Genetic breakthrough that reveals the differences between humans Scientists hail genetic discovery that will change human understanding
By Steve Connor, Science Editor Published: 23 November 2006
Scientists have discovered a dramatic variation in the genetic make-up of humans that could lead to a fundamental reappraisal of what causes incurable diseases and could provide a greater understanding of mankind.
The discovery has astonished scientists studying the human genome - the genetic recipe of man. Until now it was believed the variation between people was due largely to differences in the sequences of the individual " letters" of the genome.
It now appears much of the variation is explained instead by people having multiple copies of some key genes that make up the human genome.
Until now it was assumed that the human genome, or "book of life", is largely the same for everyone, save for a few spelling differences in some of the words. Instead, the findings suggest that the book contains entire sentences, paragraphs or even whole pages that are repeated any number of times.
The findings mean that instead of humanity being 99.9 per cent identical, as previously believed, we are at least 10 times more different between one another than once thought - which could explain why some people are prone to serious diseases.
The studies published today have found that instead of having just two copies of each gene - one from each parent - people can carry many copies, but just how many can vary between one person and the next.
The studies suggest variations in the number of copies of genes is normal and healthy. But the scientists also believe many diseases may be triggered by an abnormal loss or gain in the copies of some key genes.
Another implication of the finding is that we are more different to our closest living relative, the chimpanzee, than previously assumed from earlier studies. Instead of being 99 per cent similar, we are more likely to be about 96 per cent similar.
The findings, published simultaneously in three leading science journals by scientists from 13 different research centres in Britain and America, were described as ground-breaking by leading scientists.
"I believe this research will change for ever the field of human genetics," said Professor James Lupski, a world authority on medical genetics at the Baylor College of Medicine in Houston, Texas.
Professor Lupski said the findings superseded the basic principles of human genetics that have been built up since the days of Gregor Mendel, the 19th century "father" of Mendelian genetics, and of Jim Watson and Francis Crick, who discovered the DNA double helix in 1953.
"One can no longer consider human traits as resulting primarily from [simple DNA] changes... With all respect to Watson and Crick, many Mendelian and complex traits, as well as sporadic diseases, may indeed result from structural variation of the genome," Professor Lupski said.
Deciphering the three billion letters in the sequence of the human genome was once likened to landing on the Moon. Having now arrived, scientists have found the "lunar landscape" of the genome is very different from what they expected.
Matthew Hurles, one of the project's leaders at the Wellcome Trust Sanger Institute in Cambridge, said the findings show each one of us has a unique pattern of gains and losses of entire sections of our DNA.
"One of the real surprises of these results was just how much of our DNA varies in copy number. We estimate this to be at least 12 per cent of the genome - that has never been shown before," Dr Hurles said.
Scientists have detected variation in the "copy number" of genes in some individuals before but the sheer scale of the variation now being discovered is dramatic.
"The copy number variation that researchers had seen before was simply the tip of the iceberg, while the bulk lay submerged, undetected," Dr Hurles said.
"We now appreciate the immense contribution of this phenomenon to genetic differences between individuals, " he said.
The studies involved a detailed and sophisticated analysis of the genomes of 270 people with Asian, African or European ancestry. It was important to include as wide a sample of the human gene pool as possible.
They found that 2,900 genes could vary in the number of copies possessed by the individuals. The genes involved multiple copies of stretches of DNA up to a million letters of the genetic code long.
"We used to think that if you had big changes like this, then they must be involved in disease. But we are showing that we can all have these changes," said Stephen Scherer of the Howard Hughes Medical Institute in Chevy Chase, Maryland.
But it is also becoming apparent that many diseases appear to be influenced by the number of copies of certain key genes, said Charles Lee, another of the project's leaders at the Brigham and Women's Hospital and Harvard Medical School in Boston, Massachusetts.
"Many examples of diseases resulting from changes in copy number are emerging. A recent review lists 17 conditions of the nervous system alone, including Parkinson's disease and Alzheimer's, that can result from such copy number changes," Professor Lee said.
"Indeed, medical research will benefit enormously from this map, which provides new ways for identifying genes involved in common diseases," he said.
Mark Walport, director of the Wellcome Trust, the medical charity that funded much of the research, said: "This important work will help to identify genetic causes of many diseases."
The key questions answered
What have scientists discovered today?
They have found that each of us is more different genetically than we previously believed. Instead of being 99.9 per cent identical, it may turn out to be more like 99 per cent identical - enough of a difference to explain many variations in human traits. Instead of having just two copies of every gene - one from each parent - we have some genes that are multiplied several times. Furthermore these "multiple copy numbers" differ from one person to another, which could explain human physical and even mental variation.
Why does this matter?
One practical benefit is that it could lead to a new understanding of some of the most difficult, incurable diseases. Although it adds an extra layer of complexity to our understanding of the human genome, the discovery could lead eventually to new insights and medical treatments of conditions ranging from childhood disorders to senile dementia. Scientists are predicting for instance that the knowledge could lead to new diagnostic tests for such diseases as cancer.
How was this discovery made?
Scientists have developed sophisticated methods of analysing large segments of DNA over recent years. "In some ways the methods we have used are 'molecular microscopes' , which have transformed the techniques used since the foundation of clinical genetics where researchers used microscopes to look for visible deletions and rearrangements in chromosomes, " explained Nigel Carter of the Sanger Institute in Cambridge.
What genes are copied many times and why?
There are just under 30,000 genes in the human genome, which consists of about 3 billion "letters" of the DNA code. The scientists found that more than 10 per cent of these genes appear to be multiplied in the 270 people who took part in the study. They do not know why some genes are copied and some are not. One gene, called CCL3L1, which is copied many times in people of African descent, appears to confer resistance to HIV. Another gene involved in making a blood protein is copied many times in people from south-east Asia and seems to help against malaria. Other research has shown that variation in the number of copies of some genes is involved in Alzheimer's and Parkinson's disease.
Are there any other practical applications?
The scientists looked at people from three broad racial groups - African, Asian and European. Although there was an underlying similarity in terms of how common it was for genes to be copied, there were enough racial differences to assign every person bar one to their correct ethnic origin.This might help forensic scientists wishing to know more about the race of a suspect.
Who made the discovery and where can we read more about it?
Scientists from 13 research centres were involved, including Britain's Sanger Institute in Cambridge, which also took a lead role in deciphering the human genome. The research is published in Nature, Nature Genetics and Genome Research.
Scientists have discovered a dramatic variation in the genetic make-up of humans that could lead to a fundamental reappraisal of what causes incurable diseases and could provide a greater understanding of mankind.
The discovery has astonished scientists studying the human genome - the genetic recipe of man. Until now it was believed the variation between people was due largely to differences in the sequences of the individual " letters" of the genome.
It now appears much of the variation is explained instead by people having multiple copies of some key genes that make up the human genome.
Until now it was assumed that the human genome, or "book of life", is largely the same for everyone, save for a few spelling differences in some of the words. Instead, the findings suggest that the book contains entire sentences, paragraphs or even whole pages that are repeated any number of times.
The findings mean that instead of humanity being 99.9 per cent identical, as previously believed, we are at least 10 times more different between one another than once thought - which could explain why some people are prone to serious diseases.
The studies published today have found that instead of having just two copies of each gene - one from each parent - people can carry many copies, but just how many can vary between one person and the next.
The studies suggest variations in the number of copies of genes is normal and healthy. But the scientists also believe many diseases may be triggered by an abnormal loss or gain in the copies of some key genes.
Another implication of the finding is that we are more different to our closest living relative, the chimpanzee, than previously assumed from earlier studies. Instead of being 99 per cent similar, we are more likely to be about 96 per cent similar.
The findings, published simultaneously in three leading science journals by scientists from 13 different research centres in Britain and America, were described as ground-breaking by leading scientists.
"I believe this research will change for ever the field of human genetics," said Professor James Lupski, a world authority on medical genetics at the Baylor College of Medicine in Houston, Texas.
Professor Lupski said the findings superseded the basic principles of human genetics that have been built up since the days of Gregor Mendel, the 19th century "father" of Mendelian genetics, and of Jim Watson and Francis Crick, who discovered the DNA double helix in 1953.
"One can no longer consider human traits as resulting primarily from [simple DNA] changes... With all respect to Watson and Crick, many Mendelian and complex traits, as well as sporadic diseases, may indeed result from structural variation of the genome," Professor Lupski said.
Deciphering the three billion letters in the sequence of the human genome was once likened to landing on the Moon. Having now arrived, scientists have found the "lunar landscape" of the genome is very different from what they expected.
Matthew Hurles, one of the project's leaders at the Wellcome Trust Sanger Institute in Cambridge, said the findings show each one of us has a unique pattern of gains and losses of entire sections of our DNA.
"One of the real surprises of these results was just how much of our DNA varies in copy number. We estimate this to be at least 12 per cent of the genome - that has never been shown before," Dr Hurles said.
Scientists have detected variation in the "copy number" of genes in some individuals before but the sheer scale of the variation now being discovered is dramatic.
"The copy number variation that researchers had seen before was simply the tip of the iceberg, while the bulk lay submerged, undetected," Dr Hurles said.
"We now appreciate the immense contribution of this phenomenon to genetic differences between individuals, " he said.
The studies involved a detailed and sophisticated analysis of the genomes of 270 people with Asian, African or European ancestry. It was important to include as wide a sample of the human gene pool as possible.
They found that 2,900 genes could vary in the number of copies possessed by the individuals. The genes involved multiple copies of stretches of DNA up to a million letters of the genetic code long.
