Y-SNP analysis in order to type multiple markers in parallel. In an effort to evaluate the usefulness of Y-chromosome SNP markers for human identity applications, we constructed several novel multiplex ASPE assays and utilized a new commercial ASH 1 Biotechnology Division, National Institute of Standards and Technology, Gaithersburg, MD 20899-8311. ∗ Contribution of the U.S. National Institute of Standards and Technology. Certain commercial equipment, instruments, and materials are identified in order to specify experimental procedures as completely as possible. In no case does such identification imply a recommendation or endorsement by the National Institute of Standards and Technology nor does it imply that any of the materials, instruments, or equipment identified are necessarily the best available for the purpose. Received 6 Sept. 2003; and in revised form 21 Dec. 2003, 6 March 2004. accepted 6 March 2004; published XXXX. kit to type 50 Y-SNP markers in more than 200 individuals. In addition, by examining ten of the Y-SNPs with both methods, we were able to assess concordance in more than 2000 allele calls between primer extension and hybridization approaches. Methods U.S. African American and Caucasian DNA Samples Anonymous liquid blood samples with self-identified ethnicities were purchased from Interstate Blood Bank, Inc. (Memphis, TN) and Millennium Biotech, Inc. (Ft. Lauderdale, FL) and extracted using a modified salting out procedure (19). Carll Ladd from the Connecticut Forensic Laboratory (Meriden, CT) kindly provided extracted DNA for 20 U.S. Caucasian and 20 African American samples usedas part of this study. TheextractedDNAwas quantified using ultraviolet (UV) spectrophotometry followed by a PicoGreen assay (20) to adjust concentrations to approximately 1 ng/µL. All samples were examined with 15 autosomal short tandem repeats and the amelogenin sex-typing marker using the AmpF_STR Identifiler Kit to verify that each sample was unique (21). A total of 229 male samples were typed (115 African Americans and 114 Caucasians). Y-SNP Markers A total of 50 Y-chromosome biallelic markers were used to cover all 18 major haplogroups (A-R) recognized by the Y-chromosome consortium (YCC) (22,23). Table 1 contains a summary of the YSNP markers used in this study according to their physical position along theY-chromosome. These positions were identified using amplicon sequences for the 50 Y-SNPs with the BLAST-Like Alignment Tool (BLAT): http://genome.ucsc.edu/cgi-bin/hgBlat. Of the 50 Y-SNPs, 18 was typed by three hexaplex allele specific primer extension assays. An additional set of 42 Y-SNP loci was typed by an ASH assay described below. Ten of the Y-SNP loci probed were redundant between the two sets. Copyright C_ 2004 by ASTM International, 100 Barr Harbor Drive, PO Box C700, West Conshohocken, PA 19428-2959. 723
J Forensic Sci, Mar. 2005, Vol. 50, No. 2 Paper ID JFS2004293 Available online at: www.astm.org TECHNICAL NOTE Margaret C. Kline,1 M.S.; Peter M. Vallone,1 Ph.D.; Janette W. Redman;1 David L. Duewer,2 Ph.D.; Cassandra D. Calloway,3,4 M.S.; and John M. Butler,1 Ph.D. Mitochondrial DNA Typing Screens with Control Region and Coding Region SNPs∗
ABSTRACT: Mitochondrial DNA (mtDNA) analysis has found an important niche in forensic DNA typing. It is used with highly degraded samples or low-copy number materials such as might be found from shed hair or bones exposed to severe environmental conditions. The primary advantage of mtDNA is that it is present in high copy number within cells and therefore more likely to be recovered from highly degraded specimens. A major disadvantage to traditional forensic mtDNA analysis is that it is time-consuming and labor-intensive to generate and review the 610 nucleotides of sequence information commonly targeted in hypervariable regions I and II (HVI and HVII) of the control region. In addition, common haplotypes exist in HVI/HVII mtDNA sequences that can reduce the ability to differentiate two unrelated samples. In this report we describe the utility of two newly available screening assays for rapid exclusion of non-matching samples. The LINEAR ARRAY mtDNA HVI/HVII Region-Sequencing Typing Kit (Roche Applied Science, Indianapolis, IN) was used to type 666 individuals from U.S. Caucasian, African American, and Hispanic groups. Processing of the LINEAR ARRAY probe panels “mito strips” was automated on a ProfiBlot workstation. Observable variation in 666 individuals is reported and frequencies of the mitotypes within and between populations are presented. Samples exhibiting the most common Caucasian mitotype were subdivided with a multiplexed amplification and detection assay using eleven single nucleotide polymorphisms in the mitochondrial genome. These types of screening assays should enable more rapid evaluation of forensic casework samples such that only samples not excluded would be subjected to further characterization through full HVI/HVII mtDNA sequence analysis. KEYWORDS: forensic science, DNA typing, mtDNA, SSO probes, mitochondrial DNA coding region, primer extension For the past decade, DNA sequencing of hypervariable regions I (HVI) and II (HVII) in the control region of mitochondrial DNA (mtDNA) has been useful in forensic casework for the analysis of human remains when nuclear DNA systems fail due to low amounts of DNA or highly degraded specimens (1–3). However, considerable effort and expense are required to develop a full HVI and HVII mtDNA sequence (typically positions 16024–16365 and 1 Biotechnology Division, National Institute of Standards and Technology, Gaithersburg, MD 20899. 2 Analytical Chemistry Division, National Institute of Standards and Technology, Gaithersburg, MD 20899. 3 Department of Human Genetics, Roche Molecular Systems, Alameda, CA 94501. 4 Comparative Biochemistry Group, University of California, Berkeley, CA. ∗ Contribution of the U.S. National Institute of Standards and Technology. Not subject to copyright. Certain commercial equipment, instruments and materials are identified in order to specify experimental procedures as completely as possible. In no case does such identification imply a recommendation or endorsement by the National Institute of Standards and Technology nor does it imply that any of the materials, instruments or equipment identified are necessarily the best available for the purpose. † Parts of this work were presented at the 2003 International Symposium on Human Identification, Phoenix, Arizona, and at the 2004 Annual Meeting of the American Academy of Forensic Sciences, Dallas, Texas. ‡ National Institute of Justice (NIJ) funded this work in part through an interagency agreement with the NIST Office of Law Enforcement Standards and NIJ grant 95-IJ-CX-0014 to Roche Molecular Systems. Received 31 July 2004; and in revised form 16 Oct. 2004; accepted 16 Oct. 2004; published 2 Feb. 2005. 73–340 are examined). Hence, several mtDNA screening methods have been developed (4–9). These screening methods permit rapid resolution of non-matching samples allowing a laboratory to focus more attention on full-sequencing of samples that cannot be resolved from one another with the screening method. Alternatively, laboratories without DNA sequencing capabilities or expertise can perform mtDNAtyping with a screening method and then send only those samples that are not excluded to a private or public laboratory for full HVI/HVII sequencing. This report details a number of inter-related technologies associated with the use of the newly available Linear Array Mitochondrial DNA HVI/HVII Region-Sequence Typing Kit (Roche Applied Science, Indianapolis, IN). The utility of a new microchip CE method for quantifying PCR products that are then hybridized to immobilized sequence specific oligonucleotide (SSO) probes is demonstrated. A semi-automated sample processing method for the Linear Arrays was developed and is demonstrated. The utility of this mtDNA typing kit is demonstrated by differentiating several hundred unrelated individuals from U.S. Caucasian, African American, and Hispanic groups. These results are compared to previous work with similar mtDNA SSO typing probes. The presence of multiple signals within a probe region resulting from sequence heteroplasmy is described as is the absence of signal within a probe region resulting from failed hybridization of PCR products due to additional destabilizing polymorphisms. In addition, a new coding region single nucleotide polymorphism (SNP) assay was employed to help subdivide 51 individuals possessing the most common Caucasian mtDNA haplotype (10,11). Copyright C_ 2005 by ASTM International, 100 Barr Harbor Drive, PO Box C700, West Conshohocken, PA 19428-2959. 377
378 JOURNAL OF FORENSIC SCIENCES Materials and Methods The steps involved in typing the control region SNPs with the mtDNA Linear Arrays are: DNA extraction/quantification, PCR amplification, PCR product quantification, hybridization of the PCR products to the Linear Arrays, detection with colored precipitate, interpretation of results for each sample, comparison of Linear Array results to other samples, and subdividing into groupings. Those samples possessing the most common Caucasian type were also processed with an additional coding region SNP assay as described below. DNA Samples A total of 666 DNA samples that had previously been extracted from whole blood were evaluated in this study. These samples, purchased from Interstate Blood Bank Inc. (Memphis, TN), are assumed to be unrelated and were classified into U.S. Caucasian (N =286), African American (N =252), or Hispanic (N =128) groups based on self-declaration. All samples possess unique STR profiles as determined previously with the AmpF_STR Identifier STR kit (Applied Biosystems, Foster City, CA) (12). Bloods were extracted by a modified “saltout” procedure (13). Portions of the genomic extracts were quantified by UV measurement on a Cary Bio 100 double-beam spectrophotometer (Varian Analytical Instruments, Walnut Creek, CA). Based on the UV/260 quantification, the samples were diluted to a nominal 1 ng/µL (14,15). The concentration of the diluted sample was verified by Pico Green quantitation to be between 0.5 ng/µL and 1.5 ng/µL (16). PCR Amplification One µL of each sample extract (≈1 ng/µL) was amplified using the mtDNA HVI/HVII Primer mix and mtDNA PCR Reaction Mix supplied by Roche Molecular Systems (Alameda, CA) as part of a beta-test of the Linear Array Mitochondrial DNA HVI/HVII Region-Sequence Typing kit. This kit is now available from Roche Applied Sciences (Indianapolis, IN) in the same format as described in this work (catalog number 03-527-867-001). Samples are amplified in a duplex PCR that simultaneously generates PCR products for HVI (positions 15975-16418) and HVII (positions 15–429). The HVI primers amplify an approximately 444 bp PCR product using the following primers: Forward (F15975-15993B) 5_-biotin-CTCCACCATTAGCACCCAA-3_ Reverse (R16418-16401B) 5_-biotin-ATTTCACGGAGGATGGTG-3_ The HVII primers amplify an approximately 416 bp PCR product using the following primers: Forward (F15-34B) 5_-biotin-CACCCTATTAACCACTCACG-3_ Reverse (R429-410B) 5_-biotin-CTGTTAAAAGTGCATACCGC-3_ Since 1 ng of genomic DNA was used rather than the “Kit” recommended 5 pg (based on nuclear DNA quantification), the number of amplification cycles was reduced from the recommended protocol. Whereas the standard protocol calls for 34–38 cycles, only 28 cycles were run in order to yield PCR products in the desired concentration range (see below). The PCR parameters used with a GeneAmp 9700 thermal cycler (Applied Biosystems) were: 94◦C for 14 min, 28 cycles of {92◦C for 15 s, 59◦C for 30 s, and 72◦C for 30 s}, final extension 72◦C for 10 min, and hold at 10◦C until the products could be removed from the thermal cycler. Amplification and typing of 11 SNP sites outside the HVI/HVII Region was performed using the multiplex amplification and allelespecific primer extension assay as previously published (11). These sites include SNPs at positions 3010, 4580, 4793, 5004, 7028, 7202, 10211, 12858, 14470 in the coding region and at positions 477 and 16519 in theVariable Regions (control region outside of HVI/HVII) that help differentiate the most common Caucasian Haplotype (10). Post-PCR Quantification Forty of the PCR products were quantified by loading 4 µL on to an agarose (3% mass NuSieve, 1% mass SeaKem GTG, Cambrex Bio Science Rockland, Inc., Rockland, ME) yield gel stained with ethidium bromide and imaged/analyzed with a FMBIO III plus (MiraiBio Inc., Alameda, CA). A yield gel quantification standard was supplied from Roche Molecular Systems as part of the beta-site test, which is the same as the DNA Molecular Weight Marker XIV 100 bp ladder available from Roche Applied Sciences (catalog number 1-721-933). A DNA Low Mass Ladder (catalog number 10068-013, Invitrogen, Carlsbad, CA) was also used for PCR product size estimation and quantification. All 666 HVI/HVII PCR products were quantified using the Agilent 2100 Bioanalyzer Lab Chip system (Agilent Technologies, Palo Alto, CA) and 1 µL of each PCR product according to the manufacturer’s protocols. The Agilent 2100 standard ladder calibrates for base pair (bp) sizing, and quantification for up to 12 samples per run (17). Two DNA fragments, 15 bp and 1500 bp, are added in each tested sample as internal standards to quantify PCR product amounts. Quantitation results were imported to an Excel spreadsheet in order to calculate the appropriate quantity of the PCR product to add to each Linear Array probe panel. Typically addition of ≈50 ng total amplified product to each probe panel was targeted. Control Region SNP Typing Manufacturer protocols for the Linear Arrays were followed in processing the HVI/HVII PCR products through hybridization to a nylon membrane containing specific probe sequences (Fig. 1). Allele-specific hybridization of the amplified DNA is detected using an enzymatic conversion of a soluble, colorless substrate to a blue-colored precipitate with the detection chemistry originally described by Saiki et al. (18). Cambridge Reference Sequence (19, 20) positions 16093, 16126, 16129, 16270, 16278, 16304, 16309, 16311, and 16362 from HVI and positions 73, 146, 150, 152, 189, 195, 198, 200, and 247 from HVII are probed in this assay. Samples were processed both manually (120 samples) and using a SLT ProfiBlot workstation (Tecan US, Research Triangle Park, NC) (remaining 446 samples). Steps in the developed Profiblot protocol are listed in Table 1. All reagents required for processing are pre-loaded onto the Tecan Profiblot. Up to 24 probe panels can be processed simultaneously in a 2 h run. The wash solution is placed in a heated/stirred heat block to maintain the required 55◦C temperature for hybridization. After the Linear Array probe panels are added to the tray, the Profiblot SLT instrument dispenses the
Mitochondrial DNA: Coding Region SNP Assay Development
Participants: Peter M. Vallone, Michael D. Coble, Margaret C. Kline, and John M. Butler (AFDIL participants: Rebecca Just and Thomas Parsons)
Project Timeframe: 2001 to present
Purpose: The development of multiplex primer extension assays to probe coding region mitochondrial SNPs to help resolve common mitotypes.
Progress: The typing of single nucleotide polymorphisms (SNPs) located throughout the mitochondrial genome (mtGenome) allows for differentiation between individuals possessing an identical HV1/HV2 sequence. A set of 11 SNPs selected for distinguishing individuals of the most common Caucasian HV1/HV2 mitotype were incorporated in an allele-specific primer extension assay. The 11-plex assay probed SNPs located at positions 477, 3010, 4580, 4793, 5004, 7028, 7202, 10211, 12858, 14470 and 16519 in the mtGenome. The assay was optimized for multiplex detection of these SNPs. Primers were designed to allow for the simultaneous polymerase chain reaction (PCR) amplification of 11 unique regions in the mtGenome. Locus specific primers of varying lengths were employed in multiplex primer extension reactions. Extension primers binding 5’ adjacent to the SNP site of interest were enzymatically extended using fluorescently labeled dideoxynucleotides (ddNTPs). Resolution and detection of each extended fragment were achieved by analysis on a capillary-based electrophoresis (CE) platform. The electrophoretic mobility for the extension primers was compared in denaturing POP4 and POP6 CE running buffers. Empirical adjustment of extension primer concentrations resulted in even signal intensity for the 11 loci probed. The development of the mtSNP 11-plex assay has resulted in an accurate method for typing sequence variant mtSNPs on a platform common to forensic laboratories.
We are currently developing additional multiplex SNP panels to resolve other common mitotypes (Caucasian, Hispanic, and African American).
Publications Resulting From This Project: Kline, M.C., Vallone, P.M., Redman, J.W., Duewer, D.L., Calloway, C.D., and Butler, J.M. (2005) Mitochondrial DNA typing screens with control region and coding region SNPs. J. Forensic Sci. 50(2): 377-385.
Just, R.S., Irwin, J.A., O'Callaghan, J.E., Saunier, J.L., Coble, M.D., Vallone, P.M., Butler, J.M., Barritt, S.M., and Parsons, T.J. (2004) Toward increased utility of mtDNA in forensic identifications. Forensic Sci. Int. 146S: S147-S149.
Vallone, P.M., Just, R.S., Coble, M.D., Butler, J.M., and Parsons, T.J. (2004) A multiplex allele-specific primer extension assay for forensically informative SNPs distributed throughout the mitochondrial genome. Int. J. Legal Med. 118: 147-157.
Coble, M.D., Just, R.S., O'Callaghan, J.E., Letmanyi, I.H., Peterson, C.T., Irwin, J.A., Parsons, T.J. (2004) Single nucleotide polymorphisms over the entire mtDNA genome that increase the power of forensic testing in Caucasians. Int. J. Legal Med. 118: 137-146.
.
.
Posted by *Topdog* (Member # 10328) on :
I disagree, terms like Mongoloid, Negroid Caucasoid are worthless because they're all based on so-called "idealized" stereotypical perceptions. These perceptions are arbitrary and do not denote discrete peoples. Race wasn't based on genes, it was based originally on visual observation without respect to human variation as well as typological thinking. Those who didn't fit within a certain type were demed mixed, which gave way to fallacious postualtions like this for example:
Carleton Coon,"The Living Races of Man", 1965
p.121
"The Somalis and Dankalis are closely related and be considered as a unit...Both are essentially Caucasoid, but in different ways."
p.122
"In northern Nigeria are the Hausa, a numerous and widespread people who are skilled craftsmen and clever traders. Beyond them and among them are the Fula or Peul, and the related Fulani, a cattle people who have invaded the agricultural regions of the western Sudan, founded dynasties, and had been overthrown from time to time. All of them are Caucasoids in a sense and somewhat Negroid."
p.123
"This evidence suggests that the Negroes are not a primary subspecies but rather a product of mixture between invading Caucasoids and Pygmies who lived on the edge of the the forest, which at the end of the Pleistocene extended farther north and east than it does now."
Of course all of this has been debunked, human variation is clinal, therefore race(s)[which are discrete biological units with boundaries] does not exist. Clyde I await your response to this.
Posted by rasol (Member # 4592) on :
quote: Race is a constant: you are either Negroid, Caucasoid or Mongoloid;
Really?
Interesting.
What happens if one has 'Mongoloid' father and a 'Caucazoid' mother?
What then?
Mixed, hybrid? But those are variables aren't they, and not constants?
Posted by rasol (Member # 4592) on :
quote: If you are Black or white today, you will be Black or white tomorrow
Fascinating information you are disseminating Dr. Winters.
So skin color isn't subject to enviromental selection, as anthropologists have been telling us?
Does that mean that the ancestors of whites were "always white?"
Skin color defines race?
Posted by rasol (Member # 4592) on :
quote:The research makes it clear that IQ is related to schools and the learning obtained by the students.
Research also shows that skin color is related to exposure to sunlight and tanning, doesn't stop people from relating skin color to 'race'.
So, why not relate intelligence to race?
quote: This use of argument from spurious similiarity between race and IQ does not prove that race doesn't exist.
lol. didn't say it did.
I stated that every [bad] argument you make, for the 'scientific reality of race', can be made to the effect of the 'scientific reality of race & IQ.
This is why your arguments are so easy to refute Dr. Winters.
We've heard them before....
quote: Therefore, using Dr. Winters 'race-exist' circular argument as the basis of our faux-proof, we can conclude:
the Black race is intellectually inferior to the Asian and the white race.
Correct?
For the Black advocates of race-science.
Here's your trophy: IQ and Race
^ Dr. Winters believes in race as and immutable constant of biology, but doesn't want to accept any 'studies' on 'racial' differences that have and unpleasant outcome.
Winters argues for division of humans into racial sub-species that are 'separate' but 'equal'.
Does this ring a bell-curve, anyone?
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Clyde Winters:
You are a hypocrite. You also believe race exist.
You are illiterate, for coming to that conclusion. My statement doesn't support the notion on "human races". This is the same antic you've used to make it seem that Templeton's comment was justifying your bogus claims, when in fact Templeton conclusion belies your claims.
quote:Clyde:
This is supported by the fact that you claim that the Egyptians were black, because their " Because their base lineages are of "tropical African" extraction, show strong cranial affinities with contemporary sub-Saharan African groups, and their skeletal remains have demonstrated their "super tropical" body plans. In the African tropics, dark skin is the natural adaptation, not pigmentless or highly low pigmented skin."
And so? How does that support your bogus claim?
quote:Clyde:
Your correlation of black, a race term,
"Black" here, is in reference to visible levels of skin pigmentation, that darkens the skin. It doesn't justify your wishful thinking. Next!
quote:Clyde:
to tropical African body plan and dark skin makes it clear that you are using race to describe a biological phenomena.
How does it suggest "race"? It is a physical adaptation to the tropics, but doesn't represent all the variations indigenous to tropical regions. Africa is not the only landmass, which has regions in the tropics. Next!
quote:Clyde:
You can not use a race term to describe biological phenomena, unless 'race exist.
I easily refuted your premises for 'psycho analyzing' me, as you claim to be doing with other folks here. No term has been used here to denote "race". Your premises has been swiftly falsified.
quote:Clyde:
Shame on you pretending to defend the notion that race doesn't exist, and then turn around and claim that Sub-Saharan Africans are black, a term that denotes race not population, since people on the Asian continent that live in tropical areas are also highly pigmented.
Shame on you for not being able to read what people are stating, and then using your incomprehension of what was said, to set up your blatant bogus claims.
Yep, those requests still stand. Posted by Clyde Winters (Member # 10129) on :
Rasol
quote: quote: If you are Black or white today, you will be Black or white tomorrow
Fascinating information you are disseminating Dr. Winters.
So skin color isn't subject to enviromental selection, as anthropologists have been telling us?
Does that mean that the ancestors of whites were "always white?"
Skin color defines race?
This is a fallacy of extension (straw man) argument. The geneticist in this paper especially Tang et all indicate that genes can aggregate individuals according to race.
.
Posted by rasol (Member # 4592) on :
^ Actually there is no 'fallacy', but rather only questions for you. Questions you didn't even try to answer, as usual
The questions pertained to your claim that race is a constant.
It's a staggeringly sweeping claim.
I couldn't extend it even if I wanted to. So accusing me of extending your claim does not provide you with and excuse for not answering.
Posted by rasol (Member # 4592) on :
quote:Originally posted by Clyde Winters:
You are a hypocrite. You also believe race exist.
quote:SuperCar writes: My statement doesn't support the notion on "human races". This is the same antic you've used to make it seem that Templeton's comment was justifying your bogus claims, when in fact Templeton's conclusion belies your claims.
I'm still waiting for answers as well. It is true that Dr. Winters resort to antics when he doesn't have answers.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by rasol: ^ Actually there is no 'fallacy', but rather only questions for you. Questions you didn't even try to answer, as usual
Lol. You are probably in for a long wait.
Posted by Clyde Winters (Member # 10129) on :
[b] You are a hypocrite. The term black can only refer to people who belong to the negroid race.
There are many people in the tropics with very dark skin that are not called black. This makes your excuse a sad expression of a person who has betrayed his belief in race while he argues otherwise.
Supercar
quote: quote:Originally posted by Clyde Winters:
You are a hypocrite. You also believe race exist.
You are illiterate, for coming to that conclusion. My statement doesn't support the notion on "human races". This is the same antic you've used to make it seem that Templeton's comment was justifying your bogus claims, when in fact Templeton conclusion belies your claims.
quote:Clyde:
This is supported by the fact that you claim that the Egyptians were black, because their " Because their base lineages are of "tropical African" extraction, show strong cranial affinities with contemporary sub-Saharan African groups, and their skeletal remains have demonstrated their "super tropical" body plans. In the African tropics, dark skin is the natural adaptation, not pigmentless or highly low pigmented skin."
And so? How does that support your bogus claim?
quote:Clyde:
Your correlation of black, a race term,
"Black" here, is in reference to visible levels of skin pigmentation, that darkens the skin. It doesn't justify your wishful thinking. Next!
quote:Clyde:
to tropical African body plan and dark skin makes it clear that you are using race to describe a biological phenomena.
How does it suggest "race"? It is a physical adaptation to the tropics, but doesn't represent all the variations indigenous to tropical regions. Africa is not the only landmass, which has regions in the tropics. Next!
quote:Clyde:
You can not use a race term to describe biological phenomena, unless 'race exist.
I easily refuted your premises for 'psycho analyzing' me, as you claim to be doing with other folks here. No term has been used here to denote "race". Your premises has been swiftly falsified.
quote:Clyde:
Shame on you pretending to defend the notion that race doesn't exist, and then turn around and claim that Sub-Saharan Africans are black, a term that denotes race not population, since people on the Asian continent that live in tropical areas are also highly pigmented.
Shame on you for not being able to read what people are stating, and then using your incomprehension of what was said, to set up your blatant bogus claims.
Yep, those requests still stand.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote: quote:Originally posted by Clyde Winters:
You are a hypocrite. You also believe race exist.
quote:SuperCar writes: My statement doesn't support the notion on "human races". This is the same antic you've used to make it seem that Templeton's comment was justifying your bogus claims, when in fact Templeton's conclusion belies your claims.
I'm still waiting for answers as well. It is true that Dr. Winters resort to antics when he doesn't have answers.
/
First of all Supercar is a hypocrite. He showed in his conversation with Tee85, that he believes in race.
Rasol in your post on the Templeton statement that guides this thread you claim that it can only be refuted by answering the following questions:
Rasol
quote: 1) show us that different SNP markers can be used to systematically classify populations into races.
2) list the geneticist who support this theory with direct, clear statements to the effect that this is so.
3) present a study classifying Dravidians and Africans into a distinct race based upon specific SNP markers.
