One can only hope Hawass will now allow more DNA testing (which I doubt) to straighten out the relationship issues with some of the Egyptian royalty.
If this test is valid then why can't other DNA tests be attempted, I really dont want to hear the old excuses. If they go back to the NO DNA TESTING/DNA NOT VALID rubbish then one would know this DNA test was just an attempt to embarass Dr Fletcher IMO.
posted
This is a quote from a submission I made on another thread on Jan. 20...
I've just read a report on another on-line discussion group, and a new DNA test has been done on the "Younger Woman". Go to: http://www.cbc.ca/disclosure/archives/040113_nef/test.html After reading this, I would like to hear from everyone concerning what is to be a very revolutionary idea. The test was authorized by Dr. Hawass, and he sent a copy of the results to Discovery. The test proves, through DNA testing, that the "Younger Woman" is a man. If this is accurate, it certainly brings a whole new relmn of speculation to the burial. Who are they?
Posts: 174 | From: Long Beach, CA U.S.A. | Registered: Nov 2003
| IP: Logged |
I think this is great news if Hawass will open up seriously on the Issue of DNA testing for the Royal Mummies.
I think we all have so many questions about all the Royal relationships, if this Testing is now in the very near future huge questions are about to be answered. A very exciting time.
posted
This article is very suspect. I'm completely open to the possibility that the mummy is in fact not Nefertiti, but this site does not prove to me that the mummy is male. It may be male, but I'm going to wait for an official word from Hawass on this DNA report. This should be bigger news, and on more than just this site.
First, the article seems very cynical, almost mocking Fletcher and the Discovery channel. Personally I really don't care, but this is not typical journalism.
Second, the pdf would not open on my machine in any of my web browsers. I got an error saying file couldn't be found or something. Did either of you see it? And if so, could you send it to me.
Also, the facial reconstruction was definitely female. If this mummy is really a male, then does that mean we can not trust facial reconstructions? If the mummy ends up being female after all, does that mean we can't trust DNA test? I've seen modern forensics do facial reconstructions that really look like murder victims for example, but could that be because the artist already had a picture of the person to begin with?
What about the bent right arm? If the mummy is in fact a male, does the bent right arm mean that we are dealing with a male Pharaoh? If this is the case, and seeing as the mummy is probably 18th Dynasty, shouldn't the mummy's DNA match Tut's somewhere along the line? Someone should check this now that we are doing DNA tests right?
This is confusing. I'll be glad when this gets sorted out.
If Hawass will open up verification of this testing to the international community then we may have all those answers.
We know there has been a little feud going on between Hawass/SCA and some British egyptologists so I don't think we can be sure of anything from either side until they allow an impartial party to participate in the aunthentication process, especially with regard to letting some other group perform the DNA testing.
That would be a benificial result of this feud if Hawass will allow impartial others to come in and verify things instead of using his own private methods, we all win then.
However we are talking about Hawass so I won't hold my breathe, this is the second time he has used DNA findings, why doesn't he just open up access to the top DNA labs around the world.
Right now I think everyone is confused and not sure what to believe
What about the bent right arm? If the mummy is in fact a male, does the bent right arm mean that we are dealing with a male Pharaoh? If this is the case, and seeing as the mummy is probably 18th Dynasty, shouldn't the mummy's DNA match Tut's somewhere along the line? Someone should check this now that we are doing DNA tests right?
This is confusing. I'll be glad when this gets sorted out.
The male's DNA doesn't have to match Tut's if the male is Ay or Horemheb. They are not related to Tut by blood.
quote:Originally posted by blackman: The male's DNA doesn't have to match Tut's if the male is Ay or Horemheb. They are not related to Tut by blood.
This is true. If the mummy is one of those two, then Tut's mummy won't tell us anything. But the Yuya and Tuya mummy could possibly give us info on Ay, or maybe even the elder lady if she's Tiye.
quote:Originally posted by Kem-Au: This article is very suspect. I'm completely open to the possibility that the mummy is in fact not Nefertiti, but this site does not prove to me that the mummy is male. It may be male, but I'm going to wait for an official word from Hawass on this DNA report. This should be bigger news, and on more than just this site.