"We used to think that if you had big changes like this, then they must be involved in disease. But we are showing that we can all have these changes," said Stephen Scherer of the Howard Hughes Medical Institute in Chevy Chase, Maryland.
But it is also becoming apparent that many diseases appear to be influenced by the number of copies of certain key genes, said Charles Lee, another of the project's leaders at the Brigham and Women's Hospital and Harvard Medical School in Boston, Massachusetts.
"Many examples of diseases resulting from changes in copy number are emerging. A recent review lists 17 conditions of the nervous system alone, including Parkinson's disease and Alzheimer's, that can result from such copy number changes," Professor Lee said.
"Indeed, medical research will benefit enormously from this map, which provides new ways for identifying genes involved in common diseases," he said.
Mark Walport, director of the Wellcome Trust, the medical charity that funded much of the research, said: "This important work will help to identify genetic causes of many diseases."
The key questions answered
What have scientists discovered today?
They have found that each of us is more different genetically than we previously believed. Instead of being 99.9 per cent identical, it may turn out to be more like 99 per cent identical - enough of a difference to explain many variations in human traits. Instead of having just two copies of every gene - one from each parent - we have some genes that are multiplied several times. Furthermore these "multiple copy numbers" differ from one person to another, which could explain human physical and even mental variation.
Why does this matter?
One practical benefit is that it could lead to a new understanding of some of the most difficult, incurable diseases. Although it adds an extra layer of complexity to our understanding of the human genome, the discovery could lead eventually to new insights and medical treatments of conditions ranging from childhood disorders to senile dementia. Scientists are predicting for instance that the knowledge could lead to new diagnostic tests for such diseases as cancer.
How was this discovery made?
Scientists have developed sophisticated methods of analysing large segments of DNA over recent years. "In some ways the methods we have used are 'molecular microscopes' , which have transformed the techniques used since the foundation of clinical genetics where researchers used microscopes to look for visible deletions and rearrangements in chromosomes, " explained Nigel Carter of the Sanger Institute in Cambridge.
What genes are copied many times and why?
There are just under 30,000 genes in the human genome, which consists of about 3 billion "letters" of the DNA code. The scientists found that more than 10 per cent of these genes appear to be multiplied in the 270 people who took part in the study. They do not know why some genes are copied and some are not. One gene, called CCL3L1, which is copied many times in people of African descent, appears to confer resistance to HIV. Another gene involved in making a blood protein is copied many times in people from south-east Asia and seems to help against malaria. Other research has shown that variation in the number of copies of some genes is involved in Alzheimer's and Parkinson's disease.
Are there any other practical applications?
The scientists looked at people from three broad racial groups - African, Asian and European. Although there was an underlying similarity in terms of how common it was for genes to be copied, there were enough racial differences to assign every person bar one to their correct ethnic origin. This might help forensic scientists wishing to know more about the race of a suspect.
Who made the discovery and where can we read more about it?
Scientists from 13 research centres were involved, including Britain's Sanger Institute in Cambridge, which also took a lead role in deciphering the human genome. The research is published in Nature, Nature Genetics and Genome Research.
Posted by Calypso (Member # 8587) on :
Dr. Winters wrote:
quote:The scientists looked at people from three broad racial groups - African, Asian and European. Although there was an underlying similarity in terms of how common it was for genes to be copied, there were enough racial differences to assign every person bar one to their correct ethnic origin. This might help forensic scientists wishing to know more about the race of a suspect.
Dr. Winters think about it: They used some criterion to separate people into groups to begin with. They concluded that there are differences in the rate with which these people copy some genes. No one has ever said that there are no observable differences among people from different regions. Why do you consider differential rates of production of the genes in question as greater proof of the existence of race than the primary set of criteria used to separate the individuals in the first place?
quote:They have found that each of us is more different genetically than we previously believed. Instead of being 99.9 per cent identical, it may turn out to be more like 99 per cent identical - enough of a difference to explain many variations in human traits. Instead of having just two copies of every gene - one from each parent - we have some genes that are multiplied several times. Furthermore these "multiple copy numbers" differ from one person to another, which could explain human physical and even mental variation.
You highlighted the last paragraph above but it seems to me they're talking about individual differences here not racial differences. How does this help you?
Posted by rasol (Member # 4592) on :
^ Good citation, Dr. Winters. You are referencing current science which is a step in the right direction.
However this article about the use of genetics in medicine does not claim that race can be determined biologically.
What Lupski does claim is that the number of replications of some genes varies in individuals, species and groups more than was previously thought.
In this study he also tested distinct ethnic groups using parent offspring trio's for the Yoruba [YRI] Nigerians, and white(?) people from Utah [CEU], as well as unrelated Chinese and Japanese.
It's not suprising that family trios of Utah would cluster together relative to Yoruba Nigerians, Chinese and Japanese....you could easily reproduce that result using autosomal distance, or Y chromosome [Utah white will have lots of R1b and I, Yoruba will have lots of E3a].
The ability to find different gene frequencies in different ethnic groups is nothing new, and you can do this - within - typological races as well as between them.
There are only two results that are "surprising", the relative similarity of results among Chinese and Japanese...and the fact that some of the "Europeans" of Utah [CEU] appear to be intermediate with respect to Yoruba, other "Europeans" and Chinese/Japanese.
And, at least one of the Chinese is closer to the parent/sibling groups of Utah than to any of the other Chinese, while one of the Utah/Europeans is further away from the others in his assigned group, than the Chinese is.
This certainly doesn't 'prove' race typology, and in fairness, no one associated with the study claims otherwise....
Posted by Clyde Winters (Member # 10129) on :
Calypso
quote: Dr. Winters think about it: They used some criterion to separate people into groups to begin with. They concluded that there are differences in the rate with which these people copy some genes. No one has ever said that there are no observable differences among people from different regions. Why do you consider differential rates of production of the genes in question as greater proof of the existence of race than the primary set of criteria used to separate the individuals in the first place?
Because these geneticists claim they can differiate people into racial categories based on biological differences.
I am not the one claiming race exist it was these scientists from the 13 leading genetic research institutions in the WORLD.
This finding is by geneticists. A group of scientists many people on this forum trust and believe in.
.
Posted by rasol (Member # 4592) on :
quote:Because these geneticists claim they can differiate people into racial categories based on biological differences.
No they do not. The populations were separated into 4 distinct ethnic groups beforehand.
Concievably you could separate out 4 populations in Nigeria, or in Utah for that matter and still produce 4 distinct, Nigerian, or Utah clusters.
Would that prove the existence of 4 Nigeria races, or 4 Utah races, or 4 Chinese races? No.
Nor do the authors claim otherwise.
The only one claiming the study validates race, is you.
Posted by Calypso (Member # 8587) on :
Dr. Winters wrote:
quote: Because these geneticists claim they can differiate people into racial categories based on biological differences.
So what? The factors underlying the criteria used to separate the individuals into groups in the first place (probably hair texture, skin color, etc.,)are also biological. How does that prove the reality of races? No one has ever contended that there are no regional differences among people.
Posted by Clyde Winters (Member # 10129) on :
This is your opinion. The article speaks for itself. It makes it clear that races can be dertermined biologically.
.
Posted by rasol (Member # 4592) on :
quote:No one has ever contended that there are no regional differences among people.
Precisely.
Differences between individuals guarantees differences between regions.
So if you divide people in regions [A,B,C]....you can find differences between A,B and C...if you look for them, but this might be true even if the divisions did not correspond to preconceived 'racial' types.
Posted by rasol (Member # 4592) on :
quote:Originally posted by Clyde Winters: This is your opinion. The article speaks for itself.
Yes the article speaks for itself.
quote: It makes it clear that races can be dertermined biologically.
The study does *not* claim that...that is *your* opinion. You are dangerously close to mis-citing your source material again, and error that dogs your linguistic works.
Your opinion is rooted more in wishful thinking, leaping to wild conclusions ,and hearing only what you want to hear, than anything else. Posted by King_Scorpion (Member # 4818) on :
Sorry Clyde, but highlighting a couple sentences out of an entire article does not prove race exists biologically.
Posted by Calypso (Member # 8587) on :
Rasol wrote:
quote:Differences between individuals guarantees differences between regions.
So if you divide people in regions [A,B,C]....you can find differences between A,B and C...if you look for them, but this might be true even if the divisions did not correspond to preconceived 'racial' types.
Excellent point Rasol. I'm sure as you pointed out above even in a national entity such as Nigeria you might find observable regional differences - and therefore according to Dr. Winters's logic: racial differences.
Posted by Clyde Winters (Member # 10129) on :
Calypso
quote:
Excellent point Rasol. I'm sure as you pointed out above even in a national entity such as Nigeria you might find observable regional differences - and therefore according to Dr. Winters's logic: racial differences.
You keep saying Winters' logic. It is the article by 13 leading genectic research institutes that claims race exist.
You guys seem to have blinders on. You continue to claim race does not exist when the scientists you admire claim otherwise.
I feel sorry for you guys . This is why you guys argue about history on this forum instead of writing it. You create a dream world in which race does not exist while the science you hold sacre continues to preach its reality .
.
Posted by rasol (Member # 4592) on :
quote:You keep saying Winters' logic. It is the article by 13 leading genectic research institutes that claims race exist.
Now your comments are bordering on the delusional.
No geneticist in the article you cited makes any such claim.
quote:I feel sorry for you guys . This is why you guys argue about history on this forum instead of writing it
^ And now you sound frustrated.
Why would that be?
Perhaps because you have no scientific basis for your racial ideology.
So....you are reduced to scouring the internet seeking anything faintly resembling 'support'.
You find none.
So the best you can do is distort the works of real scholars who do not agree with you.