But this is uncessary because they were not part of Templeton's statement. But I will answer them anyway.
1) show us that different SNP markers can be used to systematically classify populations into races.
It is not necessary to provide any specific SNP markers used to systematically classify populations into races. Research studies published by geneticists clearly indicate that they continue to use race to describe poulations in the research literature as I have pointed out in previous post that I will repose below.
[/b]
: Hum Immunol. 2006 Jan-Feb;67(1-2):73-84. Epub 2006 Apr 5. Related Articles, Links The haplotype structure of the human major histocompatibility complex.Alper CA, Larsen CE, Dubey DP, Awdeh ZL, Fici DA, Yunis EJ.CBR Institute for Biomedical Research, Boston, MA 02115, USA; Department of Pediatrics, Harvard Medical School, Boston, MA 02115, USA.There is great interest in the use of single-nucleotide polymorphisms (SNPs) and linkage disequilibrium (LD) analysis to localize human disease genes. The results suggest that the human genome, including the major histocompatibility complex (MHC), consists largely of 5- to 200-kb blocks of sequence fixity between which random recombination occurs. Direct determination of MHC haplotypes from family studies also demonstrates similar-sized blocks, but otherwise gives a very different picture, with a third to a half of Caucasian haplotypes fixed from HLA-B to HLA-DR/DQ (at least 1 Mb) as conserved extended haplotypes (CEHs), some of which encompass more than 3 Mb. These fixed haplotypes differ in frequency both in different Caucasian subpopulations and in Caucasian patients with HLA-associated diseases, complicating disease susceptibility gene localization. The inherent inability of LD analysis to "see" DNA fixity beyond three markers contributes to the failure of SNP/LD analysis to define in detail or even detect CEHs in the MHC and probably elsewhere in the genome. More importantly, the use of statistical analysis, rather than direct haplotype determination and counting, fails to reveal the details of haplotype structure essential for gene localization. Given the oversimplified picture of the MHC (and probably the rest of the genome) provided only by SNP/LD-defined blocks, it is questionable whether this approach will be of great help in disease susceptibility gene localization or identification.
Br J Haematol. 1997 Aug;98(2):356-64. Related Articles, Links
Specificity and sensitivity of RHD genotyping methods by PCR-based DNA amplification.
Aubin JT, Le Van Kim C, Mouro I, Colin Y, Bignozzi C, Brossard Y, Cartron JP.
Centre d'Hemobiologie Perinale, Paris, France.
We have compared the sensitivity and specificity of four PCR methods of RHD gene detection using different sets of primers located in the regions of highest divergence between the RHD and RHCE genes, notably exon 10 (method I), exon 7 (method II), exon 4 (method III) and intron 4 (method IV). Methods I-III were the most sensitive and gave a detectable signal with D-pos/D-neg mixtures containing only 0.001% D-positive cells. Moreover, method II could detect the equivalent DNA amount present in only three nucleated cells in the assay without hybridization of PCR products, whereas the sensitivity of the other methods was 10-50 times less. Investigation of D variants indicated that false-negative results were obtained with method II (D(IVb) variant), method III (D(VI) and DFR variants) and method IV (D(VI) variants), but not method I. Weak D (D(u)) was correctly detected as D-positive by all methods, but most cases of Rh(null) appeared as false-positives, as they carry normal RH genes that are not phenotypically expressed. Some false-positive results were obtained with method I in a few Caucasian DNA samples serotyped as RhD-neg but carrying a C- or E-allele, whereas a high incidence of false-positives was found among non-Caucasian Rh-negative samples by all methods. In the Caucasian population, however, we found a full correlation between the predicted genotype and observed phenotype at birth of 92 infants. Although we routinely use the four methods for RHD genotyping, a PCR strategy based on at least two methods is recommended.
Hum Immunol. 2006 Jan-Feb;67(1-2):125-39. Epub 2005 Nov 4. Related Articles, Links
Disease Relevant HLA Class II Alleles Isolated by Genotypic, Haplotypic, and Sequence Analysis in North American Caucasians With Pemphigus Vulgaris.
Lee E, Lendas KA, Chow S, Pirani Y, Gordon D, Dionisio R, Nguyen D, Spizuoco A, Fotino M, Zhang Y, Sinha AA.
Department of Dermatology, Weill Medical College of Cornell University, New York, NY.
Early studies of genetic susceptibility to pemphigus vulgaris (PV) showed associations between human leukocyte antigen (HLA) DR4 and DR6 and disease. The emergence of DNA sequencing techniques has implicated numerous DRB1 and DQB1 loci in various populations, leading to confusion regarding which exact alleles confer susceptibility. The strong linkage disequilibrium among DR and DQ HLA alleles further complicates the investigation of the true susceptibility loci. In this study, we report genotyping data for the largest sampling of North American Caucasian non-Jewish and Ashkenazi Jewish PV patients studied to date and compare our data with other population studies. To pinpoint true susceptibility, alleles among overrepresented sequences, we applied a step-wise reductionist analysis through (1) determination of the degree of linkage disequilibrium (LD) between purportedly associated alleles, (2) haplotype frequencies comparisons, and (3) primary sequence comparisons of disease-associated versus non-disease-associated alleles to identify crucial differences in amino acid residues in putative peptide binding pockets. Collectively, our data provide extended support for the hypothesis that the HLA associations in Caucasian PV patients map to DRB1*0402 and DQB1*0503 alone. Further structure-function studies will be required to define the exact mechanisms of HLA-mediated control of susceptibility and resistance to disease.
PMID: 16698434 [PubMed - in process]
Ann Hum Genet. 2006 May;70(Pt 3):350-9. Related Articles, Links
A comparison of individual genotyping and pooled DNA analysis for polymorphism validation prior to large-scale genetic studies.
Yang HC, Lin CH, Hung SI, Fann CS.
Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan 115.
Polymorphism validation is an important issue in genetic studies because only polymorphic markers provide useful information. We analyzed genetic data for 180 SNPs in the human major histocompatibility complex region in Caucasian and Taiwanese populations, and evaluated ethnic heterogeneity between these populations to illustrate the importance of polymorphism validation. An initial individual genotyping experiment (IGE) with 95 samples was compared with a DNA pooling allele-typing experiment (PAE) of 630 individuals for polymorphism validation based on authentic data sets. Afterwards, all samples were genotyped individually in a confirmation study. Under narrow (broad) polymorphism criteria, 24 (41) polymorphic SNPs in Caucasians could not be validated in the Taiwanese population, suggesting a 13% (23%) inconsistency rate and revealing a strong discrepancy between genetic backgrounds, probably due to ethnic heterogeneity. IGE yielded high sensitivity and specificity for polymorphism validation, but may be sensitive to sampling variation. PAE showed high sensitivity (97%) and specificity (100%) using a narrow polymorphism criterion, but reduced specificity (83%) using a broad criterion. Public domain polymorphism databases should therefore be used with caution and polymorphism validation should be performed routinely prior to conducting large-scale genetic studies. PAE is a cost-saving, reliable alternative to IGE for polymorphism validation, especially for a stringent polymorphism criterion.
2) list the geneticist who support this theory with direct, clear statements to the effect that this is so.
This question was already answered above when I provided the published papers where racial terms such as caucasian is frequently used for the "white'" race. Use of the term caucasian is a clear statement to the effect race continues to play a role in the research of geneticists as proven by the papers discussed above.
3) present a study classifying Dravidians and Africans into a distinct race based upon specific SNP markers.
You already mentioned one the Cavelli Sforza study.
Clyde Winters
quote::I have never read where the geneticists have claimed that the Dravidians were Caucasian.
Rasol
quote: Cavelli Sforza has claimed this.
Since Sforza classifies the Dravidians as caucasian proves that geneticists use racial terms to describe populations. It refutes Templeton's claim that
If their is no distinct subdivision of humanity into races:
1)why do geneticists continue to use racial terms in their research and even Sforza call the Dravidians caucasians?
2) How did Templeton find that 15% of genetic variation could be traced to what could be interpreted as "racial" differences
3) How did that 95% of people in the Tang et al study show genetic cluster membership related to their self-identified race/ethnicity.
The answer is: Race exist.
Posted by Djehuti (Member # 6698) on :
^^MORE ACCURATE Answer: Of course 'race' exists but only as a social concept, not a biological one!
A perfect example would be reason why Sforza identified Dravidians as 'caucazoid'. Why were Egyptians also classified as 'caucazoids'? What exactly is a 'caucazoid', or a 'negroid', but groups based on specious or semantical phenotypic traits. There are no true divisions based on such traits, as folks have shown on this forum and to YOU Clyde ad-nasium!! Posted by Clyde Winters (Member # 10129) on :
Supercar
quote:
quote:Originally posted by rasol: ^ Actually there is no 'fallacy', but rather only questions for you. Questions you didn't even try to answer, as usual
Lol. You are probably in for a long wait.
I answered Rasol question back on page 3 and above. But I will never discuss the issue: race doesn't exist with you. You have already shown that you believe race exist. Your fallacious arguments have no standing before me. You attempt to call me illiterate, when it was you, who wrote the following:
Supercar
quote: quote:Originally posted by Tee85:
If race doesn;t exist then, how do we know that the ancient Egyptian were "black"???
Supercar quote:
Because their base lineages are of "tropical African" extraction, show strong cranial affinities with contemporary sub-Saharan African groups, and their skeletal remains have demonstrated their "super tropical" body plans. In the African tropics, dark skin is the natural adaptation, not pigmentless or highly low pigmented skin.
quote:Tee85: What characteristics would we have to go by to prove that?
You need to understand that just because it is claimed that "human races" don't exist biologically, that this doesn't mean that there are no genetic or physical variations among humans. Human variation however occurs within and outside populations and ethnic groups. Also, human variation is clinal in nature, which means you cannot form a physical demarcation on the said variations.
Clyde quote:
You are a hypocrite. You also believe race exist. This is supported by the fact that you claim that the Egyptians were black, " Because their base lineages are of "tropical African" extraction, show strong cranial affinities with contemporary sub-Saharan African groups, and their skeletal remains have demonstrated their "super tropical" body plans. In the African tropics, dark skin is the natural adaptation, not pigmentless or highly low pigmented skin."
Your correlation of black, a race term, to tropical African body plan and dark skin makes it clear that you are using race to describe a biological phenomena. You can not use a race term to describe biological phenomena, unless 'race exist.
Shame on you pretending to defend the notion that race doesn't exist, and then turn around and claim that Sub-Saharan Africans are black, a term that denotes race not population, since people on the Asian continent that live in tropical areas are also highly pigmented.
.
Posted by rasol (Member # 4592) on :
quote:Winters: I answered Rasol question back on page 3 and above.
Nope. The question pertained your comments on 'this page'.
But don't worry, I don't expect you to answer. No one does anymore.
Posted by Clyde Winters (Member # 10129) on :
^fallacious argument by emotive language
Posted by rasol (Member # 4592) on :
^ non answer, by Clyde Winters,(tm.) Posted by Supercar (Member # 6477) on :
quote:Originally posted by Clyde Winters:
You are a hypocrite. The term black can only refer to people who belong to the negroid race.
There are many people in the tropics with very dark skin that are not called black. This makes your excuse a sad expression of a person who has betrayed his belief in race while he argues otherwise.
You are illiterate, for coming to that conclusion. My statement doesn't support the notion on "human races". This is the same antic you've used to make it seem that Templeton's comment was justifying your bogus claims, when in fact Templeton conclusion belies your claims.
Posted by alTakruri (Member # 10195) on :
Colour and national/geographic ethnonyms employed before the 16th century can't possibly refer to race. Before the Triangular Trade there simply was no notion of race nor did the word race refer to anything other than a contest of speed.
I may post some on how the ancients divied up humanity they knew about. But first a word from times much nearer to our own.
Posted by Djehuti (Member # 6698) on :
quote:Originally posted by Clyde Winters:
You are a hypocrite. The term black can only refer to people who belong to the negroid race.
There are many people in the tropics with very dark skin that are not called black. This makes your excuse a sad expression of a person who has betrayed his belief in race while he argues otherwise.
So tell me Clyde, is this person here black?
And what about this person?
And what exactly constitutes this 'negroid race'??..
Posted by alTakruri (Member # 10195) on :
quote: I could wish the distinctions between the human species, that have been made from a laudable zeal for systematic science, not be carried beyond due bounds. Some for instance have thought fit to employ the word races for four or five divisions, originally made on the basis of country or complexion: but I see no reason for this appelation.
Race refers to a difference of origin, which in our case simply does not exist, or in each of these countries, and under each of these complexions, comprises the most different races. In short, there are neither four or five races, nor exclusive varieties, on this earth.
Complexions blend into each other; forms follow the genetic character; and, on the whole, all are at last but shades of the same great picture, extending over all ages and over all parts of the earth.
J. G. Herder Ideen zur Philosophie der Geschichte der Menschheit Carlsrue: C. G. Schmieder, 1794
Posted by alTakruri (Member # 10195) on :
As Herder wrote back in 1794, humanity has looked on itself in terms of country or complexion without thought of genetic race.
The ancient Egyptians noted two distinctions of complexion: black (km) and red (dshr). The people along the Nile clear up to its sources and between the Nile and the Red Sea were blacks (KM.t.nwt), while those west of the Nile and east or northeast of the Red Sea were reds (DSHR.t.nwt).
The RT RMTW saw what we today call Afrisan speakers as blacks and reds, a designation still used throughout Africa by Africans when generalizing for their people and the Arabs use the same terminology.
The RT RMTW explicitly classed themselves and the NHHSW to their south as blacks, and the TMHHW and A3MW immediately bordering them as reds.
Thus the ancient Egyptians divied up humanity by complexion and noted the cardinal angle of other folks' locales. They had no race concept.
Posted by alTakruri (Member # 10195) on :
Another ancient people the Hebrews per their sacred literature viewed humanity as a single family from one "great great grandfather", and one father's three sons. Two of those sons Shem and Hham were black, the other was Yapheth was white.
Shem was black and beautiful, Hham was black like the raven, and Yapheth was entirely white.
The earth was alotted to them and their offspring recognized as families languages and lands.
The ancient Hebrews and their inheritors the Israelites and "Jews" had no concept of race. They saw what was there to see and heard what was there to hear: colour, kinship, speech, nationality/geographic locale.
Posted by alTakruri (Member # 10195) on :
Not quite as ancient are the Greeks. How much of their philosophy of humanity is original or echoes of the East Mediterranean and the Nile Valley remains moot.
We know they saw an at least black and white world that had something to do with geography. For instance they noticed folk on the either side of the Nile stretching to the sunrise and sunset were black whether their hair was straight or wooly.
Straight haired blacks must have been an anomally to those Greeks who beleived the tripartate colour myth of Phaeton's chariot ride.
The youth couldn't control the path of his father's chariot (the Sun) whose horses swayed to near the south and veered to far from the north permanently altering the complexions of the folk toward those geographic extremes leaving Mediterraneans with the, to them, "just right" colour.
No idea of race for them. Just colour and the natural geography of where those colours were.
Posted by alTakruri (Member # 10195) on :
I understand that other folk all over the world have a myth similar to that of the Greeks to the effect that the Creator molded human forms out of clay and placed them like bread in an oven to bake to finished perfection.
The first set were in too long and burned black. Fearing to burn the second set, they were removed too soon retaining dough white colour. The third attempt produced the "just right" baked bread colour.
Do these myths mention race? Just looks like complexions to me.
Posted by rasol (Member # 4592) on :
It is in the ancient Greek views on purity and essentialism that we find some of the philosophical roots of western notions of race - and racism.
Posted by alTakruri (Member # 10195) on :
I don't have a clue as to what Pacific Asians say about the physical variance of humanity. What was once believed about India seems to have undergone a swift political correctness campaign as now most Indians in the west deny there ever was an Aryan people or literal varna/colorocracy or hated flat nosed Dasyus and such. Supposedly our translations of the Laws of Manu are badly wrought and there is no such saying as: "Ones not to be trusted; a black Brahmin, a white Dalit."
I guess if there ever were Aryans they were no more than Iranis. I don't know how much colour has to do with it since the Irani homelands, or at least the northern parts thereof, only had light skinned peoples but the Zoroastrians are hypercircumspect about miscegenation and who's elegible to be a convert.
Are we approaching the origins of what would become race, i.e., the idea of human sub-species ranked from superior to inferior judged so by colour, hair, nose, lips and the environment of the geographic locale that engenders the "wrong" examples of those features?
Posted by Djehuti (Member # 6698) on :
quote:Originally posted by alTakruri: I don't have a clue as to what Pacific Asians say about the physical variance of humanity. What was once believed about India seems to have undergone a swift political correctness campaign as now most Indians in the west deny there ever was an Aryan people or literal varna/colorocracy or hated flat nosed Dasyus and such. Supposedly our translations of the Laws of Manu are badly wrought and there is no such saying as: "Ones not to be trusted; a black Brahmin, a white Dalit."
I for one can vouch for Asians. In the Philippines, we recognize light-skinned folk, dark-skinned folk, and blacks which are usually the Aytas or 'Negrito' groups.
Unfortunately because of Spanish influence as well as current Western influence, some if not many folks in the Philippines have gotten into the skin-lightening craze. This all started with trying to look Mestiza (having Spanish ancestry) but now done to look more like northern Asians like Chinese and Koreans.
I don't know too much about Indian traditional beliefs but they too have it bad with the whole fair-skinned craze.
quote:I guess if there ever were Aryans they were no more than Iranis. I don't know how much colour has to do with it since the Irani homelands, or at least the northern parts thereof, only had light skinned peoples but the Zoroastrians are hypercircumspect about miscegenation and who's elegible to be a convert.
Ironically the Iranians took over the power and civilization that belonged to the black Elamites. Where are the Elamites now?? I have only seen a few pictures showing the remnants of these people. Pretty scary.
quote:Are we approaching the origins of what would become race, i.e., the idea of human sub-species ranked from superior to inferior judged so by colour, hair, nose, lips and the environment of the geographic locale that engenders the "wrong" examples of those features?
What do you mean "approaching" this has already happened. What we are doing now is correcting all of this nonsense.
Posted by Clyde Winters (Member # 10129) on :
Great post Takruri your history of race is very interesting.
I just wanted to add a few points. It would appear that some ancient people believed that the original man was created black. This suggest that these people felt environment had little if anything to do with race.
The Sumerian literature make it clear that the gods were suppose to have created man from "clay". Since clay is usually black or red it was only natural for man to be black. This may have been the reason that the Sumerians called themselves: sag-gig-ga "black heads".
The Assyro-Babylonians called the entire Babylonian population Salmat Kakkadi black heads also.
Akkadian
The Quran and Bible also claim that the first man Adam, was made of clay. The fact that clay is black may have led these ancient people to refer to themselves as Black heads, since they were created Black like the soil.
The Greek word Ethiop 'black face", may be related to the Sumerian name for Sumerians: 'Black Heads' .
.
Posted by Mansa Musa (Member # 6800) on :
Dr. Winters,
I would like to hear your opinion on race and intelligence.
I'm sure you are familiar with the Bell Curve and Rushton's work.
You believe that race is a scientific fact, what are your opinions on the measurement of intelligence using IQ tests and the results above?
Posted by rasol (Member # 4592) on :
^ My purpose for posting the above [originally] was tactical.
I want the naive potential 'afrocentrists' to witness that Winters is of *no use* to them when the real battle for liberty and equality against racism and tyranny is enjoined.
Winters vs. white supremacist racism is a fight that will never happen, because Winters ducks that fight.
He is too busy trying to bully Blacks into his 'radical' Afrocentrism, which in turn, reduces African history to anti-scientific, anti-intellectual ridiculousness, whose root assumptions are based upon the pseudo-scientific fallacies of white racism to the begin with.
Winters is mere fodder for the likes of Rushton/Murray, etc..
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote: ^ My purpose for posting the above [originally] was tactical.
I want the naive potential 'afrocentrists' to witness that Winters is of *no use* to them when the real battle for liberty and equality against racism and tyranny is enjoined.
Winters vs. white supremacist racism is a fight that will never happen, because Winters ducks that fight.
He is too busy trying to bully Blacks into his 'radical' Afrocentrism, which in turn, reduces African history to anti-scientific, anti-intellectual ridiculousness, whose root assumptions are based upon the pseudo-scientific fallacies of white racism to the begin with.
Winters is mere fodder for the likes of Rushton/Murray, etc..
Rasol you're full of it. I have been writing on education issues for years. I usually present four papers or more a year at National education conferences.
In addition, I have published numerous articles in education journals and several chapters in books. My most recent book is Brain Based Learning and Special Education.
I am a consultant for school districts, and one of the educators who wrote the Social Science Standards for the Chicago Public Schools. I also wrote the Guided Lesson Plans, used to teach World History in the CPS.
In addition I have trained many teachers in teaching Afrocentric social science in the Chicago area.
I.Q test are not an issue. It is well known in education that IQ are dependent on learning. This is why very few school districts employ IQ test to evaluate their students.
I am not trying to make anyone an Afrocentricist.
I am about truth. I have probably done more to further Afrocentrism, and education than many members of this forum.
As I have shown in this thread in my discussion of genes and race I am far from anti-intellectual,or the fodder for anyone. My research is always supported by citations.
I am a man. Instead of hiding on this forum annymously, I have presented my research to National and International Linguistics and Anthropology Conference. How many papers have you delivered Rasol on Eb3 or whatever gene being an "African" gene?
You're just upset that Tang's ability to correlate genes and race prove that one of your pet theories is not supported by the evidence.
For the record, please post us a vita of your published articles in the fight against racism...we would all like to see how you are engaged in the struggle.
.
Posted by rasol (Member # 4592) on :
^ lol, lol, lol. Dr. Winters response is useless, as expected.
Something useful from Stephen Gould:
Posted by rasol (Member # 4592) on :
Something else, useless By Dr Winters....
quote:You're just upset that Tang's ability to correlate genes and race.
Winters is corrected again, with something useful.....
In an attempt to buttress claims for the biological relevance of race, Rowe (2005) placed considerable emphasis on the interpretation by some geneticists of the cluster analysis of Rosenberg et al. (2002; see Risch, Bur-chard, Ziv, & Tang, 2002)
Unfortunately, the article by D. Rowe (2005, this issue, see record 2005-00117-007) begins from mistaken premises and merely restates the racialist view using the terminology of molecular genetics.
Race is not a concept that emerged from within modern genetics; rather, it was imposed by history, and its meaning is inseparable from that cultural origin. By ignoring its cultural meaning the reductionist narrative about race fails--both in the narrow terms of science and as a contribution to the broader social discourse.
quote:You're just upset that Tang's ability to correlate genes and race.
Winters is corrected again, with something useful.....
In an attempt to buttress claims for the biological relevance of race, Rowe (2005) placed considerable emphasis on the interpretation by some geneticists of the cluster analysis of Rosenberg et al. (2002; see Risch, Bur-chard, Ziv, & Tang, 2002)
Unfortunately, the article by D. Rowe (2005, this issue, see record 2005-00117-007) begins from mistaken premises and merely restates the racialist view using the terminology of molecular genetics.
Race is not a concept that emerged from within modern genetics; rather, it was imposed by history, and its meaning is inseparable from that cultural origin. By ignoring its cultural meaning the reductionist narrative about race fails--both in the narrow terms of science and as a contribution to the broader social discourse.
Race and IQ: Molecular genetics as deus ex machina.
This paper has nothing to do with Tang et al. The Tang et al paper was published in 2005 not 2002
Am J Hum Genet. 2005 Feb;76(2):268-75. Epub 2004 Dec 29. Related Articles, Links
Genetic structure, self-identified race/ethnicity, and confounding in case-control association studies.
Tang H, Quertermous T, Rodriguez B, Kardia SL, Zhu X, Brown A, Pankow JS, Province MA, Hunt SC, Boerwinkle E, Schork NJ, Risch NJ.
Division of Public Health Sciences, Fred Hutchinson Cancer Research Center, Seattle, WA, USA.
We have analyzed genetic data for 326 microsatellite markers that were typed uniformly in a large multiethnic population-based sample of individuals as part of a study of the genetics of hypertension (Family Blood Pressure Program). Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic) and were recruited from 15 different geographic locales within the United States and Taiwan. Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories. Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity. On the other hand, we detected only modest genetic differentiation between different current geographic locales within each race/ethnicity group. Thus, ancient geographic ancestry, which is highly correlated with self-identified race/ethnicity--as opposed to current residence--is the major determinant of genetic structure in the U.S. population. Implications of this genetic structure for case-control association studies are discussed.
PMID: 15625622 [PubMed - indexed for MEDLINE]
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
Race is not a concept that emerged from within modern genetics; rather, it was imposed by history, and its meaning is inseparable from that cultural origin. By ignoring its cultural meaning the reductionist narrative about race fails--both in the narrow terms of science and as a contribution to the broader social discourse.
Race and IQ: Molecular genetics as deus ex machina.
I may take some time today to track down this article Race and IQ. The concept of correlating race, IQ and genetics seems outlandish to me. This is due to the fact that IQ is not associated with biology, it is associated with learning and intelligence.
Intelligence is related to nurture not nature. There are a number of myths associated with IQ
1. Each person has a fixed IQ
2.High IQ's guarantee success
3.IQ is inherited
You have to remember that intelligence are used for prediction. They determine if an individual will be able to perform a speccific task, which require a specific form of intelligence.
As a result IQ is simply a score someone obtains in a "specific testing situation" on a specific "intelligence test". IQ test lack perfect validity because they measure things other than intelligence, especially the effects of past experience.
We no that IQ can not be inherited, because IQ is not fixed. Flynn Effect makes it clear that an individuals baseline intelligence can change overtime. This makes it clear that the amount of learning obtained by the leaner will directly influence that learners IQ.