First, the article seems very cynical, almost mocking Fletcher and the Discovery channel. Personally I really don't care, but this is not typical journalism.
Second, the pdf would not open on my machine in any of my web browsers. I got an error saying file couldn't be found or something. Did either of you see it? And if so, could you send it to me.
Also, the facial reconstruction was definitely female. If this mummy is really a male, then does that mean we can not trust facial reconstructions? If the mummy ends up being female after all, does that mean we can't trust DNA test? I've seen modern forensics do facial reconstructions that really look like murder victims for example, but could that be because the artist already had a picture of the person to begin with?
What about the bent right arm? If the mummy is in fact a male, does the bent right arm mean that we are dealing with a male Pharaoh? If this is the case, and seeing as the mummy is probably 18th Dynasty, shouldn't the mummy's DNA match Tut's somewhere along the line? Someone should check this now that we are doing DNA tests right?
This is confusing. I'll be glad when this gets sorted out.
I have always thought the mummy's reconstruction looked male without the accessories. If you use the spin window you can take the image from begining to end of reconstruction. I was just telling someone the other day that without accessories that the mummy actually looks like a guy friend of mine. It is quite possible this mummy could have had some sort of genetic chromosome disease. Have they considered this possibility?
quote:Originally posted by Kem-Au: Good point. But remember that no one yet knows if Tut is Akhenaten's son. They may be brothers, possibly eliminating Yuya from the equation.
The golden mask of King Tut does show a close resembelance to the bust of Queen Tiye so we can fairly assume that they are all in the same family and share genes...
I've also read that Ay may be the father of Nefertiti...
posted
Originally posted by Kem: First, the article seems very cynical, almost mocking Fletcher and the Discovery channel. Personally I really don't care, but this is not typical journalism.
Second, the pdf would not open on my machine in any of my web browsers. I got an error saying file couldn't be found or something. Did either of you see it? And if so, could you send it to me.
Kem, I agree that the article is slanted to discredit Fletcher, but the pdf for the test--which opens just fine for me--shows a report that does not even mention Fletcher, but is concerned with the DNA test on the mummy. It is my understanding that Hawass submitted this report to the SCA, which then released it to the public. I can see of no way that it is "suspect", but is a report of an extremely detailed test. The conclusion of the report, that the mummy is male, makes a shambles of several peoples pre-conceived ideas, and opens up a big question--who are the mummies? Will we ever find the correct naming of them?
Posts: 174 | From: Long Beach, CA U.S.A. | Registered: Nov 2003
| IP: Logged |
quote:Originally posted by Osiris II: The conclusion of the report, that the mummy is male, makes a shambles of several peoples pre-conceived ideas, and opens up a big question--who are the mummies? Will we ever find the correct naming of them?
This is what I hate about Egyptology. For all the trouble they went through to prove the mummy is male, has the idea of finding out WHO the mummy is somehow slipped past their minds? It is still unknown, and I think the greater good that can come out of this is getting a better understanding of the family relationships of the late 18th Dynasty.
posted
The discovery of a mummy believed to be that of Nefertiti has engendered the inevitable debate as to whether or not it is actually the remains of Queen Nefertiti. Whether or not it is the mummy of the celebrity queen or not is irrelevant. It is an Egyptian Royal mummy. This is what Ancient Egyptian royalty looked like (Nefertiti Resurrected). And that, quite simply, is the more important point.
Using DNA to identify the royal personages of Ancient Egypt is of course, useful. The primary focus should, however, be on the history of the Egyptian people as a whole, and not merely that of the elite or celebrity personalities.
posted
I actually agree with you on this point,Wally. People who study Egypt[Kmt] spend too much times on select individuals instead of the life and lifestyle of the commoners. One of my main interest is studying the life of the common people that lived in ancient Kemetian[Egyptian] soceity.