You do the same thing with your language work.
Seems a tad obsessve, no?
Disagree?
Ask yourself a question.
Who is the delusional obsessive who started this thread?
That's the guy you should feel sorry for. Posted by Supercar (Member # 6477) on :
It should become apparent by now, that what you are up against here, is not some goal towards fact-seeking, but some subjective ideology. How many threads have been created on this very same issue, did it change the participants' views? Fact-seeking entails the discredited viewpoint to be tossed out the window [which in this case, involves making human "races" a biologically valid concept], but when this doesn't happen, then the driving force for such becomes all too apparent.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by rasol:
quote:Originally posted by Clyde Winters:
It makes it clear that races can be dertermined biologically.
The study does *not* claim that...that is *your* opinion. You are dangerously close to mis-citing your source material again,...
...because of this:
Although there was an underlying similarity in terms of how common it was for genes to be copied, there were enough racial differences to assign every person bar one to their correct ethnic origin. This might help forensic scientists wishing to know more about the race of a suspect.
...reasonably predict "race", just like how the characterization of the aforementioned "Nubian" and Spanish crania exemplified.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote: And now you sound frustrated.
Why would that be?
Perhaps because you have no scientific basis for your racial ideology.
So....you are reduced to scouring the internet seeking anything faintly resembling 'support'.
You find none.
So the best you can do is distort the works of real scholars who do not agree with you.
You do the same thing with your language work.
Seems a tad obsessve, no?
Disagree?
Yes I disagree. The article makes it clear that races exist.
Article
quote: In contrast to other classes of human genetic variation, the population genetics of copy number variation remains unexplored. The distribution of copy number variation within and among different populations is shaped by mutation, selection and demographic history. A range of polymorphisms, including SNPs25, microsatellites59 and Alu insertion variants60, has been used to investigate population structure. To demonstrate the utility of copy number variation genotypes for population genetic inference we performed population clustering61 on 67 genotyped biallelic CNVs. We obtained the optimal clustering with the assumption of three ancestral populations, with the African, European and Asian populations clearly differentiated (Fig. 7). Population differentiation of individual variants is commonly estimated by the statistic FST, which varies from 0 (undifferentiated) to 1 (population-specific)62. The average FST for the same 67 autosomal CNVs was 0.11, very similar to that observed for all autosomal Phase I HapMap SNPs (0.13)25.
Recent population-specific positive selection elevates population differentiation. To explore population differentiation at all CNVs, we devised a statistic, VST, that estimates population differentiation based on the quantitative intensity data and varies from 0 to 1, similar to FST (Supplementary Fig. 16). Estimating VST for all clones on the WGTP array and all CNVs on the 500K EA array revealed a number of outliers with levels of population differentiation suggestive of population-specific selective pressures (Fig. 8; see also Supplementary Table 20). Among these outliers were two CNVs previously demonstrated to have elevated population differentiation7, 19: UGT2B17 is a gene encoding a UDP-glucuronosyl transferase with roles in androgen metabolism and xenobiotic conjugation63, 64, and CCL3L1 is a chemokine-encoding multi-copy gene at which greater copy numbers protect against HIV-1 infection19.
This is the claim of geneticists from 13 leading research institutions. Are you saying these learned professionals are wrong while you and your friends on this forum are right?
There are just under 30,000 genes in the human genome, which consists of about 3 billion "letters" of the DNA code. The scientists found that more than 10 per cent of these genes appear to be multiplied in the 270 people who took part in the study. They do not know why some genes are copied and some are not. One gene, called CCL3L1, which is copied many times in people of African descent, appears to confer resistance to HIV. Another gene involved in making a blood protein is copied many times in people from south-east Asia and seems to help against malaria. Other research has shown that variation in the number of copies of some genes is involved in Alzheimer's and Parkinson's disease. Are there any other practical applications?
The scientists looked at people from three broad racial groups - African, Asian and European. Although there was an underlying similarity in terms of how common it was for genes to be copied, there were enough racial differences to assign every person bar one to their correct ethnic origin. This might help forensic scientists wishing to know more about the race of a suspect.
Who made the discovery and where can we read more about it?
Scientists from 13 research centres were involved, including Britain's Sanger Institute in Cambridge, which also took a lead role in deciphering the human genome. The research is published in Nature, Nature Genetics and Genome Research.
The evidence is clear. It is you, not I, that lives in a world of fantasy.
.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Clyde Winters:
This is the claim of geneticists from 13 leading research institutions. Are you saying these learned professionals are wrong while you and your friends on this forum are right?
We are saying that you are arriving at the wrong conclusions from the study. It is not the study that is the problem at hand; it is how you are interpreting it to support the highly biologically-questionable idea of human "races".
Posted by Clyde Winters (Member # 10129) on :
Supercar
quote: We are saying that you are arriving at the wrong conclusions from the study. It is not the study that is the problem at hand; it is how you are interpreting it to support the highly biologically-questionable idea of human "races".
This is not my conclusion. It was the conclusion of the researchers who discussed their findings in the article below. Are you saying that the authors of the article below are misquoting the scientists from the 13 leading genetic institutions who claim that races exist.
There are just under 30,000 genes in the human genome, which consists of about 3 billion "letters" of the DNA code. The scientists found that more than 10 per cent of these genes appear to be multiplied in the 270 people who took part in the study. They do not know why some genes are copied and some are not. One gene, called CCL3L1, which is copied many times in people of African descent, appears to confer resistance to HIV. Another gene involved in making a blood protein is copied many times in people from south-east Asia and seems to help against malaria. Other research has shown that variation in the number of copies of some genes is involved in Alzheimer's and Parkinson's disease. Are there any other practical applications?
The scientists looked at people from three broad racial groups - African, Asian and European. Although there was an underlying similarity in terms of how common it was for genes to be copied, there were enough racial differences to assign every person bar one to their correct ethnic origin. This might help forensic scientists wishing to know more about the race of a suspect.
Who made the discovery and where can we read more about it?
Scientists from 13 research centres were involved, including Britain's Sanger Institute in Cambridge, which also took a lead role in deciphering the human genome. The research is published in Nature, Nature Genetics and Genome Research.
Posted by rasol (Member # 4592) on :
quote:Originally posted by Clyde Winters: This is not my conclusion.
Incorrect.
The title of your thread, "Race Exist" is your conclusion, not a conclusion of a scientific study.
This is distinct from variations in copies of genes, which is the subject of the study.
Unfortunately, appending your far fetched opinions to the work of those who disagree with you is standard behavior from you.
It's very silly, which is why you pepper your thread with disingenuous grins.
When you do this, you sell yourself short, and make it easy for others to dismiss you.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Clyde Winters:
This is not my conclusion. It was the conclusion of the researchers who discussed their findings in the article below. Are you saying that the authors of the article below are misquoting the scientists from the 13 leading genetic institutions who claim that races exist.
I am saying that 'you' are misreading the article. For instance, what have you learnt from the study, in terms of the genes under study:
[*] Is the variation in the alleles or the number of copies?
[*]Does the answer to the above support your idea of human "races"?
[*]Can the said alleles be inherited via miscegenation between people of 'different' ethnic background? If so, how then do you 'predict' the ethnic background of the offspring from such coupling?
^^I asked you earlier questions along these lines earlier, but of course, you never replied:
quote:Supercar:
Clyde at it again, defending the biologically indefensible idea of human "races", and in doing so, grasping onto the idea that the number of "copies" of a gene marks "racial" difference. Meanwhile, things like this were overlooked...
there was an underlying similarity in terms of how common it was for genes to be copied,...
They do not know why some genes are copied and some are not.
I wonder in what "race" would a European who, in recent history of the family tree, had an African ancestry, but wouldn't be 'physically' out of place with other 'white' Europeans, happened to inherit the 'number' of said genes from that African ancestor, be placed?...just as southern Europe has higher incidence of the Benin haplotype HbS.
For instance, if this were the case in the twins shown: here
^^Maybe you'll surprise me, and now answer "all" the questions herein, as they are specifically laid out.
Posted by rasol (Member # 4592) on :
quote:They do not know why some genes are copied and some are not. One gene, called CCL3L1, which is copied many times in people of African descent, appears to confer resistance to HIV.
Yet millions of Africans have died of HIV. Genes confering resistence to disease are likely and adaptive response. Where there is little HIV, in Africa, this gene would confer no advantage and so would not be selected for. This doesn't prove race, or even that Africans are statisically less likely to get HIV. It only proves tha HIV or similar disease has killed enough people in Africa to cause and adaptive response.
It's rather pathetic that you highlight this passage because you think it somehow 'proves' race.
quote:Another gene involved in making a blood protein is copied many times in people from south-east Asia and seems to help against malaria.
Yet millions of South-East Asians die of Malaria.
Moreover the precense of this adaptive response distinguishes South-East Asians from NorthEast Asians or North American Indians, for the simple reason that there is little to no Malaria in the later two regions - yet in Doctor Winters race typology - *all these people belong to the 'same [mongoloid] race'.*
In fact, the precense of different gene frequencies in South-East Asians and North East Asians contradicts your simplistic notion that these people can be placed in *the same race*.
It's also important for medicine as it means you can't put all Asians in the same medical catagory and make assumptions about them.
So desparate is Winters for evidence, that he does not even notice this contradiction in *his* race thesis.
Now that we have made him aware of it, would Winters care to explain it?
Posted by Clyde Winters (Member # 10129) on :
^^ I am not desparate for evidence I am just telling the truth. You attempt to lie to your followers on this forum and maintain that race does not exist biologically when scientists continue to show that it does.