Most IQ test only measure academic ability. They tell us nothing about a persons practical intelligence, social intelligence, emotion, adaptive skills and motivation. Since academic skills are mastered in school, IQ can not be correlated with genes.
Most importantly, we should remember that IQ tests are culturally biased they favor children with similar backgrounds to the sample the test was normed on. Given these facts I don't see how any one can correlate IQ with genes.
Unanswered Questions (back to outline) The report concludes with a summary, which in turn concludes with a list of "unanswered questions" about intelligence (these questions are taken verbatim from a Web-based version of the report): 1. Differences in genetic endowment contribute substantially to individual differences in (psychometric) intelligence, but the pathway by which genes produce their effects is still unknown. The impact of genetic differences appears to increase with age, but we do not know why. 2. Environmental factors also contribute substantially to the development of intelligence, but we do not clearly understand what those factors are or how they work. Attendance at school is certainly important, for example, but we do not know what aspects of schooling are critical. 3. The role of nutrition in intelligence remains obscure. Severe childhood malnutrition has clear negative effects, but the hypothesis that particular "micro-nutrients" may affect intelligence in otherwise adequately-fed populations has not yet been convincingly demonstrated. 4. There are significant correlations between measures of information processing speed and psychometric intelligence, but the overall pattern of these findings yields no easy theoretical interpretation. 5. Mean scores on intelligence tests are rising steadily. They have gone up a full standard deviation in the last fifty years or so, and the rate of gain may be increasing. No one is sure why these gains are happening or what they mean. 6. The differential between the mean intelligence test scores of Blacks and Whites (about one standard deviation, although it may be diminishing) does not result from any obvious biases in test construction and administration, nor does it simply reflect differences in socio-economic status. Explanations based on factors of caste and culture may be appropriate, but so far have little direct empirical support. There is certainly no such support for a genetic interpretation. At present, no one knows what causes this differential. 7. It is widely agreed that standardized tests do not sample all forms of intelligence. Obvious examples include creativity, wisdom, practical sense and social sensitivity; there are surely others. Despite the importance of these abilities we know very little about them: how they develop, what factors influence that development, how they are related to more traditional measures.
As a result of public confusion about the meaning of "race," claims as to major biological differences among "races" continue to be advanced.
Stemming from past AAA actions designed to address public misconceptions on race and intelligence, the need was apparent for a clear AAA statement on the biology and politics of race that would be educational and informational.
Rather than wait for each spurious claim to be raised, the AAA Executive Board determined that the Association should prepare a statement for approval by the Association and elicit member input.
From its inception, this modern concept of "race" was modeled after an ancient theorem of the Great Chain of Being, which posited natural categories on a hierarchy established by God or nature.
Thus "race" was a mode of classification linked specifically to peoples in the colonial situation.
It subsumed a growing ideology of inequality devised to rationalize European attitudes and treatment of the conquered and enslaved peoples.
Proponents of slavery in particular during the 19th century used "race" to justify the retention of slavery.
The ideology magnified the differences among Europeans, Africans, and Indians, established a rigid hierarchy of socially exclusive categories underscored and bolstered unequal rank and status differences, and provided the rationalization that the inequality was natural or God-given.
The different physical traits of African-Americans and Indians became markers or symbols of their status differences.
Ultimately "race" as an ideology about human differences was subsequently spread to other areas of the world.
It became a strategy for dividing, ranking, and controlling colonized people used by colonial powers everywhere.
But it was not limited to the colonial situation. In the latter part of the 19th century it was employed by Europeans to rank one another and to justify social, economic, and political inequalities among their peoples. During World War II, the Nazis under Adolf Hitler enjoined the expanded ideology of "race" and "racial" differences and took them to a logical end: the extermination of 11 million people of "inferior races" (e.g., Jews, Gypsies, Africans, homosexuals Posted by alTakruri (Member # 10195) on :
I wrote on what ancients saw basically as colour variation and geographic regions where humans of varying complexion was found and that they had no conception of race.
I don't know about Bible, but from the Hebrew book, B*rei'shiyth, only someone who has no idea of the meaning of the Hebrew word 'adham (אָדָם) could propose it means either clay or black.
This response piles one incomprehension upon another.
quote:Originally posted by Clyde Winters: Great post Takruri your history of race is very interesting.
. . . .
... Bible also claim that the first man Adam, was made of clay. The fact that clay is black ...
Posted by Clyde Winters (Member # 10129) on :
Takruri
quote: I wrote on what ancients saw basically as colour variation and geographic regions where humans of varying complexion was found and that they had no conception of race.
I don't know about Bible, but from the Hebrew book, B*rei'shiyth, only someone who has no idea of the meaning of the Hebrew word 'adham (אָדָם) could propose it means either clay or black.
This response piles one incomprehension upon another.
quote: -------------------------------------------------------------------------------- Originally posted by Clyde Winters: Great post Takruri your history of race is very interesting.
. . . .
... Bible also claim that the first man Adam, was made of clay. The fact that clay is black ... --------------------------------------------------------------------------------
Takruri 'Adham does mean Black.I am surprised that you didn't recognize this fact by the addition of -ham, to the 'ad-.
The Bible Dictionary makes it clear that Adam was associated with dust [clay] and is the generic name for man.
Origin and Meaning of the Name Adham Add Adham to favorites for boys. (0) Have a friend named Adham? Email him this page.
The boy's name Adham is of Arabic origin, and its meaning is "black." Also variant of Adam.
For more information, see also the related name Damek. Search for names similar to Adham starting with Ad- or ending with -am, -ham, -dham, -adham.
Adham is a rare male first name as it was not ranked for males of all ages in the 1990 U.S. Census. Adham is a common surname, ranking 53186 out of 88799 for people of all ages in the 1990 U.S. Census.
quote: Adam - red, a Babylonian word, the generic name for man, having the same meaning in the Hebrew and the Assyrian languages. It was the name given to the first man, whose creation, fall, and subsequent history and that of his descendants are detailed in the first book of Moses (Gen. 1:27-ch. 5). "God created man [Heb., Adam] in his own image, in the image of God created he him; male and female created he them."
Adam was absolutely the first man whom God created. He was formed out of the dust of the earth (and hence his name), and God breathed into his nostrils the breath of life, and gave him dominion over all the lower creatures (Gen. 1:26; 2:7). He was placed after his creation in the Garden of Eden, to cultivate it, and to enjoy its fruits under this one prohibition: "Of the tree of the knowledge of good and evil thou shalt not eat of it; for in the day that thou eatest thereof thou shalt surely die."
Posted by alTakruri (Member # 10195) on :
1). What is race (biologically)?
2). How many biologically defined races are there?
3). List the names of these biologically defined races.
Posted by alTakruri (Member # 10195) on :
Even though you didn't use a Hebrew dictionary to properly do it, thank you for providing a citation that proves 'adham means red not black.
To say your cited reference supports 'adham means black displays a deliberate willful attempt to twist the easy, plain, and obviously comprehensible truth to fit a priori idealogy.
The response also shows complete ignorance of Hebrew grammar and lexicon as adam is a triliteral root (aleph-daledh-mem sofit) not a compound of ad and ham. There is no h in adam. I used dh to approximate the soft d (daledh without a dagesh).
Not only that, but neither ad nor ham mean black in the Hebrew language. Whatever languages you do know, you do not know Hebrew. You should quit pretending that you do.
The other point, clay is not dust. Nor does the Hebrew word 'adhamah (אֲדָמָה) bear any connotation of the word clay.
quote:Originally posted by Clyde Winters: Takruri
'Adham does mean Black. I am surprised that you didn't recognize this fact by the addition of -ham, to the 'ad-.
The Bible Dictionary makes it clear that Adam was associated with dust [clay] and is the generic name for man.
quote: [/b]Adam - red, a Babylonian word, the generic name for man, having the same meaning in the Hebrew and the Assyrian languages. ... Adam ... was formed out of the dust of the earth[b] (and hence his name), ...
Posted by Clyde Winters (Member # 10129) on :
Takruri
quote: Even though you didn't use a Hebrew dictionary to properly do it, thank you for providing a citation that proves 'adham means red not black.
You read the post wrong. Adam can be interpreted as red. 'Adham means 'black'. See below
Origin and Meaning of the Name Adham Add Adham to favorites for boys. (0) Have a friend named Adham? Email him this page.
The boy's name Adham is of Arabic origin, and its meaning is "black." Also variant of Adam.
.
Posted by Clyde Winters (Member # 10129) on :
Commentary
Nature Genetics 36, S13 - S15 (2004) Published online: ; | doi:10.1038/ng1436 What we do and don't know about 'race', 'ethnicity', genetics and health at the dawn of the genome era
Francis S Collins National Human Genome Research Institute, National Institutes of Health, Bethesda, Maryland 20892, USA. fc23a@nih.gov
A true understanding of disease risk requires a thorough examination of root causes. 'Race' and 'ethnicity' are poorly defined terms that serve as flawed surrogates for multiple environmental and genetic factors in disease causation, including ancestral geographic origins, socioeconomic status, education and access to health care. Research must move beyond these weak and imperfect proxy relationships to define the more proximate factors that influence health.
A small meeting convened at the National Human Genome Center at Howard University in Washington, D.C., on 15 May 2003, titled "Human Genome Variation and 'Race': The State of the Science," marked an important, positive milestone in the turbulent history of genetics, race and ethnicity. Experts in sociology, anthropology, history and genetics gathered together to discuss, in an honest and unemotional way, the substance of what we know and what we don't know about the connections between genetics and race. The few meetings held in the past decade to discuss this highly charged topic have often been unsatisfactory, either because participants with strong opinions tended to talk past each other or, more commonly, because heightened sensitivity to the possibility of giving inadvertent offense caused those present to speak only in politically correct generalities. As a historically black university, Howard University served science and society by sponsoring this frank discussion, and the National Human Genome Center's leaders are to be congratulated for their vision in putting together such a thought-provoking agenda at a time when large amounts of new information about human genetic variation are coming to light. Many of the salient points made by participants in this meeting were captured in the preceding articles.
The meeting at Howard University focused on exactly the right questions. What does the current body of scientific information say about the connections among race, ethnicity, genetics and health? What remains unknown? What additional research is needed? How can this information be applied to benefit human health? How might this information be applied in nonmedical settings? How can we adopt policies that will achieve beneficial societal outcomes?
Is race biologically meaningless? First, it is essential to point out that 'race' and 'ethnicity' are terms without generally agreed-upon definitions. Both terms carry complex connotations that reflect culture, history, socioeconomics and political status, as well as a variably important connection to ancestral geographic origins. Well-intentioned statements over the past few years, some coming from geneticists, might lead one to believe there is no connection whatsoever between self-identified race or ethnicity and the frequency of particular genetic variants1, 2. Increasing scientific evidence, however, indicates that genetic variation can be used to make a reasonably accurate prediction of geographic origins of an individual, at least if that individual's grandparents all came from the same part of the world3. As those ancestral origins in many cases have a correlation, albeit often imprecise, with self-identified race or ethnicity, it is not strictly true that race or ethnicity has no biological connection. It must be emphasized, however, that the connection is generally quite blurry because of multiple other nongenetic connotations of race, the lack of defined boundaries between populations and the fact that many individuals have ancestors from multiple regions of the world.
Race and health disparities What about health disparities? Are genetic differences between populations likely to have a role in health status, both in the US and around the world? In many instances, the causes of health disparities will have little to do with genetics, but rather derive from differences in culture, diet, socioeconomic status, access to health care, education, environmental exposures, social marginalization, discrimination, stress and other factors4. Yet it would be incorrect to say that genetics never has a role in health disparities. This is most obvious in the unequal distribution of disease-associated alleles for certain recessive disorders, such as sickle cell disease or Tay-Sachs disease, but has also been noted recently for certain nonmendelian disorders, such as Crohn disease5.
The question of whether genetics will explain a substantial proportion of health disparities for most common diseases is largely unanswered and will be clarified only by further research studies of many populations. Given that the frequency of many genetic variants is not equal in all parts of the world6, however, genetic variations conferring disease susceptibility are expected to be unequally distributed, at least in some cases.
Finding common ground A vigorous debate has raged in the scientific and medical literature over the last few years about whether there is any value in using self-identified race or ethnicity to identify factors that contribute to health or disease7, 8. Proponents of maintaining such identifiers argue that even if the genetic component of health disparities is small, self-identified race or ethnicity is also a useful proxy for other correlated nongenetic variables, and to lose the opportunity to explore these would be doing a disservice to the public. Detractors argue that race and ethnicity are such flawed concepts that the persistent use of such descriptors prolongs the delay in seeking real causes and lends more scientific validity to the race-health connection than it deserves.
After reviewing these arguments and listening to the debate during the meeting at Howard University, one could conclude that both points are correct. The relationship between self-identified race or ethnicity and disease risk can be depicted as a series of surrogate relationships (Fig. 1). On the nongenetic side of this diagram, race carries with it certain social, cultural, educational and economic variables, all of which can influence disease risk. On the genetic side of the diagram, race is an imperfect surrogate for ancestral geographic origin, which in turn is a surrogate for genetic variation across an individual's genome. Likewise, genome-wide variation correlates, albeit with far-from-perfect accuracy, with variation at specific loci associated with disease. Those variants interact with multiple environmental variables, with the ultimate outcome being health or disease.
Figure 1. Interconnections between self-identified race or ethnicity and health status.
The undeniable existence of health disparities indicates that there is a correlation between self-identified race or ethnicity and health or disease in some cases. But this is a complex and poorly understood relationship. On the left side of the diagram, multiple environmental factors that are influenced by race and ethnicity, and that potentially contribute to health disparities, are depicted. On the right side, the potential genetic contribution to health disparities, which operates through a series of proxy relationships, is depicted. To unravel the real causes, research into health disparities must move beyond weakly correlated variables, such as self-identified race or ethnicity, towards an understanding of the more proximate environmental and genetic factors.
Full Figure and legend (34K)
Considered in this context, it is apparent why self-identified race or ethnicity might be correlated with health status, through genetic or nongenetic surrogate relationships or a combination of the two. It is also evident that a true understanding of disease risk requires us to go well beyond these weak and imperfect proxy relationships. And if we are not satisfied with the use of imperfect surrogates in trying to understand hereditary causes, then we should not be satisfied with them as measures of environmental causation either.
What additional research is needed? The recent National Human Genome Research Institute's "Vision for the Future of Genomics Research"9 outlined a bold agenda for the future, including a number of compelling research opportunities. The meeting at Howard University underscored the importance of additional research in certain crucial areas:
(i) Without discounting self-identified race or ethnicity as a variable correlated with health, we must strive to move beyond these weak surrogate relationships and get to the root causes of health and disease, be they genetic, environmental or both.
(ii) To determine accurate risk factors for disease, we need to carry out well-designed, large-scale studies in multiple populations. Such studies must be equally rigorous in their collection of genetic and environmental data. If only genetic factors are considered, only genetic factors will be discovered.
(iii) To validate quantitative conclusions about genes, environment and their interactions in health and disease for multiple groups, long-term, longitudinal prospective cohort studies, as well as carefully designed case-control studies, will be needed10.
(iv) We must continue to support efforts to define the nature of human variation across the world, focused primarily on medical goals. The International Human Haplotype Map Project11 will open a new window into human variation and generate a powerful tool for discovering disease associations, but the project will provide a resource, not all of the answers.
(v) We need more anthropological, sociological and psychological research into how individuals and cultures conceive and internalize concepts of race and ethnicity.
(vi) We must assess how the scientific community uses the concepts of race and ethnicity and attempt to remedy situations in which the use of such concepts is misleading or counterproductive.
(vii) We need to formulate clear, scientifically accurate messages to educate researchers, health-care professionals and the general public on the connections among race, ethnicity, genetics and health.
Conclusion The individuals attending the meeting at Howard University represented a group of highly informed and sophisticated thinkers. Many participants had spent more than a decade trying to untangle these complicated concepts. A substantial degree of consensus was achieved regarding what we currently know, but it was impossible to escape the fact that substantial gaps in our current knowledge remain. Therefore, the research and the conversation must continue.
In that vein, the National Human Genome Research Institute convened a Roundtable on Race, Ethnicity, and Genetics on 8−10 March 2004, which was attended by a wide range of thought leaders in genetics, anthropology, sociology, history, law and medicine. A report of that meeting is being prepared for publication. The National Human Genome Research Institute is also sponsoring a consortium of funded investigators, known as the Genetic Variation Consortium (http://www.genome.gov/10001551), which is striving to address many of these unanswered questions.
Much remains to be done, but the meeting at Howard University set the stage for a new era of interdisciplinary inquiry into the challenging topic of race and genetics, an era characterized by openness, freedom of scientific inquiry, an appreciation of history and a respect for differing points of views. It would be naive to portray these early steps as a breakthrough, but the committed efforts of the band of scholars and thinkers involved in these discussions are a good start in that direction.
Received 9 August 2004; Accepted 3 September 2004; Published online: 26 October 2004.
Top
REFERENCES Angier, N. Do races differ? Not really, genes show. The New York Times Aug. 22, F1 (2000). Marshall, E. DNA studies challenge the meaning of race. Science 282, 654−655 (1998). | Article | Rosenberg, N.A. et al. Genetic structure of human populations. Science 298, 2381−2385 (2002). | Article | Sankar, P. et al. Genetic research and health disparities. JAMA 291, 2985−2989 (2004). | Article | Inoue, N. et al Lack of common NOD2 variants in Japanese patients with Crohn's disease. Gastroenterology 123, 86−91 (2002). | Article | Bamshad, M., Wooding, S., Salisbury, B.A. & Stephens, J.C. Deconstructing the relationship between genetics and race. Nat. Rev. Genet. 5, 598−608 (2004). | Article | Cooper, R.S., Kaufman, J.S. & Ward, R. Race and genomics. N. Engl. J. Med. 348, 1166−1170 (2003). | Article | Burchard, E.G. et al The importance of race and ethnic background in biomedical research and practice. N. Engl. J. Med. 348, 1170−1175 (2003). | Article | Collins, F.S., Green, E.D., Guttmacher, A.E. & Guyer, M.S. A vision for the future of genomics research: A blueprint for the genomic era. Nature 422, 835−847 (2003). | Article | Collins, F.S. The case for a U.S. prospective cohort study of genes and environment. Nature 429, 475−477 (2004). | Article | The International HapMap Consortium. The International HapMap Project. Nature 426, 789−796 (2003). | Article |
Posted by alTakruri (Member # 10195) on :
I didn't read anything wrong. You and thinkbabynames don't know what you're talking about.
However, whatever Bible Dictionary you used did give the correct translation of the Hebrew language into English.
The Hebrew word אָדָם is the English word red. Comprehend?
Not even worth arguing about. Anyone who knows how to use a Hebrew-English dictionary can confirm this as easy as 1-2-3.
Posted by alTakruri (Member # 10195) on :
Please explain in your own words:
1). What is race (biologically)?
2). How many biologically defined races are there?
3). List the names of these biologically defined races.
Please do not cut and paste an entire article. If needed, brief quotes will do. Giving the URL for further reading is fine.
Posted by Clyde Winters (Member # 10129) on :
If we look at the research of Tang et al,2005 and the National Human Genome Research Institutes of Health Meeting at Howard University: "What we do and don't know about race..." we can easily answer Takruri's questions
COMMENTARY
quote: Nature Genetics 36, S13 - S15 (2004) Published online: ; | doi:10.1038/ng1436 What we do and don't know about 'race', 'ethnicity', genetics and health at the dawn of the genome era Francis S Collins National Human Genome Research Institute, National Institutes of Health, Bethesda, Maryland 20892, USA. fc23a@nih.gov
After reviewing these arguments and listening to the debate during the meeting at Howard University, one could conclude that both points are correct. The relationship between self-identified race or ethnicity and disease risk can be depicted as a series of surrogate relationships (Fig. 1). On the nongenetic side of this diagram, race carries with it certain social, cultural, educational and economic variables, all of which can influence disease risk. On the genetic side of the diagram, race is an imperfect surrogate for ancestral geographic origin, which in turn is a surrogate for genetic variation across an individual's genome. Likewise, genome-wide variation correlates, albeit with far-from-perfect accuracy, with variation at specific loci associated with disease. Those variants interact with multiple environmental variables, with the ultimate outcome being health or disease.
quote:
Am J Hum Genet. 2005 Feb;76(2):268-75. Epub 2004 Dec 29. Related Articles, Links
Genetic structure, self-identified race/ethnicity, and confounding in case-control association studies.
Tang H, Quertermous T, Rodriguez B, Kardia SL, Zhu X, Brown A, Pankow JS, Province MA, Hunt SC, Boerwinkle E, Schork NJ, Risch NJ.
Division of Public Health Sciences, Fred Hutchinson Cancer Research Center, Seattle, WA, USA.
We have analyzed genetic data for 326 microsatellite markers that were typed uniformly in a large multiethnic population-based sample of individuals as part of a study of the genetics of hypertension (Family Blood Pressure Program). Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic) and were recruited from 15 different geographic locales within the United States and Taiwan. Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories. Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity. On the other hand, we detected only modest genetic differentiation between different current geographic locales within each race/ethnicity group. Thus, ancient geographic ancestry, which is highly correlated with self-identified race/ethnicity--as opposed to current residence--is the major determinant of genetic structure in the U.S. population. Implications of this genetic structure for case-control association studies are discussed.
PMID: 15625622 [PubMed - indexed for MEDLINE]
Having reviewed these papers we can not answer Takruri's questions:
quote:
1). What is race (biologically)?
2). How many biologically defined races are there?
3). List the names of these biologically defined races.
1) Following the research discussed above biologically speaking race is the genetic cluster analysis of the microsatellite markers which showed near-perfect correspondence with the four self-reported race/ethnicity categories.
2)In the United States the genetic research indicates that there are four biological races recognizied through the genetic markers corresponding to self-reported race/ethnicity categories.
3) The four biological racial/ethnic groups recognized in the United States are: white, African American, East Asian, and Hispanic.
.
Posted by alTakruri (Member # 10195) on :
I asked for an explanation in your own words which you refused to provide.
So I take your stance is that throughout all time and over the entire planet
* there are four biologically defined races
* the names of the biologically defined races are __ white __ African American __ East Asian __ Hispanic
Am I correct and is that what you hold to be true?
If not then please explain in your own words:
1). What is race (biologically)?
2). How many biologically defined races are there?
3). List the names of these biologically defined races.
Also I reject the definition of biological race you provided because a definition of a word cannot contain the word being defined.
Biological race cannot be self-identified race because the selves identifying their race are neither scientists nor used scientific means of ascertaining their self-identified race. What they did use as identifiers were USA socially constructed races based on * a colour for one * a nationality for another * a geographic locale for the third * a language for the last
For consistency either colour, nationality, geography or language should've been allowed across the board by all resondents.
Not to mention that Amerinds, Kooris (Australia), Indians, Twa, and other populations can be assigned to neither of the four.
Posted by Clyde Winters (Member # 10129) on :
Takruri
quote:
Biological race cannot be self-identified race because the selves identifying their race are neither scientists nor used scientific means of ascertaining their self-identified race. What they did use as identifiers were USA socially constructed races based on * a colour for one * a [b]nationality[b] for another * a geographic locale for the third * a language for the last
Why not you discuss genetics and you're not a geneticist.
It becomes biological in the United States because genetic research indicates that there are four biological races recognizied through the genetic markers corresponding to self-reported race/ethnicity categories.
This biological reality was determined through scientific means, since the researchers found genetic markers correlating with the four races. You can not find genetic markers if you do not use scientific methods.
The ability to find genetic markers associated with these self-reported race/ethnicity categories confirms the existence of these races.
Takruri
quote:
I have shown earlier the confusion that arises when trying to objectively qualify a Spaniard, an African in the Americas, and a Filipino to one and only one of these self-identified races.
Not to mention that Amerinds, Kooris (Australia), Indians, Twa, and other populations can be assigned to neither of the four.
I wasn't talking about these groups I was talking about people in the United States. The diversity of these groups make it clear that they may not engage the categories for these races/ethnic groups in the United States.
It is fine to say that we should look at individuals based upon their geographical location: Asian, African,and Eurasian (Eastern vs Western). But this is impossible in the United States where there is no homogenous population to represent the archtypical African, Eurasian and etc.
Here we have various ethnic groups from various regions of the world,who over time have been engaged in population admixture as the various nationalities mated here in the U.S. Thus making it impossible to assign one archtypical individual to represent the United States Region, as opposed to the African, Asian, Eurasian regions.
The fact that the Tang et al study , indicated that there are four biological races recognizied through the genetic markers corresponding to self-reported race/ethnicity categories,makes it clear that race exist. This is supported by the health research which suggest that different races are effected differently by illnesses and medicines.
Granted more research may lead to recognizing additional races.
.
Posted by Clyde Winters (Member # 10129) on :
Takruri
quote:
Also I reject the definition of biological race you provided because a definition of a word cannot contain the word being defined.
Biological race cannot be self-identified race because the selves identifying their race are neither scientists nor used scientific means of ascertaining their self-identified race. What they did use as identifiers were USA socially constructed races based on * a colour for one * a nationality for another * a geographic locale for the third * a language for the last
For consistency either colour, nationality, geography or language should've been allowed across the board by all resondents.
You know this would be impossible for a multiethnic human biologically diverse society like the U.S.A. That is why Tung et al, defined these races not on social factors but the genetic markers that categorized the races in their study.
.
Posted by alTakruri (Member # 10195) on :
What Tang demonstrated was that self-identified race (i.e. socially constructed race as per USA society) matched ancient geographic ancestry which STR clustering supports.