Posts: 8675 | From: Tukuler al~Takruri as Ardo since OCT2014 | Registered: Feb 2003
| IP: Logged |
posted
Sorry to take this back to select individuals, but neo, I just thought about it and the mummy, if male, can not be Ay or Horemheb. It is way too young. The max age the mummy was given was mid-thirties. Hawass has even claimed that the mummy was a teenager. Ay (brother of Tiye? Father of Nefertiti?) would have been much older than his thirties as he outlived both Tiye and Nef. Horemheb reigned for 28 yrs, this after serving in the military under Tut, and possibly even Akhenaten.
Posts: 1038 | Registered: Feb 2003
| IP: Logged |
quote:Originally posted by Kem-Au: Sorry to take this back to select individuals, but neo, I just thought about it and the mummy, if male, can not be Ay or Horemheb. It is way too young.
posted
This is a very interesting subject..and that of one im not too familuar with.
I read about this mummy being discovered and saw only pictures of the mummy and a picture of a neffertiti statue..
my question is..How do we know this mummy is of royal significance?
like i said before im not over familuar with this find nor am i with any certain way the mummy is embalmed being royal compared to a embalmed priest of some kind..
if some one can tell me the differance ie pose of the mummy i would be very greatful
as far as the gender of this particular mummy..im not sure.the face structure does come of somewhat female significance but on the otherhand,can a male not have a femanine look to him? for example david bowie..doesnt exactly look masculine as far as visual looks go..
or maybe we have our first transexual mummy a male that was female to the look..it sounds far fetched and comical but it would still be possible
quote:Originally posted by Cobe: or maybe we have our first transexual mummy a male that was female to the look..it sounds far fetched and comical but it would still be possible
Its often difficult to determine the gender of a mummy which is why other factors like the clothing and belongings of the mummy are looked at the most.
I remember from the Nefertit program on Discovery, that Fletcher mentioned the mummy having double ear piercings. Fletcher downplayed the fact that it was uncommon for women to have double ear piercings in ancient Egypt but now it seems that was a major point against her argument.
posted
You can tell if a mummy is royalty by the folds of the arms across the chest. Different periods from the 18th dyansty to the Ptolomeic period have different placement of the arms,so this is how you can tell if the mummy is royalty or not.
During the 24-27th dyansty many priests in Egypt collected up the various royal mummies to place them in a more secure space to avoid tomb robbers. The cache that Younger Lady was found in was this cache.
However,Neferiti is believed to have been of non-royal ancestry so the arms would probally have been in a normal posture copaired to other royal mummies.
Hope this helps
For more information you might want to check out the book ''Faces of the Pharoahs'' by Robert Parthiage. Salim Ikram also writes about the various postures of royal mummies.
To determine the sex of a mummy you need to conduct X-ray tests to see if the skeletal reamins are different. The bone structure of a female corpse is much different than a male corpse,and X-raying would be one of the ways we would know the sex.
Posts: 8675 | From: Tukuler al~Takruri as Ardo since OCT2014 | Registered: Feb 2003
| IP: Logged |
posted
Thankyou Ausar for that in depth look into that subject.Ill take a look at that book.. how was this mummies arms folded when she was found?
Posts: 74 | From: London,Essex,United Kindom | Registered: Feb 2004
| IP: Logged |
posted
The gender of this mummy is a troubling question. It had been labeled both male and female long before Dr. Fletcher's claim to have found Nefertiti. This is probably why Hawass and Weeks were initially skeptical.
As far as the position of the arm, this is the most intriguing as the mummy is supposed to have had it's right arm bent across the chest, symbolizing kingship. It'll probably be a while before the truth comes out.
posted
Ok so supposing this mummy isnt Nefertiti..Who is it? Where was the mummy found? and more importantly...why is their no hieroglyph inscriptions..If this mummy is of royal significance then there would be something..and if its not royal..then why was the right arm bent accross the chest?