I don't have to make-up this reality it is evident in the news. This new study showing that race exist was published in three different journals, and is the lead story in many newspapers around the world.
The only people who can continue to maintain the notion that races do not exist, given the prestige of the authors of this article are people who personally choose to live in a dream world. Do you really believe that scientists would allow a newspaper to make up untruths and publish them as true. No way. These scientists are claiming what we always knew. Race(s) exist biologically.
You act as though we live in some double speak world, where we ignore what is said and shown and only see what we want to believe.
You are just unhappy that geneticists continue to play the race card when you have attempted to claim race no longer exist.
Race will always exist biologically and socially as long as man exist, no matter what blinders you wear.
Some anthropologists dislike the notion of race because it affects the status quo. If you accept that races exist, then you have to accept that civilization was founded by Blacks, since the skeletal, and other evidence supports the view that the Egyptians, Harappans,Elamites, Xia (of China) and Sumerians were all genetically related to Black Africans as is their languages. Acceptance of this truth means that all that we have been taught to believe as history is a lie.
Diop, DuBois and others have always maintained that races exist because they knew that if you are going to truely show the great history of Blacks you have to look at the characteristics that distinguish us. It is these racial features that allow us to truely discuss the great history of Blacks.If it was not for the skeletal record of ancient Egypt would not be able to claim that the Egyptians were Black Africans, instead of Asians.
Your continued support of the idea that races do not exist biologically (while maintaining that Egyptians are Black Africans which in itself is use of race in the dertermination of the ethnic origin of the ancient Egyptian people) support the Eurocentrists and status quo who seek to deny any role of Blacks in history. You are just to blind to see. Your adherence to the idea that races don't exist helps Eurocentrists maintain the status quo not spread the truth.
.
Posted by rasol (Member # 4592) on :
^ Booooooooo.
- off topic blow hard rhetoric, spam ranting and noise making...sure signs of your desparation Dr. Winters.
What you need to do instead is answer the question....
quote: Another gene involved in making a blood protein is copied many times in people from south-east Asia and seems to help against malaria.
Originally posted by rasol:
In fact, the precense of additional copies of this gene in South-East Asians but *not* North East Asians, Africans or Europeans *contradicts* your simplistic notion that all East Asians can placed in the same race based on gene frequency.
So desparate is Winters for evidence, that he does not even notice this contradiction in *his* race thesis.
Now that we have made him aware of it, would Winters care to explain it?
If you can't answer this question, then you effectively admit that you are simply distorting and your thesis is nonsense.
Posted by Clyde Winters (Member # 10129) on :
^There is no need for me to answer this question. I didn't conduct the study and determine that race exist. It was geneticists with years of experience from the 13 leading genetic research institutions in the world that made this claim.
If you find fault with the study that's okay. Write a letter to the journals where the article appeared and point out that the researchers who wrote this article is wrong. But please cite in your response the data from your OWN LAB, that contradicts their findings. I am sure they will want to see this evidence. By the way, before you send these journals your research findings that contradict the study herein discussed, why don't you post the findings from your own experimental research here for all of us to read.
Lacking any research of your own in this area: Send a post to the authors of the forementioned article. They will probably be happy to answer your question since they did the research.
.
Posted by rasol (Member # 4592) on :
quote:There is no need for me to answer this question.
The need to answer the question is simply a function of civil discourse, since I asked it.
The question is basic to comprehension of population genetics.
If you can't answer the question then it indicates that you don't actually understand the article you reference.
If you can answer, but simply refuse to, then this indicates that you are not interested in discourse, but rather only interested in propaganda trolling and noisemaking.
quote:If you find fault with the study that's okay.
We find fault with your distortions and inability to answer our questions.... pertaining to the article you cited, in the thread you started.
Is that... okay? Posted by Arwa (Member # 11172) on :
Dear Dr.Clyde Winters,
I read the article (Nature) you provided, and let me say first, that I welcome such studies, because it only strength that race does not exist in Science. Sure, they claims that such studies would help to produce medicine which target better for that person. But eventually, if you want to prove race in science, then you need at the end DNA sekvense and gene.
The article does not claim that there is a gene that code for a race. The article deals with population genetics, which is quite different than what the title on this thread says. A lot of things what we think is race, is actually environment. Surely you agree with me that allelic frequencies vary between any selected group? Then what is the point to talk about race in science?
One of the methods the article used is single-nucleotide polymorphism (SNP) I'm not an expert on this subject, but let me give you this article:
Science 18 February 2005: Vol. 307. no. 5712, pp. 1050 - 1051
quote: MEDICINE: Enhanced: Race and Reification in Science Troy Duster[HN12]*
Alfred North Whitehead warned many years ago about "the fallacy of misplaced concreteness" [HN1] (1), by which he meant the tendency to assume that categories of thought coincide with the obdurate character of the empirical world. If we think of a shoe as "really a shoe," then we are not likely to use it as a hammer (when no hammer is around). Whitehead's insight about misplaced concreteness is also known as the fallacy of reification [HN2]. Recent research in medicine and genetics makes it even more crucial to resist actively the temptation to deploy racial categories as if immutable in nature and society.
Hypertension and Heart Disease In the last two decades, there has been extensive publication on the differences in hypertension and heart disease between Americans of European descent and Americans of African descent (2-4). Racial designations are frequently used in efforts to assess the respective influences of environmental and genetic factors.
In November, a study was published regarding a combination of isosorbide dinitrate and hydralazine (BiDil) [HN3] that was originally found to be ineffective in treating heart disease in the general population but was then shown to work in a 3-year trial of a group of 1050 individuals designated as African Americans (5). BiDil is likely to get FDA approval this year and has been labeled "the first ethnic drug," although in medical practice, this becomes "the first racial drug." In presenting their justification for FDA approval of an ethnic/race-specific drug, the company (NitroMed) [HN4] announced, "The African American community is affected at a greater rate by heart failure than that of the corresponding Caucasian population. African Americans between the ages of 45 and 64 are 2.5 times more likely to die from heart failure than Caucasians in the same age range" (6).
However, both age and survey population complicate this picture. The age group 45 to 64 only accounts for about 6% of heart failure mortality, and for those over 65, the statistical differences between "African Americans and Caucasians" nearly completely disappear (7). Researchers recently published a study that was explicitly designed to compare racial differences, by sampling whites from eight surveys completed in Europe, the United States, and Canada and contrasting these results with those of a sample of three surveys among blacks from Africa, the Caribbean, and the United States (8). Hypertension rates were measured in 85,000 subjects. The data from Brazil, Trinidad, and Cuba show a significantly smaller racial disparity in blood pressure than is found in North America (8).[HN5]
Even within the category African American, the highly variable phenotype of skin color complicates the hypertension and race thesis. A classic epidemiological study on the topic also found differences within the African American population--with darker-skinned blacks generally having higher mean blood pressure than lighter-skinned blacks. The authors concluded that it was not the color of the skin that produced a direct causal outcome in hypertension, but that darker skin color in the United States is associated with less access to scarce and valued resources of the society. There is a complex feedback loop and interaction effect between phenotype and social practices related to that phenotype (4, 9).
Others have voiced concerns about the pitfalls of using race as anything but a temporary proxy: As the geneticist David Goldstein [HN6] observed, "Race for prescription is only an interim solution to carry us through a period of ignorance until we find the underlying causes" (10). There is every evidence that these underlying causes interact with each other. However, race is such a dominant category in the cognitive field that the "interim solution" can leave its own indelible mark once given even the temporary imprimatur of scientific legitimacy by molecular genetics.
Studies of Human Genetic Diversity The procedures for answering any inquiry into the empirical world determine the scientific legitimacy of claims to validity and reliable knowledge, but the prior question will always be: Why that particular question? The first principle of knowledge construction is, therefore, which question gets asked in the research enterprise.
A paper published in this week's issue of Science [HN7] (11) is well-intentioned, well-crafted, and designed to help better understand the molecular basis of disease. The researchers were searching for and found patterns of SNPs [HN8] differentially distributed in three population groups, formed from a total of 71 persons who were Americans of African, European, or Han Chinese descent.
Why was the question raised in this manner? The answer is a scientific Catch-22. This and other similar efforts (12) to create linkage disequilibrium and haplotype maps have a logic for choosing to study people from disparate geographic regions of the world. The purpose is to generate maps that can indicate subtle differences in the patterning or structuring of human genetic diversity across the globe. [HN9] An increased understanding of these patterns of genetic diversity will help scientists doing gene-association studies by identifying new variants and reducing the likelihood of false-positive associations. The hope is that it may aid scientists to identify medically relevant genes for diseases
However, the particular groups of individuals chosen to represent each region of the world are often chosen because of their convenience and accessibility. Cell and tissue repositories are created to decrease the cost and difficulty of obtaining samples, and the archived samples will be extensively characterized and frequently utilized. Sample collections from repositories may be treated as populations in the narrow sense of the term, even when there is little evidence that they represent a geographically localized, reproductively isolated group. These samples are often subtly portrayed as representing racially categorized populations. Finding a higher frequency of some alleles in one population versus another is a guaranteed outcome of modern technology, even for two randomly chosen populations. When the boundaries of those populations coincide with the social definition of race, a delicate tightrope needs to be better navigated between: (i) acknowledging race as a stratifying practice in societies that can lead to different frequencies of alleles in different modern populations but also to different access to health-related resources, and (ii) reifying race as having genetically sufficiently distinctive features, i.e., with "distinctive gene pathways," which are used to explain health disparities between racially categorized populations.
If we fall into the trap of accepting the categories of stored data sets, then it can be an easy slide down the slope to the misconceptions of "black" or "white" diseases. By accepting the prefabricated racial designations of stored samples and then reporting patterns of differences in SNPs between those categories, misplaced genetic concreteness is nearly inevitable.