Tang used ancient geographic ancestry.
The subjects used self-defined race/ethnicity per the USA social spectrum.
Tang never postulates four races, one a colour, one a nationality, one a geographic reference, and one a language.
Nor does Tang propose there are individual STRs that any solo geographic population holds in exclusion to any other geo-pop. Tang states the obvious, certain STRs can be shown to cluster in each geographic ancestry.
If 1 - certain physical features can be shown to cluster in certain pre-1492 geographic populations 2 - yet no one such feature appears exclusively in one vs the others and 3 - such physical features do not constitute a race Then the same holds true for STRs.
quote:Originally posted by Clyde Winters: Why not you discuss genetics and you're not a geneticist.
It becomes biological in the United States because genetic research indicates that there are four biological races recognizied through the genetic markers corresponding to self-reported race/ethnicity categories.
This biological reality was determined through scientific means, since the researchers found genetic markers correlating with the four races. You can not find genetic markers if you do not use scientific methods.
The ability to find genetic markers associated with these self-reported race/ethnicity categories confirms the existence of these races.
Posted by rasol (Member # 4592) on :
quote:Tang never postulates four races, one a colour, one a nationality, one a geographic reference, and one a language.
Correct, Winters did not answer the question as usual and his basic premise is absurd, also as usual.
Posted by alTakruri (Member # 10195) on :
Ah, but I am talking about them, and more.
What kind of a scientific principle only works in the USA?
How much science would be behind jet propulsion if it conked out as soon as it left the USA?
Science is totally objective, works the same anywhere, and has no self-identification about it. A scientist anywhere can replicate the work of a USA scientist using material at hand in the scientist's home country/continent.
If definitions of race and assigning individuals a race isn't objective enough to apply to the whole of humanity all over the planet then it isn't a science, it's something else.
Race exists as a social construct.
quote:Originally posted by Clyde Winters: Takruri
quote:
Not to mention that Amerinds, Kooris (Australia), Indians, Twa, and other populations can be assigned to neither of the four.
I wasn't talking about these groups I was talking about people in the United States. The diversity of these groups make it clear that they may not engage the categories for these races/ethnic groups in the United States.
Posted by alTakruri (Member # 10195) on :
And still in all and all you must not have waited until 2005 before you assigned certain populations to a race.
So you must have some answer to these questions that you formulated in your own words/mind. So far you continue not to share your ideas with us. Why not? What are you afraid of? Why won't you:
quote: Please at least tell us this.
1). What is race (biologically)?
2). How many biologically defined races are there?
3). List the names of these biologically defined races.
in your own words?
Posted by alTakruri (Member # 10195) on :
You're twisting it. Tang didn't define race or any individual races.
Certain groups of STRs are found together in certain geographic populations.
Tang found that his subjects' STRs corresponded to STR clustering indicative of their ancestors' geographic location.
A very predicable outcome and waste of research money as a child could've predicted that outcome, that Americans living in the same city have divergent antecedents that will show up in their chromosomes as much as it does in their skin colour, mother tongue, and last point of departure before ancestors came to the USA.
And that is exactly what Tang et al write in the abstract of their report. Americans are heterogeneous not homogeneous despite living in proximity to each other.
quote:Originally posted by Clyde Winters: You know this would be impossible for a multiethnic human biologically diverse society like the U.S.A. That is why Tung et al, defined these races not on social factors but the genetic markers that categorized the races in their study.
Posted by Clyde Winters (Member # 10129) on :
quote: Am J Hum Genet. 2005 Feb;76(2):268-75. Epub 2004 Dec 29. Related Articles, Links
Genetic structure, self-identified race/ethnicity, and confounding in case-control association studies.
Tang H, Quertermous T, Rodriguez B, Kardia SL, Zhu X, Brown A, Pankow JS, Province MA, Hunt SC, Boerwinkle E, Schork NJ, Risch NJ.
Division of Public Health Sciences, Fred Hutchinson Cancer Research Center, Seattle, WA, USA.
We have analyzed genetic data for 326 microsatellite markers that were typed uniformly in a large multiethnic population-based sample of individuals as part of a study of the genetics of hypertension (Family Blood Pressure Program). Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic) and were recruited from 15 different geographic locales within the United States and Taiwan. Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories. Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity. On the other hand, we detected only modest genetic differentiation between different current geographic locales within each race/ethnicity group. Thus, ancient geographic ancestry, which is highly correlated with self-identified race/ethnicity--as opposed to current residence--is the major determinant of genetic structure in the U.S. population. Implications of this genetic structure for case-control association studies are discussed.
PMID: 15625622 [PubMed - indexed for MEDLINE]
The Longman Dictionary of American English defines ancestry as "the members of your family who lived inpast time". Consequently, when Tang et al wrote "Thus, ancient geographic ancestry, which is highly correlated with self-identified race/ethnicity--as opposed to current residence--is the major determinant of genetic structure in the U.S. population"; he was talking about Caucasian, Hispanic, East Asian and Black ancestors. These are racial terms. Name the geneticist who have presented evidence of a caucasian geographical region, Hispanic geographical region, East Asian geographical region or Black geographical region. All the literature I have read talks about African, Asian Eurasian regions (in fact the Amerindians are usually classed with the East Eurasians).
As a result Takruri when you write:
quote:
What Tang demonstrated was that self-identified race (i.e. socially constructed race as per USA society) matched ancient geographic ancestry which STR clustering supports.
Tang used ancient geographic ancestry.
The subjects used self-defined race/ethnicity per the USA social spectrum.
You are putting words in Tang et al mouth. They did not match STR clustering to geographic ancestry, they matched it to the the genetic markers corresponding to self-reported race/ethnicity categories. It was the individual genes collected, that were match to the Self-reported race categories.
Takruri
quote:
Nor does Tang propose there are individual STRs that any solo geographic population holds in exclusion to any other geo-pop. Tang states the obvious, certain STRs can be shown to cluster in each geographic ancestry.
Wrong, Tang et al said the " Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories." This finding has nothing to do with geographical ancestry. It was based solely on the self-reported race/ethnicity of the subjects in his study. The only way you can correlate the self-reported race categories to geographical ancestry is to make the claim that the geographical ancestries assigned populations by geneticists really relate to races, instead of populations?
Please list the geneticists who claim that Eurasian, African, Asian populations are races.
Posted by Djehuti (Member # 6698) on :
So Clyde, why did you ignore my questions in this reply??..
quote:Originally posted by Djehuti:
quote:Originally posted by Clyde Winters:
You are a hypocrite. The term black can only refer to people who belong to the negroid race.
There are many people in the tropics with very dark skin that are not called black. This makes your excuse a sad expression of a person who has betrayed his belief in race while he argues otherwise.
So tell me Clyde, is this person here black?
And what about this person?
And what exactly constitutes this 'negroid race'??..
All you do is either ignore certain questions posed or answer them with tediously long postings that are in the end incorrect.
We know your game. Posted by Clyde Winters (Member # 10129) on :
^The question is, what do these people describe themselves as being.
Tang found that " Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories." This finding has nothing to do with geographical ancestry. It was based solely on the self-reported race/ethnicity of the subjects in his study.
Tang has shown the best way to determine a biological basis for race. Their research indicates that the only way we can determine what race these people belong too is to have them submit a blood sample and self-identify their race. Then we can determine exactly what their race is.
You claim these people are black. What race do you believe they belong too?
.
Posted by Mansa Musa (Member # 6800) on :
quote:Originally posted by alTakruri: You're twisting it. Tang didn't define race or any individual races.
Certain groups of STRs are found together in certain geographic populations.
Tang found that his subjects' STRs corresponded to STR clustering indicative of their ancestors' geographic location.
A very predicable outcome and waste of research money as a child could've predicted that outcome, that Americans living in the same city have divergent antecedents that will show up in their chromosomes as much as it does in their skin colour, mother tongue, and last point of departure before ancestors came to the USA.
And that is exactly what Tang et al write in the abstract of their report. Americans are heterogeneous not homogeneous despite living in proximity to each other.
Basically.....
there is no genetic basis to race -- only to ethnic and geographic groups. - Dr. Peter Underhill
An understanfing of Tang's study confirms this.
And Dr. Winters, Al Takuri asked some very important questions which he listed numerically above.
To prove that race is a biological fact those question must be answered and there must be a biological justification for those answers.
quote: 1). What is race (biologically)?
2). How many biologically defined races are there?
3). List the names of these biologically defined races.
Posted by rasol (Member # 4592) on :
quote:Originally posted by alTakruri: What kind of a scientific principle only works in the USA?
^ Demonstrating its social and subjective nature, period.
Debating Dr. Winters is easy money.
Posted by rasol (Member # 4592) on :
quote:Originally posted by Clyde Winters: The question is, what do these people describe themselves as being?
Answers:
Southern Sudanese describe themselves as being 'green'.
Fulani are discribed by the Wolof as being red.
Fulani, Wolof and Southern Sudanese can all be placed into distinct clusters in genetic study. But, what does that prove?
According to Dr. Winters: we have now proven the existnence of 'green' and 'red' races too.
Dr. Winters you don't seem to understand that your statements of 'prior belief' and circular arguments to justify them, do *not* constitute proof...of anything.
And as others have noted, when you reply with massive amounts of cut and paste spam, it is as if you are yelling at everyone in frustation because no one takes you seriously.
Spam isn't proof either. Posted by Clyde Winters (Member # 10129) on :
Takruri
quote: You're twisting it. Tang didn't define race or any individual races.
Certain groups of STRs are found together in certain geographic populations.
You are the one who is mixed up. He never said simply geographical populations. Tang et al said : " Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity. On the other hand, we detected only modest genetic differentiation between different current geographic locales within each race/ethnicity group. Thus, ancient geographic ancestry, which is highly correlated with self-identified race/ethnicity--as opposed to current residence--is the major determinant of genetic structure in the U.S. population. "
This quote makes it clear that they were talking about racial ancestry, which was supported by genetic markers. he could not have been talking about regional populations, because these people are never described as races in the genetic literature.
The use of race means race. Tang et al are talking about race and genetics.
Takruri
quote:
Tang found that his subjects' STRs corresponded to STR clustering indicative of their ancestors' geographic location.
A very predicable outcome and waste of research money as a child could've predicted that outcome, that Americans living in the same city have divergent antecedents that will show up in their chromosomes as much as it does in their skin colour, mother tongue, and last point of departure before ancestors came to the USA.
Tang et al said that the genetic markers he found related to the race of the subjects in his study. Are you claiming " that STR clustering indicative of their ancestors' geographic " origin, can indicate races? This was the conlusion of Tang et al.
.
Posted by rasol (Member # 4592) on :
How often have we seen broken debate semantics revealed in the inability of the offending party to present clear definitions of their terms?
It is a classic 'intellectual marker' of pseudoscience...
quote: 1). What is race (biologically)?
2). How many biologically defined races are there?
3). List the names of these biologically defined races.
Posted by Clyde Winters (Member # 10129) on :
Mansa Musa
quote:
there is no genetic basis to race -- only to ethnic and geographic groups. - Dr. Peter Underhill
An understanfing of Tang's study confirms this.
And Dr. Winters, Al Takuri asked some very important questions which he listed numerically above.
To prove that race is a biological fact those question must be answered and there must be a biological justification for those answers.
Why do you keep saying there is no genetic basis for race, when Tang et al found " Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity.
If Tang et al found genetic markers for these self-described Blacks, Hispanic and etc., provides the biological justification of my answers
I have already answered Takruri's questions. Here they are:
1) Race is biological in the United States because the genetic research of Tang et al, indicates that there are four biological races recognizied through the genetic markers corresponding to self-reported race/ethnicity categories.
2) This biological reality was determined through scientific means, since the researchers found genetic markers correlating with the four races. You can not find genetic markers if you do not use scientific methods.
3) The ability to find genetic markers associated with these self-reported race/ethnicity categories confirms the existence of these races.
Rasol
quote:
quote: -------------------------------------------------------------------------------- Originally posted by alTakruri: What kind of a scientific principle only works in the USA? --------------------------------------------------------------------------------
^ Demonstrating it's social and subjective nature, period.
Debating Dr. Winters is easy money...
....Easy money only if you can't comprehend what you read.
You don't know what science is science as defined by the Longman Dictionary of American English is: "knowledge about the physical world that is based on testing and proving facts". Is this not what Tang did.
He studied a group of people who self-reported their race as black, hispanic and etc.
He took their blood to test and see if their self-racial-identification correspondeded to genetic markers associated with thier race.
The results of their experiment indicated that: " Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity. "
This confirmed that the self-racial-identification of the subjects in their study was supported by specific genetic markers.
These are all the necessary steps called for in science question/hypothesis +test +confirmation or rejection of the hypothesis as a result of the test.
This makes the Tang et al study scientific, since scientific according to the Longman Dictionary of the American English is "relating to science".
This proves races exist in the United States. And it has a biological basis that can be illustrated by genetic markers.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
How often have we seen broken debate semantics revealed in the inability of the offending party to present clear definitions of their terms?
It is a classic 'intellectual marker' of pseudoscience...
quote: -------------------------------------------------------------------------------- 1). What is race (biologically)?
2). How many biologically defined races are there?
3). List the names of these biologically defined races. --------------------------------------------------------------------------------
What is unclear semantically about my answers to Takruri's questions.
The definition of biology is: "the scientific study of living things". Wasn't the Tang et al study, a study of living races?
1) Race is biological in the United States because the genetic research of Tang et al, indicates that there are four biological races recognizied through the genetic markers corresponding to self-reported race/ethnicity categories.
2) This biological reality was determined through scientific means, since the researchers found genetic markers correlating with the four races. You can not find genetic markers if you do not use scientific methods.
3) The ability to find genetic markers associated with these self-reported race/ethnicity categories confirms the existence of these races.
There is nothing ambiguous about what I wrote. The races were determined by genetic markers that correspond to self-identified racial ancestries.
.
Posted by Clyde Winters (Member # 10129) on :
Takruri
1). What is race (biologically)?
Race biologically is the ability to correlate [b]specific genetic markers to specific racial groups.
2). How many biologically defined races are there?
Tang has identified four biological races.
3). List the names of these biologically defined races. Tang has identified four biological races using specific genetic markers: white, Afro-American, Hispanic and east Asian
Posted by What Box (Member # 10819) on :
AlTakruri- _________________________________________________ If definitions of race and assigning individuals a race isn't objective enough to apply to the whole of humanity all over the planet then it isn't a science, it's something else.
Race exists as a social construct. ________________________________________________
Posted by Clyde Winters (Member # 10129) on :
What Box
quote: AlTakruri- _________________________________________________ If definitions of race and assigning individuals a race isn't objective enough to apply to the whole of humanity all over the planet then it isn't a science, it's something else.
Race exists as a social construct. ________________________________________________
This is your opinion. Takruri in a series of excellent post outlined the numerous "races", defined by various groups around the globe.
The fact that Tang et al could correlate genetic markers with white, Afro-American, Hispanic and East Asian individuals indeicate that at least in the United States these races exist.
.
Posted by rasol (Member # 4592) on :
quote:Dr. Winters: Race biologically is the ability to correlate specific genetic markers to specific racial groups.
^ Circular argument. Not a definition. The question remains unanswered.
Posted by rasol (Member # 4592) on :
quote:Winters writes: Tang has identified four biological races.
^ That is a distortion. No such claim is made by Tang. Tang simply found distinct markers in self identified population groups, as might be found in Nigeria among self identified Hausa, Yoroba, and Fulani, which would *not* prove that said groups belong to different races.
Posted by Djehuti (Member # 6698) on :
quote:Originally posted by rasol:
quote:Originally posted by Clyde Winters:
The question is, what do these people describe themselves as being?
Answers:
Southern Sudanese describe themselves as being 'green'.
Fulani are discribed by the Wolof as being red.
Fulani, Wolof and Southern Sudanese can all be placed into distinct clusters in genetic study. But, what does that prove?
According to Dr. Winters: we have now proven the existnence of 'green' and 'red' races too.
Dr. Winters you don't seem to understand that your statements of 'prior belief' and circular arguments to justify them, do *not* constitute proof...of anything.
And as others have noted, when you reply with massive amounts of cut and paste spam, it is as if you are yelling at everyone in frustation because no one takes you seriously.
Spam isn't proof either.
LMAO Good one, Rasol! I asked HIM if he considers these people to be 'black' and he turns around and gives me the same crap that the foolish trolls Mike and Salsa give!!
There are Sudanese of the same complexion as Senegalese but call themselves 'green' and etc!
My question is what do YOU consider them Clyde?! I'm shocked that you spit back with that 'what they consider themselves to be', considering you trying to connect the Dravidians to Africans on account of similar color which YOU call black!!
And you still have yet to define this "negroid race". What constitutes such a 'race' and what peoples does it consist of??
I am waiting. Posted by rasol (Member # 4592) on :
quote:Winters writes: there are four biological races using specific genetic markers: white, Afro-American, Hispanic and east Asian.
^ Laughable.
The native population of many if not most countries on earth have no whites, no Afro Americans, no Hispanics, and no east Asians.
Therefore your statement makes no sense.
Posted by Djehuti (Member # 6698) on :
^^ ROTFL Oh Lord, I think Winters has officially lost it!!
Since when is Afro-Americans a 'race'?!!
Newsflash, ALL of the black peoples of Africa are not Afro-Americans but just AFRICANS.
'Hispanic' is not a 'race' but a linguistic group. There are white hispanics as there are black hispanics, but the vast majority are of Native American ancestry or a mixture between 2 or more of the said groups. There are even Hispanics of Asian descent!
What about South Asians, Native Americans, etc.?? The populations there fall outside of your ridiculous classifications!!
Posted by rasol (Member # 4592) on :
^ Which brings me to, the Dravidians Winters so likes to use in his pseudoscientific posturings ->
not African American,
not Hispanic,
not white,
and not East Asian.
Even worse, for Winters, in genetic affinity the Dravidians are least like African Americans of all of his 4 groups - in total contradiction to Winters RACE-FANTASIES.
E-Z money, Dr. Winters....easy as can be.
Posted by Mansa Musa (Member # 6800) on :
quote:Originally posted by rasol:
quote:Dr. Winters: Race biologically is the ability to correlate specific genetic markers to specific racial groups.
^ Circular argument. Not a definition. The question remains unanswered.
Indeed this is a circular argument.
By Clyde's logic any grouping of human beings by genetic markers that can be given a title can be called a race.
The same tests done on people who self-identify by the groups Tang et al. listed can be used by people who identify by certain isolated religious groups as Amish and Mormons, as men or women, by a nationality, even by a family.
We could use these same test methods on the Bush family and the bin laden family and "identify" a Bush race and a bin Laden race.
The fact is this study does not give objective variables for what race is.
Race has historically been defined in biology as phenotype denoting genotype to identify a sub-species and this concept has been falsified.
As Rasol explained in the Peter Underhill thread that I linked to Tang et al's self-identified ethnic constructs actually belie the traditional concept of race.
I recall Richard Poe employing this same circular reasoning as Winters in a blog entry he made on his website in which he defends his usage of the term "Cro-Magnon race" with a specialized definition made by Steve Sailer in which any genetic distinction between groups can be used to identify different races.
Apparently Protestants and Catholics can be a race as well as Irish and English.
Hopefully Dr. Winters gets the point of what is being said here. Posted by Clyde Winters (Member # 10129) on :
Mansa Musa
quote:
Apparently Protestants and Catholics can be a race as well as Irish and English.
Richard Poe: A Race is a Race is a Race (cached)
Hopefully Dr. Winters gets the point of what is being said here.
This is your opinion. In this thread the topic is race doesn't exist.
I am talking about genetic research that aggregates people into racial groups based on shared genetic markers. I know of no research that has aggregated Protestants and Catholics into racial groups so this is a strawman fallacious argument.
Tang et al, found that genetic markers supported the white, Hispanic, Afro-American and East Asian aggregation of these individuals into racial groups. This proves that races exist.
This is exactly what's been said here before I ever joined the forum.
♩♩♩ ♩♩♪♪ ♩♩♩♫♪♬ I want my, I want my, I want my laboratory. That ain't race. That's the way you do it. You do the science in the laboratory. That's what you call population genetics: "ancient geographic ancestry" = population "genetic structure" = genetics.
Population genetics is science. Population genetics is not race.
Tang does not say that either "ancient geographic ancestry" or "genetic structure" is the same as race.
Tangs says that "ancient geographic ancestry" is "highly correlated" with self-identified racial/ethnic designations used in the USA (white, African American, East Asian, Hispanic = self-identified race/ethnicity).
Self-identified is not science identified.
USA self identified race/ethnicity is a social construct. USA self identified race/ethnicity is not science
Comprehend?
[Truth to tell, too much is resting on just a simple abstract, the whole report ought to be read to really get what Tang et al are putting down.]
quote: Thus, ancient geographic ancestry, which is highly correlated with self-identified race/ethnicity--as opposed to current residence--is the major determinant of genetic structure in the U.S. population.
Posted by alTakruri (Member # 10195) on :
As explained a couple times already:
* white is a colour * African American is a nationality * East Asian is geographic * Hispanic is language.
Now you write here that, duh, East Asia is not a geographic region? Is that part of the lesson plan for Chicago's youth? <<shudder>>
quote:Originally posted by Clyde Winters: Name the ... evidence of a ... East Asian geographical region ...
Posted by alTakruri (Member # 10195) on :
Tang uses the termonology "microsatellite clusters".
Is there anyone here, other than the person I'm replying to, who knows so little about population genetics that they don't know microsatellite clusters does not equal "individual genes collected"?
Microsatellite clusters are groups of STRs. Is there anyone here "analyzing" population genetics reports other than the person I'm replying to, who doesn't know microsatellites are STRs?
How can anyone claim to understand a genetic report when they don't even have basic genetics terminology under their belt?
quote:Originally posted by Clyde Winters: It was the individual genes collected, that were match to the Self-reported race categories.
Takruri
quote:
Nor does Tang propose there are individual STRs that any solo geographic population holds in exclusion to any other geo-pop. Tang states the obvious, certain STRs can be shown to cluster in each geographic ancestry.
Wrong, Tang et al said the " Genetic cluster analysis of the microsatellite markers produced four major clusters, ...
Posted by alTakruri (Member # 10195) on :
Oh and by the way, despite calculated distractions strewn in the path, no one's forgetting:
quote:Originally posted by alTakruri: And still in all and all you must not have waited until 2005 before you assigned certain populations to a race.
So you must have some answer to these questions that you formulated in your own words/mind. So far you continue not to share your ideas with us. Why not? What are you afraid of? Why won't you:
quote: Please at least tell us this.
1). What is race (biologically)?
2). How many biologically defined races are there?
3). List the names of these biologically defined races.
in your own words?
Posted by Clyde Winters (Member # 10129) on :
Takruri
quote: Tang is loud and clear, ancient geographic ancestry is the major determinant of genetic structure.
He was talking about racial ancestry. The paper is about self-racial-identification and genes.
.
Posted by Clyde Winters (Member # 10129) on :
Takruri
quote:
Self-identified is not science identified.
USA self identified race/ethnicity is a social construct. USA self identified race/ethnicity is not science
It is science when a scientist is able to correlate genes and self-racial-identification the way Tang et al did.
.
Posted by Clyde Winters (Member # 10129) on :
Takruri
quote: As explained a couple times already:
* white is a colour * African American is a nationality * East Asian is geographic * Hispanic is language.
As you know these terms as discussed earlier on this thread are also used to refer to races. The above interpretations of these terms have no standing with the Tang et al paper, they are your own interpretation of these terms. They lack the scientific precision given these racial terms by Tang et al.
In Tang et al, these terms were specifically defined as races for purposes of his study. They are recognized as races on numerous census and governmental forms people in the United States complete each day.
Other geneticists have recognized African American, and Hispanics, along with caucasians that were aggregated into races by genes.
Dr. Juan Martinez Cruzado, a geneticist from the University of Puerto Rico Mayaguez has also found genes that are associated with races, namely the Caucasian race. According to the study funded by the U.S. National Science Foundation, 61 percent of all Puerto Ricans have Amerindian mitochondrial DNA, 27 percent have African and 12 percent Caucasian. (Nuclear DNA, or the genetic material present in a gene’s nucleus, is inherited in equal parts from one’s father and mother. Mitochondrial DNA is inherited only from one’s mother and does not change or blend with other materials over time.) http://www.biomedcentral.com/1471-2350/6/30
Acuña et al ,also found genes that aggregate people into races. These researchers reported that: ”Comparisons of D1S80 allele distribution between populations (Figure 2) ² test showed no significant differences between the Chileanusing the population sample when compared with Southwestern US Hispanics and US Hispanics pooled (Zago et al., 1996; Huckenbeck et al., 1997). The research presented in this paper shows that the hypervariable DNA loci investigated are distinguishable from other Caucasian (Spanish), Black and Oriental populations, but that the D3S1744 locus is indistinguishable from the Caucasian population. All the loci studied are indistinguishable from USA Hispanic populations (Figures 2 and 3). This study provides the first database for DNA markers in low and middle socioeconomic strata in a Chilean population. The results presented indicate that the analysis of these loci may have useful applications in population genetics as well as in identity tests.”
This paper was very significant because it found that Hispanics in the American Southwest share DNA markers with their ancestral groups in South America. This is why the researchers noted that " The results presented indicate that the analysis of these loci may have useful applications in population genetics as well as in identity tests".
In relation to these biological studies and Tang et al, we now know these races can be aggregated into groups using genetics. They complement the great research of Tang et al.
Posted by KING (Member # 9422) on :
This thread has been going on long enough. Dr. Winters answer these simple questions and this debate can be put to rest.
1). What is race (biologically)?