Posts: 74 | From: London,Essex,United Kindom | Registered: Feb 2004
| IP: Logged |
posted
After watching the discovery video clips on one of them an X-ray shows a metalic object inside Nefertitis mouth..did they extract that metalic object? if so what was it? and if they didnt..why not?
Posts: 74 | From: London,Essex,United Kindom | Registered: Feb 2004
| IP: Logged |
posted
Where has this DNA sample been taken from? Is there any chance that the sample may have been contaminated? It is very possible, unless the sample has been taken from deep within the tissue. Where is Hawass' evidence to say that the sample has been taken from a site where there is absolutly no chance of contamination? Has there been x-ray analysis and bone analysis? There is considerable difference between the male and female skeletons. In some cases, it is better to use more accurate traditional methods of identification rather than methods where there may be a chance of contamination.
Posts: 117 | From: UK | Registered: Feb 2004
| IP: Logged |
posted
This could be resolved by testing all of the Armarna mummies. I think it would make it possible to clear up a number of problems if we could clear some of this up. You would think that both mummies, the young male and the mummy in question are related to Tiye since they are by her side but not neccessarily.
Posts: 5822 | From: USA | Registered: Jan 2004
| IP: Logged |
quote:Originally posted by Rhi_Sarah: Where has this DNA sample been taken from? Is there any chance that the sample may have been contaminated? It is very possible, unless the sample has been taken from deep within the tissue. Where is Hawass' evidence to say that the sample has been taken from a site where there is absolutly no chance of contamination?.
If you read the log of the scientific report of the mummy you can see it says the following...
Type of Sample: 1. Mummified bone (6x6 cm).The inner portian of the bone was used for DNA extraction
2. Mummified soft tissue (2x7 cm)
History of the sample: Tissue samples are taken from mummy No. 61072 (unidentified) which was discovered in the tomb of Amenhotep III (KV35) at Luxor west bank.
It then goes on to say the following..
Type of test: Sex identification by PCR
Scientific background of the test: The polymophism of the human genome provides an excellent mean for discrimination between sexes at the DNA lavel.The development of the PCR (Ploymerase Chain Reaction) for amplifying specific DNA fragment (1,2) has greatly simplified the determination of sex.The Value of PCR for analysis of ancient archaeological samples is that it allows the sex typing of partially degraded DNA samples.Specific primers were synthesized to amplify the centromeric alphoid repeat squencies from both X and Y chromosomes (3).in the present test we have used the following primers:
X3 S'-TATITGGACTCTCTCTGAGGA -3'
X4 S'-TTCTACTACAAGGGTGTTGCA -3'
Y3 S'- GTGTATTCACCTCCGGGAG -3'
Y4 S'- ACAAAAGGTTCAATTCTGTGAG -3'
The X primers aplify a 157 bp fragment and Y primers amplify a 100 bp fragment
posted
Are you basing all your opinions on this one site? Ok, the mummy may be male, but in order to convince me. I will need to see more hard evidence clarifying the fact that the mummy is not a female.
Posts: 117 | From: UK | Registered: Feb 2004
| IP: Logged |
posted
sure enough it is a very mysteriouse subject.
I too would liek to believe that the mummy is indeed female and that of Nefertiti.. but evidence is evidence and until you show me scientific biological evidence that the mummy is that of the female race,Im affraid i will have to say that nefertiti is still resting in piece and the mummy found was that of a male..
which brings new speculation as to who the mummy is if it is so male..
we are 80% sure he/she is of royal significance..but of whome?
posted
It does not neccessarily have to be of Royal significance...high priest maybe? There are so many people it could be. It is most probably of the upper classes, the preservation is very good. Such good preservation would surly not be attained with such a mummification as the lower classes would have been able to afford. At this stage in the investigation, it is important to keep minds open. It could be anybody. It could be Nefertiti, it could be Smenkhare, it could be one of Nefertiti's daughters, it could be a priest. Who is to say we will ever find out. The end result will most probably be based on who makes the best case.