SNP Patterns and Searches for a Biological Basis for Criminal Behavior Several countries now have national DNA databases (13). [HN10] Although I use the U.S. criminal justice system as an example, I have no doubt that the principles being considered are universal ones.
It is now relatively common for scholars to acknowledge the considerable and documented racial and ethnic bias in the criminal justice system, from police procedures, prosecutorial discretion, jury selection, and sentencing practices--of which racial profiling is but the tip of an iceberg (14-16). If the FBI's DNA database is primarily composed of those who have been touched by the criminal justice system and that system has engaged in practices that routinely select more from one group, there will be an obvious skew or bias toward this group in this database.
If we turn the clock back just 60 years, whites constituted about 77% of all prisoners in America, while blacks were only 22% (17). In just six decades, the incarceration rate of African Americans in relation to whites has gone up in a striking manner. In 1933, blacks were incarcerated at a rate about three times that of whites (18). In 1950, the ratio had increased to about four times; in 1970, it was six times; and in 1990, it was seven times that of whites.
Among humans, gene pools and SNP patterns cannot change much in 60 years, but economic conditions and the practices of the criminal justice system demonstrably do. The comparative explanatory power of SNP patterns surely pales before the analytic utility of examining shifting institutional practices and economic conditions. However, given the body of "ethnic-estimation" research being published on behalf of forensic applications (19, 20) and the exponential growth of national DNA databases (21, 22), it is not at all unreasonable to expect that a project that proposed to search for SNP profiles among sex offenders and felons convicted of violent crimes would meet with some success, both for funding and for finding "something." This could begin with the phenotype of "three populations," as in the study cited above (11), because that is the way these data are collected by the FBI and the contributing states. We must maintain vigilance to prevent SNP profiling from providing the thin veneer of neutral scientific investigation, while reinscribing the racial taxonomies of already collected data. [HN11]
Conclusions As I have tried to show, a set of assumptions about race has animated the development of BiDil, genetic diversity analyses, "ethnic estimation" research, and the siren's call to do SNP research on the ever-expanding databases of DNA from the incarcerated. These elements are poised to exert a cascading effect--reinscribing taxonomies of race across a broad range of scientific practices and fields. Biomedical research must resist setting off the cascade and, while still moving forward in their efforts to identify the molecular correlates of disease, climb back on the tightrope to address racial disparities in health, in all their biosocial complexity.
The ability to use genomic knowledge to deliver effective pharmaceuticals more safely to special subpopulations that have some functional genetic markers holds promise. Thus, if the FDA approves BiDil, it should do so only under the condition that further research be conducted to find the markers that have the actual functional association with drug responsiveness--thus assuring that the drug be approved for everyone with those markers, regardless of their ancestry, or even of their ancestral informative markers.
The technology will be increasingly available to provide SNP profiles of populations. When the phenotype distinguishing these populations is race, the likelihood of committing the fallacy of misplaced concreteness, in science, is nearly overwhelming. For this reason, when geneticists report population data, they should always attach a caveat or warning label that could read something like this, "allelic frequencies vary between any selected human groups--to assume that those variations reflect 'racial categories' is unwarranted." Whereas this will not completely block the tendency to reify race, it will be an appropriately cautious intervention that tries to prevent science from unwittingly joining the current march toward a biological reinscription of the concept.
Posted by Clyde Winters (Member # 10129) on :
Great post Arwa.
Arwa
quote:
If we fall into the trap of accepting the categories of stored data sets, then it can be an easy slide down the slope to the misconceptions of "black" or "white" diseases. By accepting the prefabricated racial designations of stored samples and then reporting patterns of differences in SNPs between those categories, misplaced genetic concreteness is nearly inevitable.
The technology will be increasingly available to provide SNP profiles of populations. When the phenotype distinguishing these populations is race, the likelihood of committing the fallacy of misplaced concreteness, in science, is nearly overwhelming. For this reason, when geneticists report population data, they should always attach a caveat or warning label that could read something like this, "allelic frequencies vary between any selected human groups--to assume that those variations reflect 'racial categories' is unwarranted." Whereas this will not completely block the tendency to reify race, it will be an appropriately cautious intervention that tries to prevent science from unwittingly joining the current march toward a biological reinscription of the concept.
This is fine rhectoric, but when you find 13 of the leading institutions in the world that study genetics claiming race exist it is hard to ignore their research. Again, as I stated earlier it is idealistic to believe that race is not reality in biology. These researchers did not try to avoid bringing in the race card.
Everyday it is becoming increasingly clear that while some medicines are effective accross populations, many medicines are more effective for one population and not another. This makes it clear that race as a concept has merit and is a biological reality as noted by the authors of the study under discussion.
Again great post Arwa it does show how environment can influence health, but it fails to counter the evidence that race has a biological reality.
.
Posted by X-Ras (Member # 10328) on :
quote:Originally posted by Clyde Winters: This is fine rhectoric, but when you find 13 of the leading institutions in the world that study genetics claiming race exist it is hard to ignore their research. Again, as I stated earlier it is idealistic to believe that race is not reality in biology. These researchers did not try to avoid bringing in the race card.
The study you keep talking about never proved nor said biological race exists, please the post the reference and citation by one of the 13 \"leading scientists. This is just a weak appeal to authority fallacy.
quote:Everyday it is becoming increasingly clear that while some medicines are effective accross populations, many medicines are more effective for one population and not another. This makes it clear that race as a concept has merit and is a biological reality as noted by the authors of the study under discussion.
Nonsense, African Americans are at higher risks for certain diseases not because of our \"biological race\", its because of lack of access to proper health care and the way we eat nd diet, its has nothing to do with anything biologically construed as \"race\"
quote:Again great post Arwa it does show how environment can influence health, but it fails to counter the evidence that race has a biological reality.
The article certainly did not help your argument that biological race exists, it goes against you Clyde, come on now.
Posted by rasol (Member # 4592) on :
quote:This is fine rhetoric
Certainly it is was better than your sloppy rhetoric.
quote:but when you find 13 of the leading institutions in the world that study genetics claiming race exit
Each time you repeat your lie, it becomes more overblown, more patently ludicrous.
It's a mistake to repeat and conflate lies the way you do.
In the long run, it only illustrates that you have no desire to be taken seriously.
This undermines you in our eyes when you present your linguistic theories, since we are ever cogniscent of your tendency to simply - flat out lie - when it suits your purposes.
quote:Everyday it is becoming increasingly clear
.....that you can't answer our questions because you don't understand the articles you cite. So you lie in order to compensate.
Isn't that a fair assessment?
How then can you hope to pretend to 'interpret' said studies? You can't. That's why no-one is impressed by your slop.
Posted by SEEKING (Member # 10105) on :
Dr. Winters, I am truly disappointed in you.
You have posted this article on a different site and the explanation given are of similar content as being expressed here.
Surely you're not going to go through the rest of your life spreading the same tales when in fact the evidence doesn't support your case just because of your wishful thinking that biological race does exist??
Posted by Clyde Winters (Member # 10129) on :
I will continue to write that race exist as long as people on this forum insist that the Egyptians were Black Africans. To insist that the Egyptians were Black means that you also believe that races exist.
.
Posted by X-Ras (Member # 10328) on :
quote:Originally posted by Clyde Winters: I will continue to write that race exist as long as people on this forum insist that the Egyptians were Black Africans. To insist that the Egyptians were Black means that you also believe that races exist.
.
LOL, come on now Clyde, since you could not prove that the said 13 authors proved race exists you're going to use this to prove your argument? Black refers to skin color, not race.
Posted by rasol (Member # 4592) on :
quote:I will continue to write that race exist
lol. Exactly. "YOU" will write this, and we will disregard your writings because you can't answer even the most basic questions pertaining to your racialist dogma. Posted by Clyde Winters (Member # 10129) on :
X-Ras
quote: LOL, come on now Clyde, since you could not prove that the said 13 authors proved race exists you're going to use this to prove your argument? Black refers to skin color, not race.
Ha,Ha. Thanks for the joke. How can you tell the skin color of a skeleton on color of a person from his genes unless you are using the term Black or white to refer to a race. As a result, when people use the term Black African to refer to Egyptians they are using the term "Black" to designate a racial group just like the authors of the study under discussion.
.
What are you talking about I confirmed that the authors determined races biologically:
There are just under 30,000 genes in the human genome, which consists of about 3 billion "letters" of the DNA code. The scientists found that more than 10 per cent of these genes appear to be multiplied in the 270 people who took part in the study. They do not know why some genes are copied and some are not. One gene, called CCL3L1, which is copied many times in people of African descent, appears to confer resistance to HIV. Another gene involved in making a blood protein is copied many times in people from south-east Asia and seems to help against malaria. Other research has shown that variation in the number of copies of some genes is involved in Alzheimer's and Parkinson's disease.
Are there any other practical applications?
The scientists looked at people from three broad racial groups - African, Asian and European. Although there was an underlying similarity in terms of how common it was for genes to be copied, there were enough racial differences to assign every person bar one to their correct ethnic origin. This might help forensic scientists wishing to know more about the race of a suspect.
Who made the discovery and where can we read more about it?
Scientists from 13 research centres were involved, including Britain's Sanger Institute in Cambridge, which also took a lead role in deciphering the human genome. The research is published in Nature, Nature Genetics and Genome Research.
Posted by rasol (Member # 4592) on :
^ Spamming only shows your sour grapes and spoiled sport tendencies DR. Winters.
Especially since you fail time and again to answer our questions.