2). How many biologically defined races are there?
3). List the names of these biologically defined races.
Enough of this beating around the bush. Why do you continue to ignore these simple questions? The other posters have got to be tired of trying to get answers from you. So far from what I have read you have not proven that race exist you have only spamed the thread with unreadable garbage. I have mostly ignored what you posted because you just spam with the same nonsense. This thread is becoming boring.
Peace
Posted by Clyde Winters (Member # 10129) on :
Takruri
quote: Originally posted by alTakruri: And still in all and all you must not have waited until 2005 before you assigned certain populations to a race.
So you must have some answer to these questions that you formulated in your own words/mind. So far you continue not to share your ideas with us. Why not? What are you afraid of? Why won't you:
quote: Please at least tell us this.
1). What is race (biologically)?
2). How many biologically defined races are there?
3). List the names of these biologically defined races.
in your own words?
Here are the answers you requested:
1). What is race (biologically)?
Race biologically is the ability to correlate specific genetic markers to specific racial groups.
2). How many biologically defined races are there?
Tang et al , Acuna et al, and Cruzado have identified four biological races aggregated by genes.
3). List the names of these biologically defined races. Tang et al , Acuna et al, and Cruzado have identified four biological races using specific genetic markers: white/Caucasian, Afro-American, Hispanic and East Asian. The research of Acuna et al, that found that the Hispanics in South America and the Southwestern U.S.A, make it clear that Hispanic is more than a linguistic term, it also corresponds to a specific racial group.
Race exist. .
Posted by KING (Member # 9422) on :
I don't understand How can Afro-Americans be a race I thought they were nation. I don't understand any of your answers they make little sense. East Asia is a geographic region not a race. And Hispanics is a language family. Their is "White" Hispanics and "Black" Hispanics. You need to come up with better answers these answers are weak.
Peace
Posted by alTakruri (Member # 10195) on :
Ok you're unable to articulate race as used by you for decades before you encountered population genetics here on this forum.
Ergo before last week you had no idea what you meant when you classified certain peoples as members of a set of races.
Again you fail to answer the questions in your own words from your own mind and thought processes over the last ~30 years.
We can only conclude that before last week you had no idea what on earth you were talking about when you wrote about black, negroid, etc., races over the years.
I can accept that!
It seems no one here is confused about this issue nor are they unclear as to what the studies you've repeatedly reposted are actually saying, so there's no need for me to further persue this.
So go ahead, I invite you to have the last word.
By the way, by the rules of English grammar what you want to write is race exists not race exist.
Posted by alTakruri (Member # 10195) on :
Sorry, one more piece of madness. This is madness. Please stop all this madness. Stop.
quote:Originally posted by Clyde Winters: Name the geneticist who have presented evidence of a caucasian geographical region, Hispanic geographical region, East Asian geographical region or Black geographical region. All the literature I have read talks about African, Asian Eurasian regions (in fact the Amerindians are usually classed with the East Eurasians).
1 - geneticists study genomes not geography, geography has been defined by geographers 2 - the Caucasus is a geographical region 3 - East Asia is a geographical region 4 - Hispania is a geographical region (the Roman name for the Iberian peninsula) 5 - Africa and America are geographical regions, America also being a nation (short for US of A)
Posted by Clyde Winters (Member # 10129) on :
King
quote:
I don't understand How can Afro-Americans be a race I thought they were nation. I don't understand any of your answers they make little sense. East Asia is a geographic region not a race. And Hispanics is a language family. Their is "White" Hispanics and "Black" Hispanics. You need to come up with better answers these answers are weak.
Peace
They are weak in your mind, since you have become conditioned to believe race does not exists when geneticists spend all their time talking about race. This is because you don't understand genetic and medical research.
Instead of reading the literature for your self you let a few ES bully's coward you down from admitting the obvious races exist.
In the U.S. you are asked when you visit a doctor what is your race. This is recorded on your medical record and becomes part of your medical history.
When blood is drawn from a patient it is labled with the name of the patient. The race of this patient is then obtained via the medical history of the patient. This is how caucasian, Afro-American and Hispanic has become racial terms.
The discovery that Hispanics in the American Southwest and South America, by Acuna et al, have common genetic markers make it clear that Hispanic, in the context of the United States and South America, relates to more than a linguistic group.
Races Exist!
.
Posted by alTakruri (Member # 10195) on :
This is precisely why one of my sisters went to her early grave before she was 30.
Her doctor dismissed the disease her symptoms clearly spelled because her assigned race was not the one her disease was supposed to afflict.
Anyone lets medical professionals treat them as a race instead of an individual you are a first class fool. Doctors have marvelled that my spouse and I don't have ailments or medical indicators our race dictates we must have. We let those doctors go because if they were too stupid to realize the role of dietary culture in disease then they were too stupid to practice their profession on my family.
quote:Originally posted by Clyde Winters: In the U.S. you are asked when you visit a doctor what is your race. This is recorded on your medical record and becomes part of your medical history.
When blood is drawn from a patient it is labled with the name of the patient. The race of this patient is then obtained via the medical history of the patient. This is how caucasian, Afro-American and Hispanic has become racial terms.
Posted by KING (Member # 9422) on :
From all I read nothing you have provided proved that race exist. I thought the whole point of this forum is to learn. Why Dr. Winters are you stuck on this idea that race exists? Again Hispanics can be "Black" and they can be "White" Hispanic is a language family not a race. You need to do better to prove your point, so far you have not proven nothing.
Peace
Posted by Mansa Musa (Member # 6800) on :
quote:Originally posted by alTakruri: [Truth to tell, too much is resting on just a simple abstract, the whole report ought to be read to really get what Tang et al are putting down.]
Here is the abstract and PDF file, so that everyone can view the whole study.
quote:Genetic structure, self-identified race/ethnicity, and confounding in case-control association studies.
Division of Public Health Sciences, Fred Hutchinson Cancer Research Center, Seattle, WA, USA.
We have analyzed genetic data for 326 microsatellite markers that were typed uniformly in a large multiethnic population-based sample of individuals as part of a study of the genetics of hypertension (Family Blood Pressure Program). Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic) and were recruited from 15 different geographic locales within the United States and Taiwan. Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories. Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity. On the other hand, we detected only modest genetic differentiation between different current geographic locales within each race/ethnicity group. Thus, ancient geographic ancestry, which is highly correlated with self-identified race/ethnicity--as opposed to current residence--is the major determinant of genetic structure in the U.S. population. Implications of this genetic structure for case-control association studies are discussed.
Hopefully now further points can be added if they could not have been before.
quote:Originally posted by Clyde Winters: This is your opinion. In this thread the topic is race doesn't exist.
I am talking about genetic research that aggregates people into racial groups based on shared genetic markers. I know of no research that has aggregated Protestants and Catholics into racial groups so this is a strawman fallacious argument.
Tang et al, found that genetic markers supported the white, Hispanic, Afro-American and East Asian aggregation of these individuals into racial groups. This proves that races exist.
It's not a strawmen as the same concept applies.
We can make any populations into a race if we find genetic markers correlating to geographic ancestry that can be distingiushed by a self-identified construct.
This study does not prove the validity of race as a taxonomic subdivision of human beings.
We can say that there are genes related to people who identify as African-Americans that can be distinguished from people who identify as White, Hispanic or East Asian.
We can call that a race.
What the study does not do is rationalize the concept of race itself.
It does not prove a concept of a Negroid (Black Race), Caucasoid (White Race) or Mongoloid (Asian Race) etc. race.
It does not prove that phenotype always denotes genotype, a concept that his been disproven and one that you have been purporting for years before adding population genetics into the equation.
As far as your repeated statements about this thread being about whether or not race exists Dr. Winters, you are really the only one who seems to be arguing from the premise of whether it does or not.
Most everyone else agrees that the concept exists in some form.
This doesn't prove the biological concept of race is valid.
As Dr. C. Loring Brace notes:
quote:I am going to start this essay with what may seem to many as an outrageous assertion: There is no such thing as a biological entity that warrants the term "race."
The immediate reaction of most literate people is that this is obviously nonsense. The physician will retort, "What do you mean 'there is no such thing as race'? I see it in my practice everyday!" Jane Doe and John Roe will be equally incredulous. Note carefully, however, that my opening declaration did not claim that "there is no such thing as race." What I said is that there is no "biological entity that warrants the term 'race'......
First, it is perfectly true that the long-term residents of the various parts of the world have patterns of features that we can easily identify as characteristic of the areas from which they come. It should be added that they have to have resided in those places for a couple of hundred thousand years before their regional patterns became established. Well, you may ask, why can't we call those regional patterns "races"? In fact, we can and do, but it does not make them coherent biological entities. "Races" defined in such a way are products of our perceptions......
There is nothing wrong with using geographic labels to designate people. Major continental terms are just fine, and sub-regional refinements such as Western European, Eastern African, Southeast Asian, and so forth carry no unintentional baggage. In contrast, terms such as "Negroid," "Caucasoid," and "Mongoloid" create more problems than they solve. Those very terms reflect a mix of narrow regional, specific ethnic, and descriptive physical components with an assumption that such separate dimensions have some kind of common tie. Biologically, such terms are worse than useless.Their continued use, then, is in social situations where people think they have some meaning.
The argument here is not over the existence of race which is semantic but about the rationale behind calling race a science based on a biologically valid entity.
Race in biology is pseudoscience.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Mansa Musa:
We can say that there are genes related to people who identify as African-Americans that can be distinguished from people who identify as White, Hispanic or East Asian.
We can call that a race.
...as a social construct or...?
quote:Mansa Musa:
Race in biology is pseudoscience.
Okay.
Posted by Clyde Winters (Member # 10129) on :
Mansa Musa
quote: The argument here is not over the existence of race which is semantic but about the rationale behind calling race a science based on a biologically valid entity.
Race in biology is pseudoscience.
This argument about race is not semantic. Semantics deals with the study of word meanings. This debate is about science.
We know exactly what race means and what genetics means. The fact that Tang was able to correlate race with genetic markers makes race a biological phenomena, not a semantic issue.
.
Posted by Clyde Winters (Member # 10129) on :
Supercar
quote:
quote:Originally posted by Mansa Musa:
We can say that there are genes related to people who identify as African-Americans that can be distinguished from people who identify as White, Hispanic or East Asian.
We can call that a race.
...as a social construct or...?
quote:Mansa Musa:
Race in biology is pseudoscience.
Okay.
If race is a pseudoscience why do you continue to call the Egyptians black, based on the genetics research of Keita and others.
.
Posted by Clyde Winters (Member # 10129) on :
King [
quote:
From all I read nothing you have provided proved that race exist. I thought the whole point of this forum is to learn. Why Dr. Winters are you stuck on this idea that race exists? Again Hispanics can be "Black" and they can be "White" Hispanic is a language family not a race. You need to do better to prove your point, so far you have not proven nothing.
Peace
I am sticking to the idea race exist because scientists are able to correlate an individuals race with specific genetic markers.
In the U.S., when people are talking about Hispanics, they are not refering to the people who speak Portuguese and Spanish,solely, they are talking about Mexicans and other Latin Americans.
.
Posted by Mansa Musa (Member # 6800) on :
quote:Originally posted by Clyde Winters: This argument about race is not semantic. Semantics deals with the study of word meanings. This debate is about science.
We know exactly what race means and what genetics means. The fact that Tang was able to correlate race with genetic markers makes race a biological phenomena, not a semantic issue.
He doesn't correlate race with genetic markers.
He correlates self-identified race-ethnicity with geographic ancestry based on specific genetic markers.
I say that race is a semantic issue because those self-identified constructs themselves are not concrete.
What is considered to be White or Black differs from region to region. The standards very between places like America, Panama and Brazil. The terms themselves are based on socio-political themes that very in everything from language to skin color to classify citizens by ancestry.
I've outlined through excerpts from Brace's article what the difference here is.
This is not a hard concept to follow Dr. Winters.
quote:Originally posted by Clyde Winters: If race is a pseudoscience why do you continue to call the Egyptians black, based on the genetics research of Keita and others.
We've already gone over that. Black is a reference to skin color and we know that tropically adapted people, which we know the Ancient Egyptian were, have skin tones within the range we refer to as "Black skin".
I don't think skin tone reference is the best way to define a culture.
The best way to decribe the Ancient Egyptians is as Ancient Egyptians.
When we talk about their culture, their language, their geographic origin their biological affinities there are many ways to describe them other than by a reference to color.
As a people the term Black African is synonymous with tropically adapted African.
That doesn't mean they were members of any sort of Black Race which is a defunct concept.
We could use Tang et al's research and construct a category for them based on geographic ancestry and call that a race, a black race if you like.
It's not the same thing as naming something that is rooted in a scientific concept such as a Black Race (e.g. Negroid) that's applied to all of humanity.
Posted by Clyde Winters (Member # 10129) on :
Mansa Musa
quote:
He correlates self-identified race-ethnicity with geographic ancestry based on specific genetic markers.
I say that race is a semantic issue because those self-identified constructs themselves are not concrete.
What is considered to be White or Black differs from region to region. The standards very between places like America, Panama and Brazil. The terms themselves are based on socio-political themes that very in everything from language to skin color to classify citizens by ancestry.
I've outlined through excerpts from Brace's article what the difference here is.
This is not a hard concept to follow Dr. Winters.
It's not the same thing as naming something that is rooted in a scientific concept such as a Black Race (e.g. Negroid) that's applied to all of humanity.
I am surprised you claim there is a "scientific concept such as a Black race (e.g., Negroid) that's applied to all of humanity", this term is applied to only one group of humanity not "all of humanity".
You declare that the concept of race varies across regions. This may be true, as excellently discussed by Takruri in this thread, but we are not talking about Brazil or Australia, we are talking about races in the United States, that correlated with genetic markers. The correlation of self-race-identification and genetic markers makes these races biological entities in the United States.
.
Posted by rasol (Member # 4592) on :
quote:This may be true, as excellently discussed by Takruri in this thread, but we are not talking about Brazil or Australia
^ If it does not transcend political and cultural boundaries then you are discussing political and cultural issues - *not biology*.
Get it thru your head Dr. Winters.
After two months and two multi-page threads, not a single person has bought into your rubbish.
Bottom line:
You have failed to indoctrinate anyone into your pseudo-scientific racial ideology, because even a child can reason out - that you aren't making any sense.
We simply aren't as dense as you need us to be, in order to take you seriously.
Posted by Mansa Musa (Member # 6800) on :
quote:Originally posted by Clyde Winters: I am surprised you claim there is a "scientific concept such as a Black race (e.g., Negroid) that's applied to all of humanity", this term is applied to only one group of humanity not "all of humanity".
You declare that the concept of race varies across regions. This may be true, as excellently discussed by Takruri in this thread, but we are not talking about Brazil or Australia, we are talking about races in the United States, that correlated with genetic markers. The correlation of self-race-identification and genetic markers makes these races biological entities in the United States.
I'm saying that Negroid was designated as a subdivision in relation to human beings as a whole while Tang et al's self-identified races are limited to cultural and political boundaries.
By contrast a species is a division related to all living things. It is rooted in biology not a concept constructed by man such as politics.
It is a concept based on natural science.
Self-Identified ethnic contructs are not based on natural science.
Population genetics is natural science, so certainly Tang's paper is scientific.
Population genetics do not prove the scientific validity of the concept of race.
Posted by Clyde Winters (Member # 10129) on :
Race exists this is supported by physical anthropologists. Dr. George Gill notes that
quote:
Slightly over half of all biological/physical anthropologists today believe in the traditional view that human races are biologically valid and real. Furthermore, they tend to see nothing wrong in defining and naming the different populations of Homo sapiens. The other half of the biological anthropology community believes either that the traditional racial categories for humankind are arbitrary and meaningless, or that at a minimum there are better ways to look at human variation than through the "racial lens."
Are there differences in the research concentrations of these two groups of experts? Yes, most decidedly there are. As pointed out in a recent 2000 edition of a popular physical anthropology textbook, forensic anthropologists (those who do skeletal identification for law-enforcement agencies) are overwhelmingly in support of the idea of the basic biological reality of human races, and yet those who work with blood-group data, for instance, tend to reject the biological reality of racial categories.
Where does George Gill stand in the "great race debate?" Read on. I happen to be one of those very few forensic physical anthropologists who actually does research on the particular traits used today in forensic racial identification (i.e., "assessing ancestry," as it is generally termed today). Partly this is because for more than a decade now U.S. national and regional forensic anthropology organizations have deemed it necessary to quantitatively test both traditional and new methods for accuracy in legal cases. I volunteered for this task of testing methods and developing new methods in the late 1980s. What have I found? Where do I now stand in the "great race debate?" Can I see truth on one side or the other—or on both sides—in this argument?
Findings First, I have found that forensic anthropologists attain a high degree of accuracy in determining geographic racial affinities (white, black, American Indian, etc.) by utilizing both new and traditional methods of bone analysis. Many well-conducted studies were reported in the late 1980s and 1990s that test methods objectively for percentage of correct placement. Numerous individual methods involving midfacial measurements, femur traits, and so on are over 80 percent accurate alone, and in combination produce very high levels of accuracy. No forensic anthropologist would make a racial assessment based upon just one of these methods, but in combination they can make very reliable assessments, just as in determining sex or age. In other words, multiple criteria are the key to success in all of these determinations.
Dr. Gill makes it clear that scientific rsearch indicates that race exists. This is further confirmation of Tang et al's, finding that self-race-identification correlates with genetic markers.
Mansa Musa
quote: quote:Originally posted by Clyde Winters: I am surprised you claim there is a "scientific concept such as a Black race (e.g., Negroid) that's applied to all of humanity", this term is applied to only one group of humanity not "all of humanity".
You declare that the concept of race varies across regions. This may be true, as excellently discussed by Takruri in this thread, but we are not talking about Brazil or Australia, we are talking about races in the United States, that correlated with genetic markers. The correlation of self-race-identification and genetic markers makes these races biological entities in the United States.
I'm saying that Negroid was designated as a subdivision in relation to human beings as a whole while Tang et al's self-identified races are limited to cultural and political boundaries.
By contrast a species is a division related to all living things. It is rooted in biology not a concept constructed by man such as politics.
It is a concept based on natural science.
Self-Identified ethnic contructs are not based on natural science.
Population genetics is natural science, so certainly Tang's paper is scientific.
Population genetics do not prove the scientific validity of the concept of race.
Posted by Clyde Winters (Member # 10129) on :
Mansa Musa
quote:
I'm saying that Negroid was designated as a subdivision in relation to human beings as a whole while Tang et al's self-identified races are limited to cultural and political boundaries.
By contrast a species is a division related to all living things. It is rooted in biology not a concept constructed by man such as politics.
It is a concept based on natural science.
Self-Identified ethnic contructs are not based on natural science
They are based on natural science when these self-identified racial constructs are supported by genetic markers and numerous individual methods involving midfacial measurements, femur traits, and so on that allow us to aggregate individuals into racial groups.
This reality has led Dr. Gill to conclude:
quote: Findings First, I have found that forensic anthropologists attain a high degree of accuracy in determining geographic racial affinities (white, black, American Indian, etc.) by utilizing both new and traditional methods of bone analysis. Many well-conducted studies were reported in the late 1980s and 1990s that test methods objectively for percentage of correct placement. Numerous individual methods involving midfacial measurements, femur traits, and so on are over 80 percent accurate alone, and in combination produce very high levels of accuracy. No forensic anthropologist would make a racial assessment based upon just one of these methods, but in combination they can make very reliable assessments, just as in determining sex or age. In other words, multiple criteria are the key to success in all of these determinations.
The ability of genetic markers and bones to classify individuals into races, show that we can objectively aggregate individuals into races using the natural sciences.
.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
If it does not transcend political and cultural boundaries then you are discussing politicals and culutural issues - *not biology*.
Get it thru your head Dr. Winters.
After two months and two multi-page threads, not a single person has bought into your rubbish.
Bottom line:
You have failed to indoctrinate anyone into your pseudo-scientific racial ideology, because even a child can reason out - that you aren't making any sense.
We simply aren't as dense as you need us to be, in order to take you seriously.
^Fallacious band wagon effect argument.
The definition of biology is: "the scientific study of living things". Wasn't the Tang et al study, a study of living races?
1) Race is biological in the United States because the genetic research of Tang et al, indicates that there are four biological races recognizied through the genetic markers corresponding to self-reported race/ethnicity categories.
2) This biological reality was determined through scientific means, since the researchers found genetic markers correlating with the four races. You can not find genetic markers if you do not use scientific methods.
3) The ability to find genetic markers associated with these self-reported race/ethnicity categories confirms the existence of these races.
There is nothing ambiguous about what I wrote. It is not rubbish as you claim. Races are determined by genetic markers and bones that correspond to self-identified racial ancestries.
.
Posted by rasol (Member # 4592) on :
quote: Rasol
If it does not transcend political and cultural boundaries then you are discussing political and cultural issues - *not biology*.
quote:Winters: Fallacious band wagon effect argument.
Red herring, has nothing to do with your inability to provide the requested definitions.
quote: Winters: The definition of biology is: "the scientific study of living things". Wasn't the Tang et al study, a study of living races?
Non-sequitur, you were asked for a biological definition of race.
quote:Winters: There is nothing ambiguous about what I wrote.
Agreed - it quite unambiguously demonstrates your inability to provide the requested definitions of terms.
And that's why you have no credibility on this issue.
It's not a bandwagon. It's just a fact.
Anyone who can show that your argument on race is credibile is free to challenge this fact.
Posted by rasol (Member # 4592) on :
quote:Originally posted by Mansa Musa: Population genetics do not prove the scientific validity of the concept of race.
posted 06 June, 2006 10:12 AM --------------------------------------------------------------------------------
quote: -------------------------------------------------------------------------------- Originally posted by Mansa Musa: Population genetics do not prove the scientific validity of the concept of race. --------------------------------------------------------------------------------
Correct: Race is not a concept that emerged from within modern genetics. By ignoring its cultural meaning the reductionist narrative about race fails--both in the narrow terms of science and as a contribution to the broader social discourse.
Wrong. The work of Tang et al is increasingly show that race and genes is a part of modern genetics.
" Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity.
If Tang et al can find genetic markers for these self-described Blacks, Hispanic and etc. races, we now have the biological justification for race.
is from the Department of Preventive Medicine and Epidemiology, Loyola.
You cannot refute them by simply shouting 'wrong', and then presenting *your irrelevant remarks* about some other study, which you don't even understand, and in no way validates your pseudoscientific views.
Not good enough Dr. Winters, not even close. Sorry.
Instead what you need to do is answer AlTakruri's questions which *were* directed TO YOU.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
Race is not a concept that emerged from within modern genetics. By ignoring its cultural meaning the reductionist narrative about race fails--both in the narrow terms of science and as a contribution to the broader social discourse.
is from the Department of Preventive Medicine and Epidemiology, Loyola.
You cannot refute them by simply shouting 'wrong', and then presenting *your irrelevant remarks* about some other study, which you don't even understand, and in no way validates your pseudoscientific views.
Not good enough Dr. Winters, not even close. Sorry.
That's why I cited Dr. Acuna, Dr. Tang and Dr. Gill in support of my proposition that race exists.
.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
Instead what you need to do is answer AlTakruri's questions which *were* directed TO YOU.
Here are the answers you requested:
1). What is race (biologically)?
Race biologically is the ability to correlate specific genetic markers to specific racial groups.
2). How many biologically defined races are there?
Tang et al , Acuna et al, and Cruzado have identified four biological races aggregated by genes.
3). List the names of these biologically defined races.
Tang et al , Acuna et al, and Cruzado have identified four biological races using specific genetic markers: white/Caucasian, Afro-American, Hispanic and East Asian. The research of Acuna et al, that found that the Hispanics in South America and the Southwestern U.S.A, make it clear that Hispanic is more than a linguistic term, it also corresponds to a specific racial group.
Race exists.
.
Posted by *Topdog* (Member # 10328) on :
I think we have a misunderstanding of Tang et al's study, it does not measure "race", ie, what we see as physical distinctions. There is no way a person can discern what another person looks like by examining their genes. There is no "Afro-American" genetic race, there is no Hispanic race, those are merely "social" ethnic labels. The African-American and Hispanic genepools are composed of various elements, with ancestry from Africa, Europe, and Native North America, there I no way you can define a race that way genetically. A "racial" label isn't the same as an ethnic label, the two are *NOT* mutually inclusive.
"make it clear that Hispanic is more than a linguistic term, it also corresponds to a specific racial group"
-- Sorry, I cannot agree here. Hispanics from the Southwestern US are mostly Native American in ancestry and South American "Hipansics" can be anything from white Argentinians to some Black Colombians and Brazilians. Hispanics could also be "black" Dominicans like Sammy Sosa and Pedro Martinez to "white" Puerto Ricans like Ricky Martin, Hispanic is *NOT* a race and it cannot be defined genetically Mr Winters, I'm shocked that you would make such a conclusion.
Posted by *Topdog* (Member # 10328) on :
On forensic anthropology for Clyde Winters:
Forensic anthropology has been much more reluctant to divorce itself from the premodern partitioning of human biological variation into races (Smay and Armelagos 2000), despite the fact that human biological variation in genetic markers (Lewontin 1972, Stoneking 1993) and cranial morphology (Relethford 1994) is quantitatively greater within than between major geographic regions or races. Pressure from local law enforcement officials who insist on “knowing” the social race of unknowns may prompt some forensic anthropologists to designate racial affinity (provided that the sex of the individual can be determined), producing classifications that some have called “bureaucratic races.” However, the use of forensic tools to determine ancestry must assume that a given cranium is more similar to those of the ascribed population than to those of any other (e.g., Byers 2002). The fact that populations are variably defined as geographic regions, islands, countries, reproductive isolates, languages, cultures, or race categories may severely limit the reliability of such diagnoses."