Posts: 117 | From: UK | Registered: Feb 2004
| IP: Logged |
As to the question of who the mummy could possible be--at this time, we have no theories or conclusions. Oh, and by the way, the right arm, though bent, was now attaced to the mymmy when it was found. In fact, there is quite a bit of speculation that it does not belong to the mummy.
Posts: 174 | From: Long Beach, CA U.S.A. | Registered: Nov 2003
| IP: Logged |
posted
damn..thats turned the whole perspective around on the mummy then..
Posts: 74 | From: London,Essex,United Kindom | Registered: Feb 2004
| IP: Logged |
posted
I still reckon it's female, does the DNA of the arm and the DNA of the mummy match up?
Posts: 117 | From: UK | Registered: Feb 2004
| IP: Logged |
posted
have there actually been any investigations into whether the arm and the body are linked by DNA? Or is it just speculation?
Posts: 117 | From: UK | Registered: Feb 2004
| IP: Logged |
posted
Bone structure is another way to tell the sex of the mummy. An X-ray on the mummy will clear things right up. The only conclusive X-Ray I have ever seen is on the 17,18th and Late Dyanstic mummies. The best canidate for Neferiti still has to be ''Elder lady'' because of it's age is too young to simply be Tiye.
Posts: 8675 | From: Tukuler al~Takruri as Ardo since OCT2014 | Registered: Feb 2003
| IP: Logged |
posted
how old was tiye when she died?? and how old was nefertiti? oh and how old was amenhotep? and what do you think of this little boy?
Posts: 74 | From: London,Essex,United Kindom | Registered: Feb 2004
| IP: Logged |
posted
DNA samples have not been taken on the arm. But just an examonation of the arm and the mummy strongly suggests that they are not from the same person--unless he was a real knuckle--dragger! The mummy of the young boy is throught to be Thutmse, the older brother of Akhenaten, who was supposed to become the ruler, but died st an early age. The questions of Tiye's and Nefertiti's ages when the died is up for grabs--anyone's guess is accepted! IF the mummy of the "Elderly Lady" turns out to be Tiye, it's gonna destroy a lot of theories. The mummy is of a person much younger that Tiye--if she out-lived her husband, Amenhotep III. The possibilty of "Younger Lady" being Nefertiti is, in my opinion, too far-fetched. And besides, the latest test have shown "her" to be a man.
Posts: 174 | From: Long Beach, CA U.S.A. | Registered: Nov 2003
| IP: Logged |
posted
Hey everyone, i'm new to this forum so hope you guys can help!
I'm a student, and i'm doing my Ancient History extension project on Nefertiti and the controversies surrounding her.
I am in doubt as to whether i should believe in the reports by CBC on Dr. Hawass having done the DNA tests and Fletcher not having had proper training. It's part of my project to analyse what information is reliable...so can anyone suggest anything to me?
I just don't understand why the DNA news hasn't been around in other big news websites such as CNN or BBC? Also, Dr Hawass hasn't said he got the DNA results in his own website either.
It'd be great if someone can give me some suggestions as of what to do!Thanks!
Posts: 3 | From: Hong Kong | Registered: Feb 2004
| IP: Logged |
quote:Originally posted by green_appletini: Hey everyone, i'm new to this forum so hope you guys can help!
I'm a student, and i'm doing my Ancient History extension project on Nefertiti and the controversies surrounding her.
I am in doubt as to whether i should believe in the reports by CBC on Dr. Hawass having done the DNA tests and Fletcher not having had proper training. It's part of my project to analyse what information is reliable...so can anyone suggest anything to me?
I just don't understand why the DNA news hasn't been around in other big news websites such as CNN or BBC? Also, Dr Hawass hasn't said he got the DNA results in his own website either.
It'd be great if someone can give me some suggestions as of what to do!Thanks!
This was the reason for my own skepticism. This should've been bigger news. I hope you're a college student, because you have alot of digging to do and you'll need alot of resources. There's a ton of unanswered questions surrounding this, and that DNA report is at the center.