This is the same ad nauseum fallacy approach you use in linguistic threads when you fail to relate the Mande of West Africa to the Manderin of China.
This is why everyone is so disappointed and unimpressed with you.
You should reconsider your strategy.
quote:Originally posted by Clyde Winters: To insist that the Egyptians were Black means that you also believe that races exist.
For this statement to be true you would have to prove that skin color relates race.
Here is what scientist Nina Jablonsky says about this topic:
Skin coloration in humans is adaptive and labile. Skin pigmentation levels have changed more than once in human evolution. Because of this, skin coloration is of no value in determining phylogenetic relationships among modern human groups.
Constrast with your bad habit of trying to pin your views on others via distortion.
Can you produce a statement from and anthropologist pertaining to skin color contradicting Jablonsky?
I'm sorry Dr. Winters, but you've yet to produce any evidence in support of your ideology.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote:
Skin coloration in humans is adaptive and labile. Skin pigmentation levels have changed more than once in human evolution. Because of this, skin coloration is of no value in determining phylogenetic relationships among modern human groups.
You should tell this to X-Ras. I use Black/African as a racial term like the authors of the study under discussion. Just like we say White South Africans to refer to the Europeans in South Africa.
There are just under 30,000 genes in the human genome, which consists of about 3 billion "letters" of the DNA code. The scientists found that more than 10 per cent of these genes appear to be multiplied in the 270 people who took part in the study. They do not know why some genes are copied and some are not. One gene, called CCL3L1, which is copied many times in people of African descent, appears to confer resistance to HIV. Another gene involved in making a blood protein is copied many times in people from south-east Asia and seems to help against malaria. Other research has shown that variation in the number of copies of some genes is involved in Alzheimer's and Parkinson's disease.
Are there any other practical applications?
The scientists looked at people from three broad racial groups - African, Asian and European. Although there was an underlying similarity in terms of how common it was for genes to be copied, there were enough racial differences to assign every person bar one to their correct ethnic origin. This might help forensic scientists wishing to know more about the race of a suspect.
Who made the discovery and where can we read more about it?
Scientists from 13 research centres were involved, including Britain's Sanger Institute in Cambridge, which also took a lead role in deciphering the human genome. The research is published in Nature, Nature Genetics and Genome Research.
.
Posted by rasol (Member # 4592) on :
quote:How can you tell the skin color of a skeleton on color of a person from his genes?
Genetically -
Skin color is produced by a melanocortin receptor, which can be assessed genetically, but is not racial.
Morphologically -
Skin color is a form of tropical adaptation which can also be correlated to tropical skeletal adaptation which is also not racial.
Now we've answered your question.
Where are the answers to ours?
Posted by rasol (Member # 4592) on :
quote:I use Black/African as a racial term
I don't.
quote:like the authors of the study under discussion
tsk tsk, yet another lie from Dr. Winters.
The term Black African is not used in the study at all, nor is it stated in the study that Black African is racial catagory so you make no point here either - except that you are quite the 'casual liar' Dr. Winters.
Meanwhile our questions go unanswered while you continue to humiliate yourself with lies.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote: quote:I use Black/African as a racial term
I don't.
That's your right. But if you notice your geneticists friends have no difficulty using it as a racial term.
There are just under 30,000 genes in the human genome, which consists of about 3 billion "letters" of the DNA code. The scientists found that more than 10 per cent of these genes appear to be multiplied in the 270 people who took part in the study. They do not know why some genes are copied and some are not. One gene, called CCL3L1, which is copied many times in people of African descent, appears to confer resistance to HIV. Another gene involved in making a blood protein is copied many times in people from south-east Asia and seems to help against malaria. Other research has shown that variation in the number of copies of some genes is involved in Alzheimer's and Parkinson's disease.
Are there any other practical applications?
The scientists looked at people from three broad racial groups - African, Asian and European. Although there was an underlying similarity in terms of how common it was for genes to be copied, there were enough racial differences to assign every person bar one to their correct ethnic origin. This might help forensic scientists wishing to know more about the race of a suspect.
Who made the discovery and where can we read more about it?
Scientists from 13 research centres were involved, including Britain's Sanger Institute in Cambridge, which also took a lead role in deciphering the human genome. The research is published in Nature, Nature Genetics and Genome Research.
.
.
Posted by rasol (Member # 4592) on :
quote:rasol writes: For this statement to be true you would have to prove that skin color relates race.
quote:Winters writes: But if you notice your geneticists friends have no difficulty using it as a racial term.
I noticed four things.
1) Blacks are not referenced in the study at all.
2) Black is not referenced in the article you keep spamming.
3) You are so busy spamming in desparation that you don't even notice that your far fetched claims are nowhere mentioned in your spam.
and...
4) You still have not answered my question:
Here is what scientist Nina Jablonsky says about this topic:
Skin coloration in humans is adaptive and labile. Skin pigmentation levels have changed more than once in human evolution. Because of this, skin coloration is of no value in determining phylogenetic relationships among modern human groups.
Where is your evidence that skin color is racial?
We know it isn't in the article you keep spamming, which makes no mention of skin color or Blacks.
Spamming doesn't help you Dr. Winters, it just makes you look like a frustrated fool.
Posted by Arwa (Member # 11172) on :
Dear Dr.Clyde Winters,
These 13 centres presented a set of allele frequenc that varies in different groups. And they never claimed that there exsist race, because the policy of Nature would never allow to publish in their paper.
quote: Nature Genetics now obliges authors to "explain why they make use of particular ethnic groups or populations, and how classification was achieved." N. Engl. J. Med. 344, 1392#8722;1393 (2001)
These studies are the same when we talk about sickle cell anaemia. You will have a population who have higher frequency than other groups.
Dr.Clyde Winters,
If race exists in science, then why is there no disease founded in only one "race"?
Whith all due respect Dr.Clyde Winters, your basis knowledge in genetic is very minimal. The article in Nature proofs that allelic frequencies vary between any selected group, hence! There is NO RACE IN SCIENCE.
Finally: Race is a social construct, not a scientific classification
Peace Yours, Arwa
Posted by X-Ras (Member # 10328) on :
quote:Originally posted by Arwa: Dear Dr.Clyde Winters,
These 13 centres presented a set of allele frequenc that varies in different groups. And they never claimed that there exsist race, because the policy of Nature would never allow to publish in their paper.
quote: Nature Genetics now obliges authors to "explain why they make use of particular ethnic groups or populations, and how classification was achieved." N. Engl. J. Med. 344, 1392#8722;1393 (2001)
These studies are the same when we talk about sickle cell anaemia. You will have a population who have higher frequency than other groups.
Dr.Clyde Winters,
If race exists in science, then why is there no disease founded in only one "race"?
Whith all due respect Dr.Clyde Winters, your basis knowledge in genetic is very minimal. The article in Nature proofs that allelic frequencies vary between any selected group, hence! There is NO RACE IN SCIENCE.
Finally: Race is a social construct, not a scientific classification
Peace Yours, Arwa
Good Post Arwa, but Dr Winters isn't going to get it. He has to learn that one cannot misuse a study to prove something that wasn't proven in the said study.
Posted by Arwa (Member # 11172) on :
I think Dr.Clyde Winters enjoys playing around with us. If race exist in science, then we would know the gene that codes "race".
Posted by rasol (Member # 4592) on :
quote:he has to learn that one cannot misuse a study to prove something that wasn't proven in the said study.
He's not a very good tactician either.
He is a professional linguist not a geneticist but his penchant for blatant bogusness comes back to bite him during linguistic discussions.
He is demonstrating a generic disregard for the truth which makes him unreliable regardless of the discipline under discussion.
Posted by Arwa (Member # 11172) on :
Dr.Clyde Winters,
Here is an article, originally from The Independent, UK, related the article from Nature.
quote:Genetic breakthrough that reveals the differences between humans Scientists hail genetic discovery that will change human understanding 23 November 2006
Scientists have discovered a dramatic variation in the genetic make-up of humans that could lead to a fundamental reappraisal of what causes incurable diseases and could provide a greater understanding of mankind.
The discovery has astonished scientists studying the human genome - the genetic recipe of man. Until now it was believed the variation between people was due largely to differences in the sequences of the individual "letters" of the genome.
It now appears much of the variation is explained instead by people having multiple copies of some key genes that make up the human genome.
Until now it was assumed that the human genome, or "book of life", is largely the same for everyone, save for a few spelling differences in some of the words. Instead, the findings suggest that the book contains entire sentences, paragraphs or even whole pages that are repeated any number of times.
The findings mean that instead of humanity being 99.9 per cent identical, as previously believed, we are at least 10 times more different between one another than once thought - which could explain why some people are prone to serious diseases.
The studies published today have found that instead of having just two copies of each gene - one from each parent - people can carry many copies, but just how many can vary between one person and the next.
The studies suggest variations in the number of copies of genes is normal and healthy. But the scientists also believe many diseases may be triggered by an abnormal loss or gain in the copies of some key genes.
Another implication of the finding is that we are more different to our closest living relative, the chimpanzee, than previously assumed from earlier studies. Instead of being 99 per cent similar, we are more likely to be about 96 per cent similar.
The findings, published simultaneously in three leading science journals by scientists from 13 different research centres in Britain and America, were described as ground-breaking by leading scientists.
"I believe this research will change for ever the field of human genetics," said Professor James Lupski, a world authority on medical genetics at the Baylor College of Medicine in Houston, Texas.
Professor Lupski said the findings superseded the basic principles of human genetics that have been built up since the days of Gregor Mendel, the 19th century "father" of Mendelian genetics, and of Jim Watson and Francis Crick, who discovered the DNA double helix in 1953.