Forensic Misclassification of Ancient Nubian Crania: Implications for Assumptions about Human Variation frank l’engle williams, robert l. belcher, and george j . armelagos
Now Mr Winters, one can see clearly see the reason why Gill(a 'forensic' anthropologist) believes in "race" and why 'physical' anthropologists like Keita, Brace, Armelagos and Hiernaux do *NOT*. The former(forensic anthros) have pressure from law enforcement which forces them to submit to the biological "race" paradigm, while physical anthropologists don't because they're not under the same pressure.
Posted by Clyde Winters (Member # 10129) on :
Topdog
quote: There is no way a person can discern what another person looks like by examining their genes. There is no "Afro-American" genetic race, there is no Hispanic race, those are merely "social" ethnic labels.
What research have you conducted that disputes the findings of Tang et al. Do you really believe that a referreed journal would publish this paper without checking the facts?
.
Posted by Clyde Winters (Member # 10129) on :
Topdog
quote:
Now Mr Winters, one can see clearly see the reason why Gill(a 'forensic' anthropologist) believes in "race" and why 'physical' anthropologists like Keita, Brace, Armelagos and Hiernaux do *NOT*. The former(forensic anthros) have pressure from law enforcement which forces them to submit to the biological "race" paradigm, while physical anthropologists don't because they're not under the same pressure. --------------------------------------------------------------------------------
This may be true but it does not diminish the fact that these scientists believe race exist.
If you check out the page discussing Dr. Brace's view on race, you will find that they also mention Dr. Gill. The purpose of my post have been to acknowledge many scientists are using biology to illustrae that races exists.
.
Posted by Clyde Winters (Member # 10129) on :
Topdog I believe in one of your post you mentioned the fact you were still in school. I am sure if you are in graduate school, eventhough , your professors may discuss a pet theory or two, they always teach you both the pros and cons relating to that theory.
That's what I am doing on this thread I am trying to make people aware of the fact that race is not dead. If someone was to read this forum they would go to a conference and maintain that race is not studied by scientists. The novices who made such a claim would be laughed at, because as I have tried to show in these pages their are two sides to the issue of biological races.
This debate will probably continue but my sole purpose is to alert readers to the obvious reality that most issues have more than one side: pros and cons exist for most scientific ideas and concepts.
.
Posted by Mansa Musa (Member # 6800) on :
quote:Originally posted by Clyde Winters: What research have you conducted that disputes the findings of Tang et al. Do you really believe that a referreed journal would publish this paper without checking the facts?
.
I don't think it is a matter of disputing the research but of interpreting what it concludes.
It is important to make note of what it means and what it doesn't mean.
quote:Originally posted by Clyde Winters:The purpose of my post have been to acknowledge many scientists are using biology to illustrae that races exists.
If the topic of this thread is really about whether or not some scientists believe race exists in a biological sense that is demonstrably proven to be true.
I don't think Topdog intended the theme of this thread to be a refutation of that claim only as Templeton says, that the theories of race as a coherent biological entity have been disproven.
In the case of Tang et al. the research does not support the existence of such an entity. What we've been saying all along is that the self-identified constructs used are not biological entities they are socio-political entities used to cluster people by geographic ancestry.
They do not prove the concept of race to be scientifically valid.
In any case do some scientists believe race exists as a biological entity and that there research can support it (as is the case with Gill)?
Yes.
Do some scholars use racial terms in published scientific literature?
Yes.
That is not in dispute, atleast not by me and most people I have seen posting in this thread.
But does this prove the scientific validity of race as a concept?
No.
It does not prove the scientific validity of race as a concept.
Posted by Clyde Winters (Member # 10129) on :
Mansa Musa
quote:
In the case of Tang et al. the research does not support the existence of such an entity. What we've been saying all along is that the self-identified constructs used are not biological entities they are socio-political entities used to cluster people by geographic ancestry.
They do not prove the concept of race to be scientifically valid.
In any case do some scientists believe race exists as a biological entity and that there research can support it (as is the case with Gill)?
Yes.
Do some scholars use racial terms in published scientific literature?
Yes.
That is not in dispute, atleast not by me and most people I have seen posting in this thread.
But does this prove the scientific validity of race as a concept?
No.
It does not prove the scientific validity of race as a concept.
This is a contradictory statement. A scientist can not confirm that race exists as a biological entity, and yet race lacks validity as a concept.
If it is found to be a biological entity as in the work of Tang et al, Acuna et al and Gill, it has validity.
.
Posted by Mansa Musa (Member # 6800) on :
quote:Originally posted by Clyde Winters: This is a contradictory statement. A scientist can not confirm that race exists as a biological entity, and yet race lacks validity as a concept.
If it is found to be a biological entity as in the work of Tang et al, Acuna et al and Gill, it has validity.
.
In the case of Tang et al. it is not a biological entity but a socially constructed one.
Tang's study is inconsistent with the biological concept of race.
The self-identified constructs themselves belie the concept of race and this has been explained to you countless times.
Posted by rasol (Member # 4592) on :
^ Correct, nor does Tang claim otherwise with regards his own study. Only Winters claims this - 'about Tang', which means nothing.
Posted by Djehuti (Member # 6698) on :
Let me make things just a tad bit easier for Clyde.
Yes, the people below are not in denial like 'Arab' Sudanese and do in fact proudly identify themselves as 'black'...
So tell us, what 'racial' group are they a part of, Clyde??
Posted by Clyde Winters (Member # 10129) on :
Mansa Musa
quote:
The self-identified constructs themselves belie the concept of race and this has been explained to you countless times.
This is false. The subjects of the study had to choose membership in a race. They could do this because they recognized membership in a particular racial group before they participated in the study.
These races have been established by governmental officials in the USA, who developed the racial categories represented on most official forms.
Once the subjects of the study self-selected the race they belonged too Tang et al adminstered genetic test and analyzed their data. The ability of Tang et al to find that " Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity".
Once Tang et al found genetic markers for these self-described races, we had the biological justification for race because, the subjects of the study were aggregated into racial groups they had correctly categorized themselves.
.
Posted by Mansa Musa (Member # 6800) on :
quote:Originally posted by Clyde Winters: These races have been established by governmental officials in the USA, who developed the racial categories represented on most official forms.
This topic has become beyond redundant Dr. Winters.
The text in bold is the crux of the issue.
These categories are rooted in socio-political themes that are bound by political and cultural boundaries.
They are NOT rooted in natural science.
This is what anthropologists and geneticists say in response to your contentions (which Tang et al. do not themselves support):
Race is not a concept that emerged from within modern genetics. By ignoring its cultural meaning the reductionist narrative about race fails--both in the narrow terms of science and as a contribution to the broader social discourse. - Cooper RS
quote:First, it is perfectly true that the long-term residents of the various parts of the world have patterns of features that we can easily identify as characteristic of the areas from which they come. It should be added that they have to have resided in those places for a couple of hundred thousand years before their regional patterns became established. Well, you may ask, why can't we call those regional patterns "races"? In fact, we can and do, but it does not make them coherent biological entities. "Races" defined in such a way are products of our perceptions......
There is nothing wrong with using geographic labels to designate people. Major continental terms are just fine, and sub-regional refinements such as Western European, Eastern African, Southeast Asian, and so forth carry no unintentional baggage. In contrast, terms such as "Negroid," "Caucasoid," and "Mongoloid" create more problems than they solve. Those very terms reflect a mix of narrow regional, specific ethnic, and descriptive physical components with an assumption that such separate dimensions have some kind of common tie. Biologically, such terms are worse than useless.Their continued use, then, is in social situations where people think they have some meaning.
Geneticists have long agreed there is no genetic basis to race -- only to ethnic and geographic groups. - Peter Underhill
Your repetition of the same fallacious argument is useless.
Arguing from repetition is not a rebuttle.
You have not adequetely answered the questions from AlTakuri that would progess this discussion and instead fallen into reiterating rhetoric under a fallacious premise that Tang et al.'s study prove the scientific validity of race when it does not.
This is pseudoscientific reasoning.
Pseudoscience attempts to persuade with rhetoric, propaganda, and misrepresentation rather than valid evidence (which presumably does not exist). - Rory Coker, Ph.D. Posted by rasol (Member # 4592) on :
quote: Mansa Musa The self-identified constructs themselves belie the concept of race and this has been explained to you countless times.
quote:Winters writes: This is false.
Actually Mansa Musa is correct. When genetic clusters can be made to correspond to variable subjective social catagories it does indeed belie the notion of race.
The same is true when it contradicts said social catagories.
The only way in principal to affirm the notion of biological race - is to proclaim universal 'objective' race typologies and then show sharp divisions amongst 'all' peoples of the world who would then fit wholey within these identical, objective - catagories.
Because 'race typology' has failed this test time and time again, biologists have stated that race is not scientific.
As for Winters, he can't even answer a simple direct question - requiring him to name these catagories, much less affirm them.
Winters attempts to contradict modern science is mere uniformed smoke blowing - via the internet.
Posted by rasol (Member # 4592) on :
quote:Originally posted by Clyde Winters: Here are the answers you requested:
fallacy ad nauseum.
repeating non answers is not answering.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
Actually Mansa Musa is correct. When genetic clusters can be made to correspond to variable subjective social catagories it does indeed belie the notion of race.
This is absolutely false. The ability to correlate genetic markers to racial categories makes race biological.
You and Mansa Musa have repeated the same tired sources over and over again, Brace, Underhill and etc who claim race doesn't exists. I have presented counter sources Gill, Acuna, Cruzano and Tang that have proven biologically that race does exists.
The definition of biology is: "the scientific study of living things". My sources represent scientist who are not talking theory. These scientists have done original research that prove race exists. As a result of their research we know three things:
1) Race is biological in the United States because the genetic research of Tang et al, indicates that there are four biological races recognizied through the genetic markers corresponding to self-reported race/ethnicity categories.
2) This biological reality was determined through scientific means, since the researchers found genetic markers correlating with the four races. You can not find genetic markers if you do not use scientific methods.
3) The ability to find genetic markers associated with these self-reported race/ethnicity categories confirms the existence of these races.
Acuna, Gill and Tang make it apparent that races are determined by genetic markers and bones .
.
Posted by rasol (Member # 4592) on :
quote:This is absolutely false. The ability to correlate genetic markers to racial categories makes race biological.
Non-sequitur, correlation is not cause and effect, and self identified ethnic groups are not biological races.
quote:You and Mansa Musa have repeated the same tired sources over and over
Emotive language fallacy that seeks to evade addressing said sources.
quote:Brace, Underhill and etc
Yes etc.. Harvard molecular geneticist Spencer Wells, Alan Templeton, Shomarka Keita, George Armelagos, Rick Kittles, The American Anthropological Association, etc. etc. etc.
Not only can you not refute ANY of the above, but you have no background in anthropology and extremely POOR comprehension of the subject.
quote:I have presented counter sources
Your sources range from weak to imaginery.
Weak: Gill makes claims but has done no peer review study verifying his claims.
Imaginary: Tang is completly misread by you, and so doesn't support your scientifically illiterate claims. This is why you in fact attempt to 're-write' him, moreso than quote him.
quote:The definition of biology
...is irrelevant. You were asked to produce a definition of race. You produce a circuluar argument which assumes the concept of race 'within' the definition.
That is argumentative fallacy and failure on your part.
quote:1) Race is biological in the United States
1) Unless humans only live in the united states this is non-sequitur. Biological truth must be the same regardless of political culture. If the united states must be used as a qualifier then race is in fact not biological, but cultural.
quote:2)Tang et al, indicates that there are four biological races
2) ad nauseam fallacy - tang makes no such claim. you make this claim but cannot prove it.
quote:corresponding to self-reported race/ethnicity categories.
Self reported ethnicity is culture, not biology
quote:You can not find genetic markers if you do not use scientific methods.
Non sequitur, the existence of discrete biological markers in population groups does not prove race.
case in point:
In southern Sudan the primary paternal lineage is haplogroup A and E-M35, there is no E-M2.
In southern Nigeria the primary paternal lineage is E-M2, there is no A and E-M35.
According to your logical fallacy the above is sufficient to 'prove' the existence of 2 distinct races - one southern nigerian and the other southern sudanese.
And moreover the result would not correspond to ethnic catagories within the United States, obviously.
In fact, no such conclusion is warranted.
Nothing has been proven beyound the existence of distinct genetic marker frequendcies within different population groups.
Dr. Winters has proven nothing other than his inability to understand genetics, and his inability to formulate a coherent argument.
Posted by rasol (Member # 4592) on :
quote:Originally posted by Djehuti: Let me make things just a tad bit easier for Clyde.
Yes, the people below are not in denial like 'Arab' Sudanese and do in fact proudly identify themselves as 'black'...
So tell us, what 'racial' group are they a part of, Clyde??
Your question is valid, and the answer should be easy.
But it is not for those ideologically addicted to typological race.
Such catagories are nonsensical and it is finally not possible to speak sensibly about them.
What race-fantacists can do however, is *ignore* the contradictions in their own discourse.
But ignoring contradictions does not make them disappear.
So tell us, what 'racial' group are they a part of, Clyde??
Your question is valid, and the answer should be easy.
But it is not for those ideologically addicted to typological race.
Such catagories are nonsensical and it is finally not possible to speak sensibly about them.
What race-fantacists can do however, is *ignore* the contradictions in their own discourse.
But ignoring contradictions does not make them disappear.
First of all I am proud to say that I belong to the Afro-American race. The only race to be slaves and attain status over time to exceed that of their former masters.
Your arguments are totally without merit. You have posted the same tired protaganists of the race theory. These people can not be compared to Acuna, Gill and etc., who have conducted primary research and found that genes correlate with race. None of these researchers have disconfirmed the research of Acuna, Gill and Tang. This makes your arguments groundless and absent any validity.
Race exists.
.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
Nothing has been proven beyound the existence of distinct genetic marker frequendcies within different population groups.
Duh, this is what makes the research of Gill, Tang and Acuna valid. The ability to aggregate people into racial categories through distinct genetic markers is what makes their research scientific and part of the natural sciences .
.
Posted by rasol (Member # 4592) on :
quote:Winters writes: Duh
Your dumbfoundedness is apropo' given your lack of coherence.
quote:Winters: this is what makes the research of Gill, and Tang valid.
Yet another non-sequitur - Gill is not a geneticist. Tang's research does not support your conclusions which are scientifically illiterate.
Given your failure to produce coherent answers to the basic biological questions put to you, it is clear that your ability to interpret scientific papers on genetics is non-existent.
Duh, indeed. Posted by rasol (Member # 4592) on :
quote:First of all I am proud to say that I belong to the Afro-American race.
Fallacy: Appeal to pride, Argumentum ad superbium, the target of this fallacy is encouraged to agree out of pride, such as pride in nation, race, or religion - frequently employed in aid of nationalism, racialism and various other forms of chauvenism
quote:Winters writes: The only race to be slaves and attain status over time to exceed that of their former masters.
That is and incomplete sentense, and incomplete thought, a non-sequitur argument, and inaccurate observation, a form of special pleading, a confession of bias, and a wholey irrelevant argument.
quote: You have posted the same tired protaganists of the race theory.
transference -> the process by which ones own emotions and desires are unconsciously shifted to another person.
Who is the protagonist of race theory Dr. Winters?
You are.
Who sounds tired [fatigued] by repetition of the same logical fallacies which fail to answer any of the questions put by any of the discussants directly to you?
You do.
Continue transferring your guilt and frustrations....
quote: These people can not be compared to Gill and etc. who have conducted primary research and found that genes correlate with race.
False statement as Gill is not a geneticist, and has never conducted any study correlating genes to race. You don't even know this, because you know nothing about Gill beyound the superfluous PBS article you quoted.
This further demonstrates your near complete lack of knowledge on the subject you argue ad nauseum about, and too explains why you can't produce coherent answers to direct questions. Posted by Clyde Winters (Member # 10129) on :
Rasol
quote: Yet another non-sequitur - Gill is not a geneticist. Tang's research does not support your conclusions which are scientifically illiterate.
Given your failure to produce coherent answers to the basic biological questions put to you, it is clear that your ability to interpret scientific papers on genetics is non-existent.
You can't even read I said bones and genes prove that race exists.
I have presented coherent answers to all questions I have been asked, you can't comprehend them because your mind is closed to truth and you've been selling the idea that race dosen't exist on this forum for so long that you have not kept up with the research that indicates that races exist.
I have shown that when the piece by Brace was published the creator of the web site countered this opinion with a discussion of the existence of race by Gill. This makes it clear that since the beginning of the movement to declare that race does not exist, many scientists have maintained race exists.
You have not presented any evidence that you can't determine race by bones and genes. The evidence is clear genes and bones have proven the reality of race for years. In fact, you have not presented one article, that tested the hypothesis that race dosen't exist, which demonstrate through genetic test that you can not aggregate people into races, that disconfirms the research of Tang, and Acuna .
Your posts are just propaganda, and presents no evidence that race can not be determined by genetic markers and bones.
You continue this argument because of your large ego. Ego will not change the fact that genes and bones show that race exists.
.
Posted by rasol (Member # 4592) on :
quote:Winters writes: you have not presented one article, that tested the hypothesis that race dosen't exist
logical fallacy, burden of proof - such as demanding proof of a negative, ie- a study proving tooth fairy does not exist.
quote:rasol: Yet another non-sequitur - Gill is not a geneticist, and has done no work correlating genes to 'race' or anything else.
quote: winters writes: You can't even read.
Logical fallacy - ad hominem, ridicule.
quote:Winters writes: I said bones and genes prove that race exists.
Logical fallacy, non-sequitur and strawman - misdirected argument.
You cited Gill as correlating genes to race. He is not a geneticist and has not done so. Your citation is false.
Challenge: List the genetic studies of George Gill?
Challenge: List 'any study' by Gill that you've actually read.
Posted by rasol (Member # 4592) on :
We'll wait. Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
This further demonstrates your near complete lack of knowledge on the subject you argue ad nauseum about, and too explains why you can't produce coherent answers to direct questions.
Your scientific illiteracy is evident in your failure to produce any research studies that disconfirm the physical anthropological and genetic research that provide the biological basis of race. [b] Your dishonesty is evident in the way you have promoted the idea that race doesn't exist, eventhough you knew full well from the PBS site that there were two sides to the race issue.
This deception will make anyone who attempts to publicly promote this lie, without acknowledging that many scientists continue to believe race exists, look illiterate, the way you look scientifically illiterate and dishonest by presenting on this forum only one side of the debate.
Eventhough you know what you are writing is not based on science--just your desire to make a lie, truth--I will give you another chance to understand why bones and genes confirm that race exists.
The definition of biology is: "the scientific study of living things". My sources represent scientist who are not talking theory. These scientists have done original research that prove race exists. As a result of their research we know three things:
1) Race is biological in the United States because the genetic research of Gill and Tang et al, indicates that there are four biological races recognizied through the genetic markers and bones corresponding to self-reported race/ethnicity categories.
2) This biological reality was determined through scientific means, since the researchers found genetic markers and specific bones correlating to the four races. You can not find genetic markers and bones through primary resaerch that indicate individual races, if you do not use scientific methods.
3) The ability to find genetic markers and bones associated with these self-reported race/ethnicity categories confirms the existence of these races.
Acuna, Gill and Tang make it apparent that races are determined by genetic markers and bones .
My answers to the questions posed in this thread are written in a very simple manner which anyone with any scientific knowledge would understand. You pretend you can't comprehend the answers to this question, so you can maintain the myth that race does not exists.
If you know of a specific article that claims that Dr. Gill has made many mis-analysis, of the race of an individual,please post it now, since you know millions of them exist.
It is time that you back up your propaganda about Dr. Gill with proof.
.
Posted by yazid904 (Member # 7708) on :
I will put aside science and logic for awhile and state that in a 'homogenous' society, like Norway, for example the same range of European characteristic will dominate. Apply the same to Japan and equally the same Asian charactyeristic will be 'similar'.
If we look to places like Brazil, Egypt, Cuba, Libya as examples of hetereogenous populations, you will see within the same families a gradation of physical characteristcs that reflect the ethnicities meaning that examples of what social constructs of 'race' (an Anglo-Saxon identifier) exemplifying as white, black and Indian between family members! For those populations, these are the norm.
For those not familiar with that level of heterogeneity, it would be seen as odd and even unnatural!
Posted by rasol (Member # 4592) on :
quote:Originally posted by Clyde Winters: It is time that you back up your propaganda about Dr. Gill with proof.
^ lol typical. fallacy, burdan of proof
gill is your [alleged] source for your propaganda. [and you continue to transfer your fallacies to others]
but since you actually know nothing about his work, he essentially amounts to a fake reference, for your fraudulent argument.
you keep FAKING.
we're still waiting.....
Posted by rasol (Member # 4592) on :
quote:Winters writes: You can't even read
quote:Originally posted by rasol: Very well Dr Winters, please list 'any study' by Gill that you've actually read.
= debate fraud.
Posted by Clyde Winters (Member # 10129) on :
Yazid924
quote: I will put aside science and logic for awhile and state that in a 'homogenous' society, like Norway, for example the same range of European characteristic will dominate. Apply the same to Japan and equally the same Asian charactyeristic will be 'similar'.
For those not familiar with that level of heterogeneity, it would be seen as odd and even unnatural!
This has nothing to do with race does not exists. All you are saying is that they belong to the same race.
I have presented evidence from Acuna, Tang and Gill that bones and genes confirm that race exists, and that there are at least four identified races in the U.S.A. The fact that they identified these races within the heterogeneity society of the U.S. , provides considerable support to the fact that bones and genes prove race exists.
.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
gill is your [alleged] source for your propaganda. [and you continue to transfer your fallacies to others]
but since you actually know nothing about his work, he essentially amounts to a fake reference, for your fraudulent argument.
you keep FAKING.
we're still waiting.....
...for you to present an article that claims Dr. Gill mis-identified the race of many individuals in his practice . You have presented none.
You are the fake.
.
Posted by Mansa Musa (Member # 6800) on :
quote:Originally posted by Clyde Winters: This has nothing to do with race does not exists. All you are saying is that they belong to the same race.
I have presented evidence from Acuna, Tang and Gill that bones and genes confirm that race exists, and that there are at least four identified races in the U.S.A. The fact that they identified these races within the heterogeneity society of the U.S. , provides considerable support to the fact that bones and genes prove race exists.
They did not "identify" any races.
The categories themselves were already set in stone by government officials as you say.
The fact that these categories which were originally used to denote ancestry based on various attributes such as skin color, geographic origin, language and nationality can be used to cluster groups by specific genetic markers based on geographic ancestry is not evidence that a race has been discovered (i.e. a subdivision of the human species).
The full article for Tang et al. has been provided in this thread.
Please give us the quote where it is stated anywhere that a race was discovered within the research.
Again, here is the abstract and links to the study:
quote:Genetic structure, self-identified race/ethnicity, and confounding in case-control association studies.
Division of Public Health Sciences, Fred Hutchinson Cancer Research Center, Seattle, WA, USA.
We have analyzed genetic data for 326 microsatellite markers that were typed uniformly in a large multiethnic population-based sample of individuals as part of a study of the genetics of hypertension (Family Blood Pressure Program). Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic) and were recruited from 15 different geographic locales within the United States and Taiwan. Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories. Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity. On the other hand, we detected only modest genetic differentiation between different current geographic locales within each race/ethnicity group. Thus, ancient geographic ancestry, which is highly correlated with self-identified race/ethnicity--as opposed to current residence--is the major determinant of genetic structure in the U.S. population. Implications of this genetic structure for case-control association studies are discussed.
quote: present an article that claims Dr. Gill mis-identified the race of many individuals in his practice
fallacy burdan of proof.
we're still waiting for your data of relevance from studies by Gill.
Where is it?
quote:Originally posted by rasol: Dr Winters, please list 'any study' by Gill that you've actually read.
the list is still empty.
so that is what we credit you with.....nothing.
Posted by Clyde Winters (Member # 10129) on :
Mansa Musa
quote: They did not "identify" any races.
The categories themselves were already set in stone by government officials as you say.
The fact that these categories which were originally used to denote ancestry based on various attributes such as skin color, geographic origin, language and nationality can be used to cluster groups by specific genetic markers based on geographic ancestry is not evidence that a race has been discovered (i.e. a subdivision of the human species).
If I remember correctly I stated that Tang et al were able to match specific genetic markers disaggregated along self-identified racial categories. This is biological evidence of race.
The research methods of Tang et al, in determining race is supported Keita, Kittles, et al. Keita and Kettles et al make it clear that you can not use ancestral population DNA to determine "race" because:
quote: They are heterogeneous in their African origins also. Continental African immigrants to the US, including some suprasaharan Africans (e.g., Tunisians and Egyptians) sometimes call themselves 'African Americans', which is true as an epithet but false as a marker of the bioethnic history of those whose ancestors share the experiences of the Middle Passage and slavery. It is this history, and its constituent elements, that are specific to the group. The Middle Passage African descendants, whether in North America or South America, do have a particular biocultural history34.
Yet Keita and Kittles make it clear that when crafting research relating to genetics and identified local human groups, the terminology used to describe the individuals under study should reflect the terms used by the subjects of the study themselves.
quote: It may be necessary to craft specific group identifiers to facilitate good research design2. 'Racial' approaches to identity, as found in Office of Management and Budget directive 15, operate from the Platonic mold that groups so defined would necessarily be genetically the same, and this is false. The New World descendants of Middle Passage Africans, whether found in specifically labeled communities (e.g., African Argentinian, African Mexican, African Venezuelan or African Canadian) or in the 'majority' populations ('mestizos' or 'whites') cannot be lumped with newcomers from the continent under the label 'black' or 'African American'.