I'd start with Fletcher's program. List out all her points that can be qualified: the age of the mummy, the bent right arm and the gender of the mummy are good starts. But again there are many unanswered questions. But try to find as much as you can that pre-dates Fletchers theories. There was an Egyptologists who noted that the mummy was female, and one that noted it was male, long before Fletcher and Hawass.
The Nubian wig and facial similarities with Nef and the mummy are speculation. How can you measure (and thus prove) something like that? Proving that the mummy is was a female Pharaoh is a good start. The bent right arm could be key to this. I don't know if this helps at all, but it's all I can say right now.
posted
hmm..perhaps they have stummbled onto a bigger discovery than first thought and therefore trying to make a cover up by saying..no this is not neffertiti..its just this unknown mummy..theres no names..no personal belongings..therefore classign the case to the public as..nothing very interesting..
Posts: 74 | From: London,Essex,United Kindom | Registered: Feb 2004
| IP: Logged |
posted
maybe they are no-one special. By special I mean lost royalty! They could just be nobles?
Posts: 117 | From: UK | Registered: Feb 2004
| IP: Logged |
posted
"DNA testing is not always accurate and cannot be done with complete success when dealing with mummies. Until we know for sure that it is accurate, we will not use it in our research." -- Zahi Hawass
quote:Originally posted by Meritaton: "DNA testing is not always accurate and cannot be done with complete success when dealing with mummies. Until we know for sure that it is accurate, we will not use it in our research." -- Zahi Hawass
Why does he contradict himself???
This is so true, an excellent point!
Hawass dismisses other attempts at dna tests as unreliable, and yet he has done them twice and hailed the results as valid. WTF!
This really hurts the credibility of the results IMO.
posted
Previously, Ausar wrote: You can tell if a mummy is royalty by the folds of the arms across the chest. Different periods from the 18th dyansty to the Ptolomeic period have different placement of the arms,so this is how you can tell if the mummy is royalty or not.
Isn't it true, though, that at the time of discovery there was a question posed doubting that the arm was from the mummy found? In fact, it was my understanding that TWO arms were found, and giving this mummy the bent arm was just a preconcieved match. If the bent arm belongs to that mummy, the person had an exceptionally long right arm!
Posts: 174 | From: Long Beach, CA U.S.A. | Registered: Nov 2003
| IP: Logged |
quote:However,Neferiti is believed to have been of non-royal ancestry so the arms would probally have been in a normal posture copaired to other royal mummies.
Does her ancestry matter? After all she was royal by marriage.
[This message has been edited by Meritaton (edited 13 February 2004).]
posted
Hi everyone, i was just wondering if anyone could tell me where i can find some reliable, true information on the background of Dr Fletcher and Hawass?
I'm still in the process of doing my NEFERTITI project and i'm investigating the 2 archaeologists' backgrounds, except a lot of sites are really biased. They either say how wonderful they are..or how bad they are. What kind of training have they had?
Also, it would be great if you all could tell me your thoughts on Fletcher and Hawass. That way i could get a popular view of how people see them.
Thanks!!
Posts: 3 | From: Hong Kong | Registered: Feb 2004
| IP: Logged |
posted
Dr.Joann Fletcher is a free-lance Egyptologist with a PHD in ancient history from Oxford. She served as a bio-anthropology consultant to Dr. Brothwell at Manchester. In the past she has made unprofessional comments about mummy hair and also has no authroity in any field of anthropology. She was never allowed acess to the department at Manchester.
Dr. Zahi Hawass is an Egyptian Egyptologist born in a town in the Delta called Daimetta. He has a PHD in Egyptology with other two degress in geology and Meditterean arcneology. Definatley I would trust Hawass over Dr. Joann Fletcher when it came to questions about Egyptology.
Posts: 8675 | From: Tukuler al~Takruri as Ardo since OCT2014 | Registered: Feb 2003
| IP: Logged |
UBBFriend: Email this page to someone!
Printer-friendly view of this topic