"One can no longer consider human traits as resulting primarily from [simple DNA] changes... With all respect to Watson and Crick, many Mendelian and complex traits, as well as sporadic diseases, may indeed result from structural variation of the genome," Professor Lupski said.
Deciphering the three billion letters in the sequence of the human genome was once likened to landing on the Moon. Having now arrived, scientists have found the "lunar landscape" of the genome is very different from what they expected.
Matthew Hurles, one of the project's leaders at the Wellcome Trust Sanger Institute in Cambridge, said the findings show each one of us has a unique pattern of gains and losses of entire sections of our DNA.
"One of the real surprises of these results was just how much of our DNA varies in copy number. We estimate this to be at least 12 per cent of the genome - that has never been shown before," Dr Hurles said.
Scientists have detected variation in the "copy number" of genes in some individuals before but the sheer scale of the variation now being discovered is dramatic.
"The copy number variation that researchers had seen before was simply the tip of the iceberg, while the bulk lay submerged, undetected," Dr Hurles said.
"We now appreciate the immense contribution of this phenomenon to genetic differences between individuals," he said.
The studies involved a detailed and sophisticated analysis of the genomes of 270 people with Asian, African or European ancestry. It was important to include as wide a sample of the human gene pool as possible.
They found that 2,900 genes could vary in the number of copies possessed by the individuals. The genes involved multiple copies of stretches of DNA up to a million letters of the genetic code long.
"We used to think that if you had big changes like this, then they must be involved in disease. But we are showing that we can all have these changes," said Stephen Scherer of the Howard Hughes Medical Institute in Chevy Chase, Maryland.
But it is also becoming apparent that many diseases appear to be influenced by the number of copies of certain key genes, said Charles Lee, another of the project's leaders at the Brigham and Women's Hospital and Harvard Medical School in Boston, Massachusetts.
"Many examples of diseases resulting from changes in copy number are emerging. A recent review lists 17 conditions of the nervous system alone, including Parkinson's disease and Alzheimer's, that can result from such copy number changes," Professor Lee said.
"Indeed, medical research will benefit enormously from this map, which provides new ways for identifying genes involved in common diseases," he said.
Mark Walport, director of the Wellcome Trust, the medical charity that funded much of the research, said: "This important work will help to identify genetic causes of many diseases."
The key questions answered
What have scientists discovered today?
They have found that each of us is more different genetically than we previously believed. Instead of being 99.9 per cent identical, it may turn out to be more like 99 per cent identical - enough of a difference to explain many variations in human traits. Instead of having just two copies of every gene - one from each parent - we have some genes that are multiplied several times. Furthermore these "multiple copy numbers" differ from one person to another, which could explain human physical and even mental variation.
Why does this matter?
One practical benefit is that it could lead to a new understanding of some of the most difficult, incurable diseases. Although it adds an extra layer of complexity to our understanding of the human genome, the discovery could lead eventually to new insights and medical treatments of conditions ranging from childhood disorders to senile dementia. Scientists are predicting for instance that the knowledge could lead to new diagnostic tests for such diseases as cancer.
How was this discovery made?
Scientists have developed sophisticated methods of analysing large segments of DNA over recent years. "In some ways the methods we have used are 'molecular microscopes', which have transformed the techniques used since the foundation of clinical genetics where researchers used microscopes to look for visible deletions and rearrangements in chromosomes," explained Nigel Carter of the Sanger Institute in Cambridge.
What genes are copied many times and why?
There are just under 3,000 genes in the human genome, which consists of about 3 billion "letters" of the DNA code. The scientists found that more than 10 per cent of these genes appear to be multiplied in the 270 people who took part in the study. They do not know why some genes are copied and some are not. One gene, called CCL3L1, which is copied many times in people of African descent, appears to confer resistance to HIV. Another gene involved in making a blood protein is copied many times in people from south-east Asia and seems to help against malaria. Other research has shown that variation in the number of copies of some genes is involved in Alzheimer's and Parkinson's disease.
Are there any other practical applications?
The scientists looked at people from three broad racial groups - African, Asian and European. Although there was an underlying similarity in terms of how common it was for genes to be copied, there were enough racial differences to assign every person bar one to their correct ethnic origin. This might help forensic scientists wishing to know more about the race of a suspect.
Who made the discovery and where can we read more about it?
Scientists from 13 research centres were involved, including Britain's Sanger Institute in Cambridge, which also took a lead role in deciphering the human genome. The research is published in Nature, Nature Genetics and Genome Research.
Posted by X-Ras (Member # 10328) on :
quote:Originally posted by Arwa: I think Dr.Clyde Winters enjoys playing around with us. If race exist in science, then we would know the gene that codes "race".
LOL, he's doing a great impression of Horemheb, continue to make the same arguments and ignore the evidence against it or just post no evidence at all to back his claims. I still respect the brother despite that.
Posted by Arwa (Member # 11172) on :
^ I do have alot respect to Dr.Clyde Winters, and I think it's very important subject to cover, because I don't believe all these studies are only to improve better drugs for "race" groups. It smeals KZ ideology. Remember, these scienties lived during race experiment in the 40's-60's.
Posted by lamin (Member # 5777) on :
To Arwa: Re "race" and disease, then what about Tay Sach's disease--found only among the Ashkenazi clinal subset of Europeans? Has this disease ever been diagnosed among generic Africans or South Asians or East Asians?
Posted by Arwa (Member # 11172) on :
The aim of HapMap Project:
quote:The aim of the International HapMap Project is to determine the common patterns of DNA sequence variation in the human genome, by characterizing sequence variants, their frequencies, and correlations between them, in DNA samples from populations with ancestry from parts of Africa, Asia and Europe. The project will thus provide tools that will allow the indirect association approach to be applied readily to any functional candidate gene in the genome, to any region suggested by family-based linkage analysis, or ultimately to the whole genome for scans for disease risk factors.
^This article is WELL!!!!! written, and I think "normal" people can follow
Posted by Arwa (Member # 11172) on :
To Lamin,
Please provide any proof that Tay-Sachs only found in Ashkenazi Jews.
In the meantime:
quote:Genetic Testing and Genetic Screening
When social groupings with a strong endogamous tradition (such as ethnic or racial groups) intermarry for centuries, they are at higher risk for pairing recessive genes and passing on a genetic disorder. In the United States, the best knowns of these clustered autosomal recessive disorders are Tay-Sachs disease, beta-thalassemia, sickle-cell anemia, and cystic fibrosis. For Tay-Sachs, concentrated primarily among Ashkenazi Jews of northern and eastern European ancestry, about one in thirty is a carrier, and approximately one in every 3,000 newborns will have the disorder. For cystic fibrosis, about one in thirty Americans of European descent is a carrier, with a similar incidence rate. In contrast, approximately one in every 12 American blacks is a carrier for sickle-cell anemia and one in every 625 black newborns will have the disorder. Irish and northern Europeans are at greater risk for phenylketonuria. In the United States, one in 60 Caucasians is a carrier, and about one in every 12,000 newborn Caucasians is affected (Detailed information on the Incidence of Genetic Disorders can be found in Burhansstipanov et al. 1987, p. 6-7).
When both parents are carriers of the autosomal recessive gene, the probability that each live birth will be affected by the disorder is 25 percent. However, being a carrier, or passing on the gene so that one's offspring is also a carrier, typically poses no more of a health threat than carrying a recessive gene for a different eye color. That is, carrier status typically poses no health threat at all. The health rationale behind carrier screening is to inform prospective parents about their chances of having a child with a genetic disorder.
In the United States, the two most widespread genetic screening programs for carriers have been for Jews of northern European descent (Tay-Sachs) and for Americans of western African descent (sickle-cell anemia). From 1972 to 1985, there was widespread prenatal screening for both disorders, and by 1988, newborn screening for sickle-cell anemia had become common (Duster 1990). It is the autosomal recessive disorders, located in risk populations that coincide with ethnicity and race, that are of special interest as we turn to address genetic screening for populations that are at greatest risk for a disorder.
It is important to distinguish between a genetic screen and a genetic test. A genetic test is done when there is reason to believe that a particular individual is at high risk for having a genetic disorder, or for being a carrier of a gene (recessive) for a disorder. So for example, a sibling of someone who has been diagnosed with Huntington's (a late-onset neurological disorder) would be a candidate for a genetic test for that disorder. A genetic screen, on the other hand, is used for a population that is at higher risk for a genetic disorder. Thus, with the risk figures cited above, Ashkenazi Jews were the subjects of genetic screening for Tay-Sachs.
I like to answer/participate about race and Science, but I don't want anything to do with Ashkenazi Jews' history.
Thank you
Posted by rasol (Member # 4592) on :
quote:Originally posted by lamin: To Arwa: Re "race" and disease, then what about Tay Sach's disease--found only among the Ashkenazi clinal subset of Europeans? Has this disease ever been diagnosed among generic Africans or South Asians or East Asians?
Are you saying Ashkenazi Jews are a race?
If you could find a desease that only effected Ashkenazi Jews you would have two groups
Ashkenazi in group one.
And non Ashkenazi in group two.
Group two would include Africans, Asians, Europeans and non Ashkenazi Jews.
If the basis of your race grouping is 'said disease' then you may not place Ashkenazi in a race group [subset] with people who don't have this disease.
If 'some' have it, and some don't - this would then be non-concordant to race-typology, therefore yet again *contradicting* race.
It would be like claiming skin color is racial, the grouping certain blacks in the race catagory of "whites who are black", technically falsifying the original premise.
You can't have it both ways Lamin.
You can't claim a disease is racial - then assign it to only 'subset' of a so called 'race'.