'Race' and research Modern human genetic variation does not structure into phylogenetic subspecies (geographical 'races'), nor do the taxa from the most common racial classifications of classical anthropology qualify as 'races' (Box 1). The social or ethnoancestral groups of the US and Latin America are not 'races', and it has not been demonstrated that any human breeding population is sufficiently divergent to be taxonomically recognized by the standards of modern molecular systematics. These observations are not to be taken as statements against doing research on demographic groups or populations. They only support a brief for linguistic precision and careful descriptions of groups under study. Terms and labels have qualitative implications. Detailed description of study populations and their specific histories is advocated. The study of well-defined local populations of demographic groups of the same name should be carried out in order to understand possible gene-environment effects. Likewise, data from nationwide studies on particular demographic groups should always be disaggregated by locale. Local names should replace macrodesignations in studies in order to reflect specific populations. Generalizations that invoke 'genetic' explanations are to be avoided unless they are warranted. All of these have policy implications for health studies. 'Racial' thinking can still be found in scientific literature15. Evolutionary and other biohistorical studies should be model-based and should acknowledge the ongoing legacy of 'racial' thinking. Collaborations with experts in appropriate fields such as historical linguistics, archaeology, ethnology and recent history would improve the quality of multidisciplinary studies.
Keita, Kittles et al, make it clear that "racial thinking can still be found in scientific literature". They prefer to call the local group a population, but they make it clear that local terminology should direct interpretations of the results.They make it clear that any research discussing race and genetics : " Local names should replace macrodesignations in studies in order to reflect specific populations. Generalizations that invoke 'genetic' explanations are to be avoided unless they are warranted. "
This was done by Tang et al. The subjects in the Tang et al study identified themselves as members Hispanic, white and etc, races, in the study, so we can be sure that local names of the subjects in the study reflect the specific racial population under study. Tang et al compared genetic markers to self-identified racial categories held by the subjects in their study.
The method used by Tang et al was state of the art. They note in the abstract of their paper that: Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories.
The finding that the self-idetified race of the subjects correlated with genetic markers prove that subjcts in his study belonged to the white, Hispanic, East Asian and African American races.
This supports the view that race exists.
.
Posted by rasol (Member # 4592) on :
quote:Originally posted by Mansa Musa:
They did not "identify" any races.
The categories themselves were already set in stone by government officials as you say.
Correct, that is why Winters argument is both circular and reductionist.......
Circular arguments assume the conclusion, within the structure of the 'proof'.
Reductionist arguments presume that complex correlations, such as between genes and populations, can be explained by singularities, such as race.
quote: Correct, as noted previously.... Race is not a concept that emerged from within modern genetics. By ignoring its cultural meaning the reductionist narrative about race fails--both in the narrow terms of science and as a contribution to the broader social discourse.
Yes but Keita, Kittles et al note:
'Racial' thinking can still be found in scientific literature15. Evolutionary and other biohistorical studies should be model-based and should acknowledge the ongoing legacy of 'racial' thinking. Posted by rasol (Member # 4592) on :
quote:'Racial' thinking can still be found in scientific literature. Evolutionary and other biohistorical studies should be model-based and should acknowledge the ongoing legacy of 'racial' thinking.
^ correct. Too bad you miss the point......
Modern human genetic variation does not structure into phylogenetic subspecies (geographical 'races'), nor do the taxa from the most common racial classifications of classical anthropology qualify as 'races' (Box 1).
The social or ethnoancestral groups of the US and Latin America are not 'races', and it has not been demonstrated that any human breeding population is sufficiently divergent to be taxonomically recognized by the standards of modern molecular systematics.
By reading Dr. Keita you're at last on the right track, provided you open your mind.
quote: quote:'Racial' thinking can still be found in scientific literature. Evolutionary and other biohistorical studies should be model-based and should acknowledge the ongoing legacy of 'racial' thinking.
^ correct. Too bad you miss the point......
....I got the point race exists.
.
Posted by Mansa Musa (Member # 6800) on :
Honestly Dr. Winters....your quoting of the Keita et al. article support our contentions and correctly interpret what research like Tang et al. mean and what they do not mean.
You even highlighted text that support these conclusions. Posted by Djehuti (Member # 6698) on :
*sigh* 7 pages and 350 posts later and Clyde STILL hasn't proven anything except how utterly easy it is to refute and debunk him! The guy even contradicts himself which is what pseudoscience does.
And so I ask, why do you guys still try to talk sense into Winters, a man who refuses to accept any sense or reality for that matter??..
Then again, if you're doing if for fun I can understand because I'm having a hell of a time thrashing Michael! LMFO Posted by rasol (Member # 4592) on :
^ any discussion that gets people to read Dr. Keita and Kittles - African scientist scholars of the highest order - is worthwhile.
Posted by Mansa Musa (Member # 6800) on :
Now, now Djehuti.
Dr. Winters is MUCH more sensible than Michael.
His arguments are fallacious, the reasoning circular and he is arguing points out of his expertise but at least he is not proposing that skin color classifications such as blue and green in the Sudan are more reliable than one that simply refers to dark skin tones under the term black (the epitome of dark coloring)!
And then propose that even by his own admission such classification are subjective, we should objectively disregard Western standards for this other standard because they are older.
Anyway I understand what Winters is trying to say.
He is saying that since Tang et al. correlated genetic markers with socially constructed self-identified race/etnicity those categories themselves have a basis in biology.
The problem is ofcourse that terms such as African-American are not based in a biological concept but a socio-political one. They do not transcend social and cultural boundaries and so cannot be said to be a biological sub-division the human species.
Winters then goes on to use Gill who is a forensic anthropologist and claims to be able to identify race by skulls to say that "race can be identified through genetic markers and skulls".
The reason this argument fails as most of us know is because:
1. A race has not been "identified" in Tang et al. only genetic markers correlated with preconcieved, socially constructed categories which themselves belie broad concepts of race.
2. Bone Anthropologists have continually misclassified human remains
For instance Gill was on the team that classified Kennewick Man to the racial classification Caucasoid, classifying them as unrelated to the Native Americans once believed to be the indegenious people of the continent (much to the delight of White Supremacists who used this as fuel to spread the belief that White people lived in America before the ancestors of todays Native Americans ).
It was later found that Kennewick Man was actually more related to the Ainu, the aboriginal people of Japan who while themselves have been classed as Caucasian or exhibiting Caucasian affinities are genetically more related to other East Asians than to Europeans.
This is an example of the unreliability of certain methods within physical anthropology to accurately assess population affinities through skeletal remains.
Another example ofcourse would be the reconstruction of King Tut in which forensic anthropologists classified him as Caucasian based on a small nose opening which they identified with Europeans even though such a trait is quite common in NorthEast Africa (the American team working without knowledge that the skull was of Tut accurately identified the skull as African).
It has been well estbalished by scientists such as Keita and Kittles through skeletal analysis and DNA that narrow facial features such as that common in Somali are indegenious to Africa.
These examples falsify the notions of racial classification that forensic anthropologists like Gill rely on.
Posted by Clyde Winters (Member # 10129) on :
Mansa Musa
quote: Honestly Dr. Winters....your quoting of the Keita et al. article support our contentions and correctly interpret what research like Tang et al. mean and what they do not mean.
You even highlighted text that support these conclusions.
I quoted Keita and Kittles et al ,because they support my thesis that race is a part of science. These researchers noted that:
'Racial' thinking can still be found in scientific literature15. Evolutionary and other biohistorical studies should be model-based and should acknowledge the ongoing legacy of 'racial' thinking.
If they note that race is part of the scientific literature they are admitting that race exists in scientific research. They even acknowledge that biohistorical studies should acknowledge the ongoing legacy of 'racial thinking'. This method was expertly illustrated by Tang et al.
Keita. Kettles et al, prefer to call the local group a population, but they make it clear that local terminology should direct interpretations of the results, even if the terms used related to race. Keita, Kittles et al, make it clear that any research discussing race and genetics : " Local names should replace macrodesignations in studies in order to reflect specific populations. Generalizations that invoke 'genetic' explanations are to be avoided unless they are warranted. "
This was done by Tang et al. The subjects in the Tang et al study identified themselves as members Hispanic, white and etc, races, in the study, so we can be sure that local names of the subjects in the study reflect the specific racial population under study. Tang et al compared genetic markers to self-identified racial categories held by the subjects in their study.
Just as Keita, Kittles et al, recognize that race is a part of science literature, Jorde & Wooding noted that: "Clustering of individuals is correlated with geogrphic origin or ancestry. These clusters are also correlated with some traditional concepts of race, but the correlations are imperfect because genectic variation tends to be distributed in a continous, overlapping fashion among populations. Therefore, ancestry , or even race, may in some cases prove useful in the biomedical setting, but direct assessment of disease-related genetic variation will ultimately yield more accurate and beneficial information"
Dr. Francis Collins observered that: 2. Increasing scientific evidence, however, indicates that genetic variation can be used to make a reasonably accurate prediction of geographic origins of an individual, at least if that individual's grandparents all came from the same part of the world3.[b] As those ancestral origins in many cases have a correlation, albeit often imprecise, with self-identified race or ethnicity, it is not strictly true that race or ethnicity has no biological connection.
These papers make it clear that Tang's research is supported by other scientific research.
The method used by Tang et al was state of the art. They note in the abstract of their paper that: Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories.
Jorde, Wooding and Collins supports Tang's methodology of defining local groups by the self-identification .
quote:
Nature Genetics 36, S28 - S33 (2004) Published online: ; | doi:10.1038/ng1435 Genetic variation, classification and 'race' Lynn B Jorde & Stephen P Wooding Department of Human Genetics, University of Utah School of Medicine, Salt Lake City, Utah 84112, USA. Correspondence should be addressed to Lynn B Jorde lbj@genetics.utah.edu
New genetic data has enabled scientists to re-examine the relationship between human genetic variation and 'race'. We review the results of genetic analyses that show that human genetic variation is geographically structured, in accord with historical patterns of gene flow and genetic drift. Analysis of many loci now yields reasonably accurate estimates of genetic similarity among individuals, rather than populations. Clustering of individuals is correlated with geographic origin or ancestry. These clusters are also correlated with some traditional concepts of race, but the correlations are imperfect because genetic variation tends to be distributed in a continuous, overlapping fashion among populations. Therefore, ancestry, or even race, may in some cases prove useful in the biomedical setting, but direct assessment of disease-related genetic variation will ultimately yield more accurate and beneficial information.
Nature Genetics 36, S13 - S15 (2004) Published online: ; | doi:10.1038/ng1436 What we do and don't know about 'race', 'ethnicity', genetics and health at the dawn of the genome era Francis S Collins National Human Genome Research Institute, National Institutes of Health, Bethesda, Maryland 20892, USA. fc23a@nih.gov
Is race biologically meaningless? First, it is essential to point out that 'race' and 'ethnicity' are terms without generally agreed-upon definitions. Both terms carry complex connotations that reflect culture, history, socioeconomics and political status, as well as a variably important connection to ancestral geographic origins. Well-intentioned statements over the past few years, some coming from geneticists, might lead one to believe there is no connection whatsoever between self-identified race or ethnicity and the frequency of particular genetic variants1, 2. Increasing scientific evidence, however, indicates that genetic variation can be used to make a reasonably accurate prediction of geographic origins of an individual, at least if that individual's grandparents all came from the same part of the world3. As those ancestral origins in many cases have a correlation, albeit often imprecise, with self-identified race or ethnicity, it is not strictly true that race or ethnicity has no biological connection. It must be emphasized, however, that the connection is generally quite blurry because of multiple other nongenetic connotations of race, the lack of defined boundaries between populations and the fact that many individuals have ancestors from multiple regions of the world.
Considered in this context, it is apparent why self-identified race or ethnicity might be correlated with health status, through genetic or nongenetic surrogate relationships or a combination of the two. It is also evident that a true understanding of disease risk requires us to go well beyond these weak and imperfect proxy relationships. And if we are not satisfied with the use of imperfect surrogates in trying to understand hereditary causes, then we should not be satisfied with them as measures of environmental causation either.
.
Posted by Clyde Winters (Member # 10129) on :
Mansa Musa
quote:
His arguments are fallacious, the reasoning circular and he is arguing points out of his expertise but at least he is not proposing that skin color classifications such as blue and green in the Sudan are more reliable than one that simply refers to dark skin tones under the term black (the epitome of dark coloring)!
And then propose that even by his own admission such classification are subjective, we should objectively disregard Western standards for this other standard because they are older.
You're full of it. I have already posted quotes from your idols Keita and Kittles that admit race exists yet you continue to ignore this evidence.
I have admitted that researchers note that race should be determined by the people in their own locale, who will make the determination what race they belong too.
You have presented no evidence at all that race is no longer part of scientific research and discourse. As noted by Keita, Kittles et al:
'Racial' thinking can still be found in scientific literature15. Evolutionary and other biohistorical studies should be model-based and should acknowledge the ongoing legacy of 'racial' thinking.
It is strange indeed that eventhough your research Icons admit race is part of the scientific literature, you continue to claim otherwise. This dogmatic behavior is unbecoming of your usual post.
.
Posted by rasol (Member # 4592) on :
quote:They support my thesis that race is a part of science.
Dismissing your egocentrism [and intellectual insecurity], it is more that Keita and Kittles are saying that race is not scientific [biological] but rather socio-political, and that science does not exist in a vacuum that can blithly disregard socio-political realities.
It is actually the opposite of the reductionist racialism involved in formally catagorising all people as belong to discrete racial groups.
However, I take your need to rationalise your discourse to make it less conflicted with 21st century science as sign of progress.
Good for you. Posted by Mansa Musa (Member # 6800) on :
quote:Originally posted by Clyde Winters: It is strange indeed that eventhough your research Icons admit race is part of the scientific literature, you continue to claim otherwise.
Non-sequitur.
I never said that the concept of race was not used in scientific literature and even stated that it was, but that such an issue was not what the focus of this discussion is turning into.
I stated this quite clearly on the previous page.
Posted by Clyde Winters (Member # 10129) on :
Mansa Musa
quote: Bone Anthropologists have continually misclassified human remains
For instance Gill was on the team that classified Kennewick Man to the racial classification Caucasoid, classifying them as unrelated to the Native Americans once believed to be the indegenious people of the continent (much to the delight of White Supremacists who used this as fuel to spread the belief that White people lived in America before the ancestors of todays Native Americans ).
It was later found that Kennewick Man was actually more related to the Ainu, the aboriginal people of Japan who while themselves have been classed as Caucasian or exhibiting Caucasian affinities are genetically more related to other East Asians than to Europeans.
You will do anything to win an argument even lie on researchers. You claim that Dr. Gill classified Kennewick man as caucasian this is untrue as noted in the article you cited in your post.
quote:
George Gill, a forensic anthropologist at the University of Wyoming and one of the plaintiffs in the Kennewick Man case, said evidence indicates that seafaring people from Southeast Asia or Polynesia could have reached the Americas by traveling along the Pacific Rim, landing somewhere in what is now South America. He said an ancient European people could also have reached the northeast corner of North America.
Dr. Gill said that he believed that ancestor of this skeleton came from Asia.
You name Dr. Brace as your hero in not using race in his studies. But it was Dr. Brace who claimed that the skeleton was related to the caucasian Ainu.
Though several scientists are at odds over many details, they have theorized that Kennewick Man is actually a relative of the Ainu people of northern Japan. Sometimes dubbed the "American Indians of Japan," the Ainu are an ethnic group with Caucasian-like features that lived on the islands for an indefinite period before the ancestors of the modern Japanese invaded the island from the Korean peninsula. "(Kennewick Man) is undoubtedly related to the Ainu in Japan," said C. Lording Brace, a professor of anthropology at the University of Michigan, one of the plaintiffs seeking to study the remains. Though disputed by other scientists, Brace insists that modern ethnic characteristics were very much the same during the time of Kennewick Man. Brace uses the method of dental pathology as evidence to this point.
^ Actually Dr. Winters Mansa Musa is correct, Ainu are not related to Europeans genetically. CaucaZoid Ainu, like Mongoloid Khoisan is and old race-myth...
quote:Mansa Musa: It was later found that Kennewick Man was actually more related to the Ainu,
Indeed excellent example Mansa Musa.
Cavelli Sforza was shocked to discover the Ainu were closely related to other Japanese and East Asians and genetically showed none of the presumed relatedness to Europeans.
He was forced to conclude:
It seems reasonable to discard the myth of caucasoid origins for the Ainu - Sforza, History/Geography of Genes, p. 232
Posted by Clyde Winters (Member # 10129) on :
Mansa Musa
quote:
I never said that the concept of race was not used in scientific literature and even stated that it was, but that such an issue was not what the focus of this discussion is turning into.
Well what are we arguing about. Acuna, Collins, Keita, Kittles et al, Jorge & Wooding, Cruzano and Tang et al all maintain that there are genetic markers that correlate with race. Keita, Kittles et al, make it clear that when conducting research you must make a "detailed description of study populations and their specific histories is advocated. The study of well-defined local populations of demographic groups of the same name should be carried out in order to understand possible gene-environment effects....Local names should replace macrodesignations in studies in order to reflect specific populations".
If you admit race is used in the biological literature which shows that genetic markers correlate with the self-identified race of individuals,why do you continue to claim that race doesn't exist.
.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
Cavelli Sforza was shocked to discover the Ainu were closely related to other Japanese and East Asians and genetically showed none of the presumed relatedness to Europeans.
He was forced to conclude:
It seems reasonable to discard the myth of caucasoid origins for the Ainu - Sforza, History/Geography of Genes, p. 232
Maybe somebody needs to tell Dr. Brace.
.
Posted by rasol (Member # 4592) on :
quote:Well what are we arguing about.
We aren't arguing.
We did ask many questions that you didn't answer.
So, it's less that we're arguing, than that you aren't answering.
Doesn't stop you from 'talking' though does it? Posted by rasol (Member # 4592) on :
quote:Maybe somebody needs to tell Dr. Brace.
Brace has made mistakes. If you read his article in in the PBS source you quoted he talks about sickle cell originating in the mid-east and spreading back to Africa.
Now, there is and interesting history of race mythology and how and why this notion came to be - but that's off topic.
Modern genetics recently destroyed this view, and revealed that the Europeans have sickle cell due to genes that originate in Africa, not in the middle east.
But none of this helps you. Answering the questions you were asked, might.
Posted by Mansa Musa (Member # 6800) on :
quote:Originally posted by Clyde Winters: You will do anything to win an argument even lie on researchers. You claim that Dr. Gill classified Kennewick man as caucasian this is untrue as noted in the article you cited in your post.
You have to read the articles carefully Dr. Winters.
In bold text from your quote Gill is merely saying that there is evidence of seafaring people from SouthEast Asia and Polynesia coming to America (in contrast to the Bering Trait theory in which Native Americans came exclusively from Siberia).
He also proposes that ancient Europeans could have come also.
He has in fact in past research attributed Kennewick Man to a descendant of Caucasoid migrants to ancient America.
Here is another article:
quote:George Gill, UW professor and specialist in forensic anthropology, says the skeleton, known as "Kennewick Man," is believed to have a caucasoid bone structure and is not an ancestor of the tribe claiming it. He and four other physical anthropologists, who specialize in the biology of early peoples, and three archaeologists, who specialize in prehistory, want to study the skeleton before its reburial.....
Gill says his primary research interest is "modern peoples and their immediate ancestors." He has studied 7,500 year-old remains recovered from the north central Plains and 5,000 year-old remains from Nebraska.
"Examining these earliest remains shows me that some were Caucasian," he says. "Many people assume that the earliest people in North America were the same in physical appearance as the later Americans at the time of European contact. I believe some were not."
....
Gill says archaeologists can prove the existence of people in North America as far back as 12,000 years ago. His research article on "Human Skeletal Remains on the Northwestern Plains," published in the 1991 edition of the book "Prehistoric Hunters of the High Plains," indicates that the region originally was inhabited by individuals with caucasoid traits. This may explain the bone structure of Kennewick Man.
I did not lie on Dr. Gill as you claim, you simply misread the material and were unaware of his past research...again.
And as far as Brace is concerned in your own quote from the previous article he is one of the people who quarreled with researchers like Gill about the physical traits of Kenewick Man insisting based on dental traits that they were very similar to modern Ainu.
For the record I do not regard Brace as "my hero".
He is a respected scholar, but he has written erroneous articles in the past such as one titled "Clines and Clusters" in which he grouped Ancient Egyptian skeletons with Neolithic Europeans and away from "Sub-Saharan Africans" (which he confined to West/Central Africans excluding groups like Somalis who are also Sub-Saharans putting them in their own category).
Though he denounces the scientific validity of race this article fueled the old racist myth of "true negroes" and "Caucasoid/Hamites" which Eurocentrists such as Mary Lefkowitz and her cohorts used in their book "Black Athena Revisted" to deny that Ancient Egyptians were black Africans.
Anti-Afrocentrists, White Supremacists, Medicentrists (such as the notorious Evil Euro who plagued this board) also used the research for their agendas.
Ask EgyptSearch posters how many times they have seen this study refenced and this chart posted:
Brace has acknowledged the errors of his past scholarship.
He is not someone I regard as a "hero" to be followed blindly but as a respected scientists capable of making mistakes like anyone else.
The question is does he acknowledge errors like a true scientists or does he, ignore them and continue an agenda citing only data that agrees with him?
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
We did ask many questions that you didn't answer.
So, it's less that we're arguing, than that you aren't answering.
Here are the answers to your questions.
1) Race is biological in the United States, especially in relation to the study of forensics and health among diverse races in the U.S.A., as noted by Kieta, Kittles et al, Collins and Jorde & Wooding. The research of Gill and Tang et al, indicates that there are four biological races recognizied through the genetic markers and bones corresponding to self-reported race/ethnicity categories.
2) This biological reality was determined through scientific means, since the researchers found genetic markers and specific bones correlating to the four races. You can not find genetic markers and bones through primary resaerch that indicate individual races, if you are not using scientific methods.
3) The ability to find genetic markers and bones associated with these self-reported race/ethnic categories confirms the existence of these races.
Jorde & Wooding, Collins, Acuna, Gill and Tang make it apparent that races are determined by genetic markers and bones . Keita, Kittles et al, make it clear that "Evolutionary and other biohistorical studies should be model-based and should acknowledge the ongoing legacy of 'racial thinking'".
My answers to the questions posed in this thread are written in a very simple manner which anyone with any scientific knowledge would understand. You pretend you can't comprehend the answers to these question, so you can maintain the myth that race does not exists.
.
Posted by Clyde Winters (Member # 10129) on :
Mansa Musa
quote:
Gill says archaeologists can prove the existence of people in North America as far back as 12,000 years ago. His research article on "Human Skeletal Remains on the Northwestern Plains," published in the 1991 edition of the book "Prehistoric Hunters of the High Plains," indicates that the region originally was inhabited by individuals with caucasoid traits. This may explain the bone structure of Kennewick Man.
Source: Science Blog.com
I did not lie on Dr. Gill as you claim, you simply misread the material and were unaware of his past research...again.
^ According to the scientist quoted above races can be disaggrgated by genetic markers.
Posted by rasol (Member # 4592) on :
^ rotfl. What a mess. Get some rest Dr. Winters.
quote:Dr. Winters writes: My bad
Yes, that's been clearly "disaggregated." Posted by Mansa Musa (Member # 6800) on :
quote:Originally posted by Clyde Winters: My bad.
Thank you for acknowledging that.
Lying is a very strong word.
quote:Originally posted by Clyde Winters:Race is biological in the United States
Tang et al. is about hypertension and the fact that
Genetic markers can be correlated with socially constructed ethnic categories.
This means that it is possible to use medicine that benefits certain ethnicities.
It doesn't change the fact that the classifications themselves are cultural and belie race typologies, used to categorize all human beings.
Posted by Clyde Winters (Member # 10129) on :
Rasol why are you misrepresenting what I wrote. You know full well I was apologizing to Mansa Musa.
quote:
Mansa Musa
quote:
Gill says archaeologists can prove the existence of people in North America as far back as 12,000 years ago. His research article on "Human Skeletal Remains on the Northwestern Plains," published in the 1991 edition of the book "Prehistoric Hunters of the High Plains," indicates that the region originally was inhabited by individuals with caucasoid traits. This may explain the bone structure of Kennewick Man.
Source: Science Blog.com
I did not lie on Dr. Gill as you claim, you simply misread the material and were unaware of his past research...again.
Clyde Winters quote:
My bad.
You ignore the facts of the matter and will use any underhanded trick imaginable to make it appear that you are right. Face the facts , although Keita and Kittles do not agree with the concept of race they acknowledge that race is still part of science.
No matter what underhanded trick you attempt to perpetrate on this forum, the forensic, and genetic research make it clear that biologically, Race Exists .
.
Posted by rasol (Member # 4592) on :
^ internet addiction exists.
quote:Winters writes: they will use any underhanded trick imaginable
Yes, you've caught on to our VAST CONSPIRACY!
Get some rest silly, you're suffering from signs of being on the internet for too long.
You're going off the deep end!
The only trick we played was to ask you to not quote sources like Gill that you actually know nothing about.
If this were a trick, it'd have to be child psychology since you did exactly what we asked you not to do.
Resulting in 'your bad', which you are now trying to blame on 'us'.
You need to go outside and get some fresh air, too much internet for you Dr. Winters.
ps - now watch him do the opposite of what was suggested.
quote:You know full well I was apologizing to Mansa Musa.
Yes, for calling him a liar, when in fact he has shown patience beyound the realm of reason in trying to educate you - a thankless task if ever there was one.
Posted by Mansa Musa (Member # 6800) on :
Dr. Winters, I think you need to read this paper to understand what Keita and Kittles really mean when they acknowledge that race is used in scientific literature (a claim I for one never denied).
quote:Originally posted by rasol: ^ internet addiction exists.
quote:Winters writes: they will use any underhanded trick imaginable
Yes, you've caught on to our VAST CONSPIRACY!
Get some rest silly, you're suffering from signs of being on the internet for too long.
You're going off the deep end!
The only trick we played was to ask you to not quote sources like Gill that you actually know nothing about.
If this were a trick, it'd have to be child psychology since you did exactly what we asked you not to do.
Resulting in 'your bad', which you are now trying to blame on 'us'.
You need to go outside and get some fresh air, too much internet for you Dr. Winters.
ps - now watch him do the opposite of what was suggested.
ROTFLH Posted by Clyde Winters (Member # 10129) on :
Mansa Musa
quote: Tang et al. is about hypertension and the fact that
Genetic markers can be correlated with socially constructed ethnic categories.
This means that it is possible to use medicine that benefits certain ethnicities.
It doesn't change the fact that the classifications themselves are cultural and belie race typologies, used to categorize all human beings.
I can agree with the statement:"Genetic markers can be correlated with socially constructed ethnic categories", with the addition of the term used by Tang et al: race(s).
I have never tried to claim that these races disaggregated by genetic markers in the Tang et al study should be applied to all human beings. I made it clear that they related solely to the people in the Tang study.
This agrees with Keita, Kittles et al, who made it clear that when conducting research you must make a "detailed description of study populations and their specific histories is advocated. The study of well-defined local populations of demographic groups of the same name should be carried out in order to understand possible gene-environment effects....Local names should replace macrodesignations in studies in order to reflect specific populations".
Jorde & Wooding, Collins, Acuna, Gill and Tang make it apparent that races are determined by genetic markers and bones . Keita, Kittles et al, make it clear that "Evolutionary and other biohistorical studies should be model-based and should acknowledge the ongoing legacy of 'racial thinking'".
This is especially necessary in biomedical research in the United States where many people live, from diverse backgrounds.
Keita,Kettles et al, prefer to call the local group a population, but they make it clear that local terminology should direct interpretations of the results, even if the terms used related to race. Keita, Kittles et al, make it clear that any research discussing race and genetics : " Local names should replace macrodesignations in studies in order to reflect specific populations. Generalizations that invoke 'genetic' explanations are to be avoided unless they are warranted. "
The methodology of Tang et al refering to the subjects of their study as races was not a bad methodology. It matches the research methodology proposed by Keita, Kittles et al.
.
Posted by Djehuti (Member # 6698) on :
^^LOL Rasol's prediction is correct as usual!
Now, if what you say is true Clyde, then why do Dravidian Indians have different markers from those in Africa even though they share many black traits in common??
Posted by Mansa Musa (Member # 6800) on :
quote:Originally posted by Clyde Winters: The methodology of Tang et al refering to the subjects of their study as races was not a bad methodology. It matches the research methodology proposed by Keita, Kittles et al.
Yes, and this is what Brace is talking about in the text below:
quote:First, it is perfectly true that the long-term residents of the various parts of the world have patterns of features that we can easily identify as characteristic of the areas from which they come. It should be added that they have to have resided in those places for a couple of hundred thousand years before their regional patterns became established. Well, you may ask, why can't we call those regional patterns "races"? In fact, we can and do, but it does not make them coherent biological entities. "Races" defined in such a way are products of our perceptions......
There is nothing wrong with using geographic labels to designate people. Major continental terms are just fine, and sub-regional refinements such as Western European, Eastern African, Southeast Asian, and so forth carry no unintentional baggage. In contrast, terms such as "Negroid," "Caucasoid," and "Mongoloid" create more problems than they solve. Those very terms reflect a mix of narrow regional, specific ethnic, and descriptive physical components with an assumption that such separate dimensions have some kind of common tie. Biologically, such terms are worse than useless.Their continued use, then, is in social situations where people think they have some meaning.
The reason that Keita, Kittles et al. stress that local names (self-identified race-ethnicity) should replace macrodesignations in studies in order to reflect specific populations is because broad categories used to classifiy human beings (such as Negroid, Caucasoid, Mongoloid etc.) are inconsistent with the specific populations.
In the case of Hispanics for instance phenotypes are variable.
Someone like Sammy Sosa can identify as Hispanic and be placed in the Hispanic category while someone like Wesly Snipes can identify as African-American and be placed separately in that category, while both of them can be grouped as Negroid.
The self-identified constructs themselves are inconsistent with broad categories that classify human beings and those categories themselves are inconsistent with the various genetic populations of the world because they rely on the assumption that physical appearance always denotes blood relatedness.
This concept has been falsified by modern genetics and bio-anthropology.
Posted by Mansa Musa (Member # 6800) on :
quote:Originally posted by Clyde Winters:
quote:Originally posted by Mansa Musa:
I never said that the concept of race was not used in scientific literature and even stated that it was, but that such an issue was not what the focus of this discussion is turning into.
Well what are we arguing about.
Let me refresh your memory about what I said on one of the previous pages.
quote:Originally posted by Mansa Musa:
quote:Originally posted by Clyde Winters:The purpose of my post have been to acknowledge many scientists are using biology to illustrae that races exists.
If the topic of this thread is really about whether or not some scientists believe race exists in a biological sense that is demonstrably proven to be true.
I don't think Topdog intended the theme of this thread to be a refutation of that claim only as Templeton says, that the theories of race as a coherent biological entity have been disproven.
In the case of Tang et al. the research does not support the existence of such an entity. What we've been saying all along is that the self-identified constructs used are not biological entities they are socio-political entities used to cluster people by geographic ancestry.
They do not prove the concept of race to be scientifically valid.
In any case do some scientists believe race exists as a biological entity and that there research can support it (as is the case with Gill)?
Yes.
Do some scholars use racial terms in published scientific literature?
Yes.
That is not in dispute, atleast not by me and most people I have seen posting in this thread.
But does this prove the scientific validity of race as a concept?
No.
It does not prove the scientific validity of race as a concept.
Posted by Clyde Winters (Member # 10129) on :
Mansa Musa
quote:
If the topic of this thread is really about whether or not some scientists believe race exists in a biological sense that is demonstrably proven to be true.
In the case of Tang et al. the research does not support the existence of such an entity. What we've been saying all along is that the self-identified constructs used are not biological entities they are socio-political entities used to cluster people by geographic ancestry.
They do not prove the concept of race to be scientifically valid.
In any case do some scientists believe race exists as a biological entity and that there research can support it (as is the case with Gill)?
Yes.
Do some scholars use racial terms in published scientific literature?
Yes.
That is not in dispute, atleast not by me and most people I have seen posting in this thread.
But does this prove the scientific validity of race as a concept?
No.
It does not prove the scientific validity of race as a concept.
You can not say: " If the topic of this thread is really about whether or not some scientists believe race exists in a biological sense that is demonstrably proven to be true. " And then turn around and say "it does not prove the scientific validity of race".
This is double talk. And does not relate to the scientific evidence presented in this thread.
Tang et al did not base their disaggregation of the subjects of their study by geographical ancestry, they used genetic markers specific to each racial group.
Mansa Musa
quote:
I don't think Topdog intended the theme of this thread to be a refutation of that claim only as Templeton says, that the theories of race as a coherent biological entity have been disproven.
If this was theme of this thread Templeton's theory has been refuted. Forensic scientists ans health professionals are making it clear that bones and genetic markers prove that race is a biological entity.
It has already been made clear that Gill does not only believe that bones can provide evidence of ones race he has proven this on many occasions. He made a preliminary case that the Kenewick man my be a caucasian but he changed his mind and said he may have been Asia, since Dr. Gill never got to examine the skeletal remains we will never know what race he may be related too.
You can not use racial terms in science and say that they are not scientific this is illogical. It was made clear by Keita, Kittles et al that you can not relie solely on geographical ancestry to illuminate the demographics or race of local populations because of the unique experience of each group once they left their original habitant.
Keita, Kittles et al, make it clear that "racial thinking can still be found in scientific literature". They prefer to call the local group a geographical population, but they make it clear that local terminology should direct interpretations of the results.
They make it clear that any research discussing race and genetics demand: " Local names should replace macrodesignations in studies in order to reflect specific populations. Generalizations that invoke 'genetic' explanations are to be avoided unless they are warranted. "
This was done by Tang et al. The subjects in the Tang et al study identified themselves as members Hispanic, white and etc, races, in the study, so we can be sure that local names of the subjects in the study reflect the specific racial population under study.
Tang et al compared genetic markers to self-identified racial categories held by the subjects in their study.
The method used by Tang et al was state of the art. They note in the abstract of their paper that: Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories.
The finding that the self-idetified race of the subjects correlated with genetic markers prove that subjcts in his study belonged to the white, Hispanic, East Asian and African American races.
Your arguments are not founded on the evidence you can not correlate genes and bones with individuals of different races and reach the conclusion race doesn't exist. The mere fact you can disaggregate individuals into various races through genetic markers and bones, even if they self-identify their race supports but one conclusion: Race Exist.
.
Posted by Djehuti (Member # 6698) on :
As usual, he ignores my question.
quote:Originally posted by Djehuti: ^^LOL Rasol's prediction is correct as usual!
Now, if what you say is true Clyde, then why do Dravidian Indians have different markers from those in Africa even though they share many black traits in common??
But we all know why. Posted by *Topdog* (Member # 10328) on :
This thread is another circular argument circus. Because keita and Kittles et al's talk about racial thinking in their papers doesn't make race a biological reality, especially when the focus of their paper is refuting the race concept. The race concept is simply a figment of antiquated anthropology. There are no Afro-American and Hispanic races, thats simply bogus Clyde and you know it, Tang et al study was more geared in the direction of social races, not authentic biological ones. So far all of your evidence has been based stuff from forensic anthropologist whom you know are biased in perpetuating the race and type concept because of their jobs.
Posted by Clyde Winters (Member # 10129) on :
Topdog
quote: There are no Afro-American and Hispanic races, thats simply bogus Clyde and you know it, Tang et al study was more geared in the direction of social races, not authentic biological ones. So far all of your evidence has been based stuff from forensic anthropologist whom you know are biased in perpetuating the race and type concept because of their jobs.
This is ludicris. Race can not just be a social concept, because Tang et al found that genetic markers disaggregated individuals into self-identified racial groups. The ability of genetic markers to accurately categories people into races indicate that Race Exists.
My evidence comes from forensic anthropologist and geneticist who recognize that genes can disaggregate individuals into races.
.
Posted by Clyde Winters (Member # 10129) on :
Topdog
quote: This thread is another circular argument circus. Because keita and Kittles et al's talk about racial thinking in their papers doesn't make race a biological reality, especially when the focus of their paper is refuting the race concept.
The focus of this paper was not refuting race. It was written to acknowledge that when studying biohealth issues relating to local groups you have to identify these groups based on local demographics.
I quoted Keita and Kittles et al ,because they support my thesis that race is a part of science. These researchers noted that:
'Racial' thinking can still be found in scientific literature15. Evolutionary and other biohistorical studies should be model-based and should acknowledge the ongoing legacy of 'racial' thinking.
If they note that race is part of the scientific literature they are admitting that race exists in scientific research. They even acknowledge that biohistorical studies should acknowledge the ongoing legacy of 'racial thinking'.
Keita. Kettles et al, prefer to call the local group a population, but they make it clear that local terminology should direct interpretations of the results, even if the terms used related to race. Keita, Kittles et al, make it clear that any research discussing race and genetics : " Local names should replace macrodesignations in studies in order to reflect specific populations. Generalizations that invoke 'genetic' explanations are to be avoided unless they are warranted. "
This was done by Tang et al. The subjects in the Tang et al study identified themselves as members of the Hispanic, white and etc, races, in the study, so we can be sure that local names of the subjects in the study reflect the specific racial population under study. Tang et al found that genetic markers were found that disaggreated individuals into self-identified racial categories .
Just as Keita, Kittles et al, recognize that race is a part of science literature, Jorde & Wooding noted that: "Clustering of individuals is correlated with geogrphic origin or ancestry. These clusters are also correlated with some traditional concepts of race, but the correlations are imperfect because genectic variation tends to be distributed in a continous, overlapping fashion among populations. Therefore, ancestry , or even race, may in some cases prove useful in the biomedical setting, but direct assessment of disease-related genetic variation will ultimately yield more accurate and beneficial information"
Dr. Francis Collins observered that:" Increasing scientific evidence, however, indicates that genetic variation can be used to make a reasonably accurate prediction of geographic origins of an individual, at least if that individual's grandparents all came from the same part of the world3.[b] As those ancestral origins in many cases have a correlation, albeit often imprecise, with self-identified race or ethnicity, it is not strictly true that race or ethnicity has no biological connection.
These papers make it clear that genetic markers correlate with race.
.
Posted by Mansa Musa (Member # 6800) on :
quote:Originally posted by Clyde Winters: You can not say: " If the topic of this thread is really about whether or not some scientists believe race exists in a biological sense that is demonstrably proven to be true. " And then turn around and say "it does not prove the scientific validity of race".
This is double talk. And does not relate to the scientific evidence presented in this thread.
Tang et al did not base their disaggregation of the subjects of their study by geographical ancestry, they used genetic markers specific to each racial group.
Let's look at what Tang et al. actually say in their study about the nature of the racial aspect in the study.
Excerpt from Tang et al.:
quote: Overall, our cluster analysis results are completely consistent with previous theoretical predictions regarding the ease of separating these groups on the basis of the number of markers tested (Risch et al. 2002).
Nearly all individuals had a cluster assignment probability of ~1.
Only two subjects had a probability <.95: one of these subjects self-reported as Hispanic but fell into the white genetic cluster, and the other subject self-reported as African American but fell into the white genetic cluster. We note that this analysis was not based on determination of individuals’ “racial” ancestry (e.g., estimating individual European, African, and Native American ancestry for the African American and Hispanic subjects). To do so would require inclusion of the nonadmixed ancestral groups (such as Africans and Native Americans) and the use of the “ADMIX” option of structure. What our results do show is that the (admixed) groups included have approximated within-group random mating sufficiently long enough to give rise to distinct genetic clusters.
There were 12 individuals who reported “other” in response to the race/ethnicity question. Of these individuals, nine were classified genetically in the Hispanic cluster, two in the East Asian cluster, and one in the white cluster. Eight of the nine subjects who fell into the Hispanic cluster were from GenNet (Tecumseh, MI), a site where the recruitment focused on whites. Tracing back to the original interview records we found that, in fact, all eight subjects self-reported as “Hispanic” but were categorized as “other” when included in the pooled data set.
Our study deliberately sampled whites, African Americans, Hispanics, and East Asians; therefore, a more general survey would likely have produced a larger representation of individuals with other self-descriptions (e.g., Native Americans, Pacific Islanders, and South Asians). Nonetheless, our results do reflect an unbiased sampling of individuals who self-describe within the major categories we included..........
In summary, from a very large study of four major racial/ethnic groups within the United States and Taiwan, we found extraordinary correspondence between SIRE and genetic cluster categories but only modest geographic differentiation within each race/ethnicity group. This result indicates that studies using genetic clusters instead of racial/ethnic labels are likely to simply reproduce racial/ethnic differences, which may or may not be genetic. On the other hand, in the absence of racial/ ethnic information, it is tempting to attribute any observed difference between derived genetic clusters to a genetic etiology. Therefore, researchers performing studies without racial/ethnic labels should be wary of characterizing difference between genetically defined clusters as genetic in origin, since social, cultural, economic, behavioral, and other environmental factors may result in extreme confounding (Risch et al. 2002).
Dr. Winters, the Tang et al. study itself clearly does NOT support your contentions and infact supports what we have been saying for the past several pages.
What scholars such as Underhill, Brace, Keita and Kittles who are quoted in this thread say is that there is no genetic basis to race only to ethnic and geographic groups (this would include ethnic groups that are called races, which are social entities confined to cultural and political boundaries, not biological entities).
So in response to your seemingly endless contentions:
1. Population genetics do not support the concept of race being biological (as clearly admitted by Tang et al.).
2. The theory by some forensic anthropologists (such as Gill) that analyzing skeletons can reliably classify humans based on objective racial categories have been falsified by modern bioanthropology and genetics.
In light of these facts what do you have to say? Posted by Clyde Winters (Member # 10129) on :
Mansa Musa
quote: Dr. Winters, the Tang et al. study itself clearly does NOT support your contentions and infact supports what we have been saying for the past several pages.
What scholars such as Underhill, Brace, Keita and Kittles who are quoted in this thread say is that there is no genetic basis to race only to ethnic and geographic groups (this would include ethnic groups that are called races, which are social entities confined to cultural and political boundaries, not biological entities).
So in response to your seemingly endless contentions:
1. Population genetics do not support the concept of race being biological (as clearly admitted by Tang et al.)
2. The theory by some forensic anthropologists (such as Gill) that analyzing skeletons can reliably classify humans into objective racial categories have been falsified by modern bioanthropology and genetics.
In light of these facts what do you have to say?
You can't read. Let's look at the Tang et al quote you posted
Tang et al
quote: In summary, from a very large study of four major racial/ethnic groups within the United States and Taiwan, we found extraordinary correspondence between SIRE and genetic cluster categories but only modest geographic differentiation within each race/ethnicity group. This result indicates that studies using genetic clusters instead of racial/ethnic labels are likely to simply reproduce racial/ethnic differences, which may or may not be genetic. On the other hand, in the absence of racial/ ethnic information, it is tempting to attribute any observed difference between derived genetic clusters to a genetic etiology. Therefore, researchers performing studies without racial/ethnic labels should be wary of characterizing difference between genetically defined clusters as genetic in origin, since social, cultural, economic, behavioral, and other environmental factors may result in extreme confounding (Risch et al. 2002).
The key phrase to read is the following "Therefore, researchers performing studies without racial/ethnic labels should be wary of characterizing difference between genetically defined clusters as genetic in origin" . This statement makes it clear that you can only say a genetically defined cluster is genetic in origin, if there are racial/ethic labels attached to the demographic group.
Absence of race should make the researcher "wary" of claiming genetically defined clusters exist.
Acuna, Collins, Keita, Kittles et al, Jorge & Wooding, Cruzano and Tang et al all maintain that there are genetic markers that correlate with race.
The disclaimer of Tang et al, support Keita, Kittles et al, contention that when conducting research you must make a "detailed description of [the] study populations and their specific histories is advocated. The study of well-defined local populations of demographic groups of the same name should be carried out in order to understand possible gene-environment effects....Local names should replace macrodesignations in studies in order to reflect specific populations".
This is why Tang et al said:" Therefore, researchers performing studies without racial/ethnic labels should be wary of characterizing difference between genetically defined clusters as genetic in origin, since social, cultural, economic,behavioral, and other environmental factors may result in extreme confounding (Risch et al. 2002). "
.
Posted by Mansa Musa (Member # 6800) on :
Can't read?
Look who's talking Dr. Winters.
The paper clearly says that in order for genetic clusters to be properly correlated with genetic origin, the social entities must be clearly defined.
Without the socially constructed labels factors such as "social, cultural, economic,behavioral, and other environmental factors may result in extreme confounding (Risch et al. 2002). "
This is consistent with what people such as Rasol and myself have been saying.
The self-identified categories are limited to cultural and political boundaries.
You are still going in circles Dr. Winters. Misinterpreting the research in a desperate attempt to prove your contentions, which it does not support.
Pseudoscience begins with a hypothesis—usually one which is appealing emotionally, and spectacularly implausible—and then looks only for items which appear to support it. - Rory Coker, Ph.D.
Posted by Clyde Winters (Member # 10129) on :
Mansa Musa
quote:
The paper clearly says that in order for genetic clusters to be properly correlated with genetic origin, the social entities must be clearly defined.
Without the socially constructed labels factors such as "social, cultural, economic,behavioral, and other environmental factors may result in extreme confounding (Risch et al. 2002). "
This is consistent with what people such as Rasol and myself have been saying.
The self-identified categories are limited to cultural and political boundaries.
Clearly you don't know anything about research. The statement that you highlighted , like the quotes I posted from Keita, Kittles et al, relate to research design. In any research you have to control for confounding variables.
Here you are talking about pseudoscience, when you don't even know the basic aspects of scientific research and research design.
Jorde & Wooding, Collins, Acuna, Gill and Tang make it apparent that races are determined by genetic markers and bones . Keita, Kittles et al, make it clear that "Evolutionary and other biohistorical studies should be model-based and should acknowledge the ongoing legacy of 'racial thinking'".
This is especially necessary in biomedical research in the United States where many people live, from diverse backgrounds.
Keita,Kettles et al, prefer to call the local demographic group a population, but they make it clear that local terminology should direct interpretations of the results, even if the terms used are related to race. Keita, Kittles et al, make it clear that any research discussing race and genetics : " Local names should replace macrodesignations in studies in order to reflect specific populations. Generalizations that invoke 'genetic' explanations are to be avoided unless they are warranted. "
The methodology of Tang et al refering to the subjects of their study as races was not a bad methodology. It matches the research methodology proposed by Keita, Kittles et al.
Your post have did nothing to change the fact that race exist.
Posted by rasol (Member # 4592) on :
quote:Mansa Musa: You are still going in circles Dr. Winters.
This is why you should let him have the last word.
He lost this argument pages ago, which is why most discussants have placed him on 'ignore'.
Continuing these circular exchanges simply helps him to evade facing this fact - it's what all those who have lost their arguments do, mindlessly repeat themselves.
Let him lie to himself to salve his wounds and be done with it.
Dr. Winters - go ahead and make your final ineffectual ad nauseum arguments......
Posted by Mansa Musa (Member # 6800) on :
quote:Originally posted by Clyde Winters: Here you are talking about pseudoscience, when you don't even know the basic aspects of scientific research and research design.
This is false, I do understand the basics of scientific methodology.
Not only is this statement unfounded it is also a red herring.
All you did was summarize the importance for controlling variables in research and then add your fallacious conclusions, when the fact remains that self-identified race/ethnicity is based on socio-political themes not biology and therefore cannot be used to measure the scientific validity of sub-divisions of the human species which is essential to proving race exists as a biological reality in human beings.
quote:Your post have did nothing to change the fact that race exist.
Socio-political categories such as self-identified race/ethnicity exist and can be used to cluster groups of people based on geographic ancestry by way of identifying specific genetic markers within the groups.
This is useful in population genetics as was the case with Tang et al.
Population genetics do not prove the scientific validity of biological races as the categories used to cluster are subjective, based not in natural science but in socio-political themes and confined to political and cultural boundaries.
In order to be objective biological entities they would have to transcend these boundaries and be used to sub-divide the human species as a whole, which they do not.
You even acknowledge that they do not but ignore the fact that social race is not the same thing as biological race.
Brace has outlined clearly in his antagonist article on the race issue what all the scholars referenced in this thread (including the erroneous contentions of Gill) amount to:
quote:First, it is perfectly true that the long-term residents of the various parts of the world have patterns of features that we can easily identify as characteristic of the areas from which they come. It should be added that they have to have resided in those places for a couple of hundred thousand years before their regional patterns became established. Well, you may ask, why can't we call those regional patterns "races"? In fact, we can and do, but it does not make them coherent biological entities. "Races" defined in such a way are products of our perceptions......
There is nothing wrong with using geographic labels to designate people. Major continental terms are just fine, and sub-regional refinements such as Western European, Eastern African, Southeast Asian, and so forth carry no unintentional baggage. In contrast, terms such as "Negroid," "Caucasoid," and "Mongoloid" create more problems than they solve. Those very terms reflect a mix of narrow regional, specific ethnic, and descriptive physical components with an assumption that such separate dimensions have some kind of common tie. Biologically, such terms are worse than useless.Their continued use, then, is in social situations where people think they have some meaning.
I agree with Rasol there is no point in engaging you in this circus act any longer.
Your circular arguments have become beyond redundant.
The facts have been presented to you, you simply choose to ignore them and stick to your false conclusions.
You can believe what you want, it's time to look at more constructive threads.
Posted by Clyde Winters (Member # 10129) on :
Mansa Musa
quote:
In order to be objective biological entities they would have to transcend these boundaries and be used to sub-divide the human species as a whole, which they do not.
You even acknowledge that they do not but ignore the fact that social race is not the same thing as biological race.
Social race and biological race is not the same thing.
The researchers I have discussed in this thread have made it clear that you can have race without sub-dividing the human species. Biological race, as proven by Tang et al, Acuna and Cruzano is established by biological/genetic markers.
I presented the facts that bones and genes correlate with race. You simply refuse to ignore the facts eventhough your heroes : Keita and Kittles recognize that race can be biohistorical if the research study is carefully designed.
Jorde & Wooding, Collins, Acuna, Gill and Tang make it apparent that biological races are determined by genetic markers and bones; and that race can be determined on a biological level.
.
Posted by Djehuti (Member # 6698) on :
quote:Originally posted by Djehuti: Let me make things just a tad bit easier for Clyde.
Yes, the people below are not in denial like 'Arab' Sudanese and do in fact proudly identify themselves as 'black'...
So tell us, what 'racial' group are they a part of, Clyde??
![[Wink]](wink.gif)
![[Smile]](smile.gif)
![[Big Grin]](biggrin.gif)
![[Razz]](tongue.gif)
![[Embarrassed]](redface.gif)
You know just as well as I do that the reason why you argue against the FACTS is that they debunk your whole notion of black Dravidians being Africans!!![[Roll Eyes]](rolleyes.gif)
![[Cool]](cool.gif)
![[Frown]](frown.gif)
![[Eek!]](eek.gif)
ROTFL 