Lack of prescence of assigned trait in all members of the claimed race-group is the only possible method of falsification.
A theory with no intrinsic method of falsification is not valid, and race is notorious for producing pseudo-scientific theories rooted in cicular reasoning and so, impossible to falsify.
Posted by Arwa (Member # 11172) on :
The author Troy Duster, is a member of HapMap Project and other important projects
Posted by lamin (Member # 5777) on :
To Arwa: You used the word "race", I did not. But here's something for you. Suppose you were a physician and you were required to prescreen pregnant mothers for genes possibly destructive to their fetus's life chances, and your patients had limited financial resources to run the required batteries of genome tests, would you test all your patients for the Tay Sach's cluster of gene(s) or just those of Eastern European Ashkenazi background?
Re "concordance": what the dialogue shows is that while it may be necessary to be Ashkenazi to be "Tay-Sachs" prone(probability), it will not be sufficient. But that in itself constitute no grounds not to test.
Posted by Arwa (Member # 11172) on :
To Lamin,
Absolutely not! This is no better than those who favoured eugenics in Nazi Germany. They were also saying it was to help people. If you allow this to happened, then you automatically permit to screen test every Black person who enters in the UK for AIDS, TB and other diseases, because that is what the Conservative party wants to legislate. You are opening the Pandora's box, if you allow this to happen.
Posted by lamin (Member # 5777) on :
To Arwa, You may be right and just don't know what to think given the correctness of Bayesian probability statistics in things like quality control testing--as in new drugs for the marketplace, testing for Down's syndrome for pregnant womem over the age of 40--if they are in the "woman's right to choose" group, etc.
There are reliable tests and there are bogus, ideologically motivated tests--as in the case hysterical claims about AIDS in Africa. There is a whole literature on charlatan medical claims. I am talking about genuine humanistic Bayesian approaches to human genetics.
I am a bit unclear on this: where do we go wrong when we look ONLY at the genome profiles and at the Y and MtDNA haplotypes of 2 sets of familes and conclude that one family is North East Asian with 99% probability and the other Southwest African with a 99% probability?
And when biologists classify flora and fauna cladistically and taxonomically where exactly do they go wrong when they transfer the same approach to humans?
Posted by rasol (Member # 4592) on :
quote:And when biologists classify flora and fauna cladistically and taxonomically where exactly do they go wrong when they transfer the same approach to humans?
Actually you have it backwards Lamin.
Biologist do classify humans cladistically as species homo-sapiens.
They simply don't classify homo-sapiens into sub-species or race.
Most species, like humans in fact do *not* classify into sub-species.
The reason humans do not classify into sub-species is because human beings are a recent species that has constantly interbred.
In most situations where there are sub-species there is breeding isolation typically on the order of 100's of thousand to millions of years, and even then the sub-species status is transient and usually a precursor to speciation.
That's why most species have no sub-species.
The original theory dividing humans into taxonomically defined races was based precisely on the premise of "ancient isolation" and separation of human populations on the order of millions of years.
For example 1 theory held that Europeans were descendant of Chimpanzees's, Africans of Gorillas and Asians of Orangataun.
The reason that this notion isn't reflected in current biological texts is simply that it has proven to be wrong.
Thus there are no taxon for humans beneath species level.
So Lamin the real question is -> Are *you saying* biologists are wrong?
If you are saying that biologists are wrong, then can you tell us why?
Also give us your list of the appropriate sub-species of human beings, in your view. (?)
Thanks.
Posted by Supercar (Member # 6477) on :
People mistake the .01% observed overall genetic variation in Humans to imply "races". As such, this biologically insensible viewpoint grasps on lack of understanding of phenomena, for instance, 'variation' in the number of "copies" of certain genes, and the higher incidence of certain naturally selected genes and their subsequent flow between spatially separated populations, mutations in genes that regulate melanin content and so forth, which have no bearings on the overall integrity of humans as a single species. As mentioned time and again, even chimpanzees that look visibly similar in phenotype from a single chimp population, actually show greater genetic variation than humans from the same population.
Posted by rasol (Member # 4592) on :
^ Geneticist Alan Templeton:
"There is more and more hard genetic evidence that all of humanity has evolved as a single unit, with regional variations, but that's all they are, slight variations," said Templeton. "A race has to be a sharply defined, geographically circumscribed population that represents an isolated or nearly isolated lineage within the species. There's nothing at all like that in humanity. In terms of the living world, it's really hard to find a species so genetically homogeneous across its populations as humans." Posted by Lord of the Nile (Member # 10305) on :
Thank you Dr Clyde Winters. That was a great article you posted. Your analysis is impecable. Only dreamers live in a raceless world!
Lord
Posted by rasol (Member # 4592) on :
Winters laughable and genetically illiterate attempts at distortion hardly constitute "analysis", even by the lowest conceivable sub-standard.
As for you, can you answer any of the questions that Winters ran away from?
Perhaps you can 'dream up' some answers?
Posted by Lord of the Nile (Member # 10305) on :
Go suck on some sleeping pills and go to bed old man.
You are the only insomaniac in North America yet to hear of race. You and your Egyptsearch merrymen are living in some dream world.
Sweet dreams!
Lord
Posted by X-Ras (Member # 10328) on :
quote:Originally posted by Lord of the Nile: Go suck on some sleeping pills and go to bed old man.
You are the only insomaniac in North America yet to hear of race. You and your Egyptsearch merrymen are living in some dream world.
Sweet dreams!
Lord
Shut up and quit trolling, anyone can see that Clyde posted no evidence to back his claims, why don't you try reading the stuy for yoursel and see.
Posted by Lord of the Nile (Member # 10305) on :
The multitude of subjective and non-uniform socio-ethnic constructs across the globe, is the actual figment of humans, which has no bearings on biological realities that result in say, this...
^...these are the sort of natural world realities that science recognizes and makes note of, and one which transcends the cultural social constructs of the human world.
It is simple: in science, falsifiable material is presented, and such, it is up to those who wish to challenge the matter at hand, to rise to the occasion. It doesn't boil down to the idea of what one culture has to say [or describe] about this or that matter; one either has the goods to make a case contrary to that of the status quo, or one doesn't.
Posted by Arwa (Member # 11172) on :
I have posted this article in my blog:
Lessons from History: Why Race and Ethnicity Have Played a Major Role in Biomedical Research By Troy Duster Ph.D., The Journal of Law, Medicine & Ethics
quote:A recent paper entitled “Whole Genome Patterns of Common DNA Variation in Three Diverse Human Populations,” which emanated from the HapMap project, demonstrates the problem.11 This paper is well-intentioned, well-crafted, and designed to help understand health differences among human population groups.The researchers were searching for, and found, patterns of SNPs differentially distributed in three population groups, formed from a total of seventy-one persons who were Americans of African descent, Americans of European descent, or Han Chinese.
However, what makes these three populations diverse is the phenotype associated with a racial classification system – not a genotypic pattern of similarity that triggered the inquiry. Indeed, the authors note that the SNP patterns of genetic diversity that they found among African-Americans suggest more diversity than that in the other two populations – a finding consistent with our knowledge of genetic diversity on the African continent. So why was the question of genetic variation raised using these racial and ethnic categories? The answer is a scientific Catch-22. The main reason is convenience: the data were originally collected and marked that way in the Coriell Cell Repositories. That is an understandable rationale. However, by deploying these pre-existing categories, any differences that emerge are likely to be “racialized” – no matter how many caveats and demurrers appear in the text of a scientific paper. Moreover, the African-American group is said to be “admixed.” But, in terms of genotype, all three groups are “admixed.” So it must actually be the phenotype to which the authors refer with the designation of “three diverse populations.”
Posted by Arwa (Member # 11172) on :
Dr.Clyde Winters posted:
quote: The scientists looked at people from three broad racial groups - African, Asian and European. Although there was an underlying similarity in terms of how common it was for genes to be copied, there were enough racial differences to assign every person bar one to their correct ethnic origin. This might help forensic scientists wishing to know more about the race of a suspect.
Use of forensic science in crime investigation, please read following article:
Thank you Dr Clyde Winters. That was a great article you posted. Your analysis is impecable. Only dreamers live in a raceless world!
Thanks for your support. I could present more articles by geneticists who claim that race exist in science and biology but we have already discussed this matter and I will not continue this discussion here.
All I have said is that scientist accept the fact that race exist. Even in the abstract of the article by Dr. Duster posted by Arwa, Dr. Duster admits:
quote:
Before any citizen enters the role of scientist, medical practitioner, lawyer, epidemiologist, and so on, each and all grow up in a society in which the categories of human differentiation are folk categories that organize perceptions, relations, and behavior. That was true during slavery, during Reconstruction, the eugenics period, the two World Wars, and is no less true today. While every period understandably claims to transcend those categories, medicine, law, and science are profoundly and demonstrably influenced by the embedded folk notions of race and ethnicity.
If race has always been a part of the normal discourse in science why is it that the members of this forum are attacking anyone who admits the obvious, and these say people even claim that race does not exist when the scientist make it clear that it does like the scientist of the study under discussion in this thread.
To understand this phenomena we have to look into the fields of sociology and political science to understand the desire on the part of many African Americans who are members of the "bourgeois" to deny the existence of race.
This begs the question : "Was race ever absent in genetics"? It is interesting that many members of the Black "bourgeois" claim that race is being re-introduced to genetics or science generally. The evidence is clear that it has always been a part of genetics, especially in relation to forensic sciences and medical sciences. Moreover, the brother on the street has never believed that "race" science or social customs that support the concept of races has ever disappeared in the public discourse. Granted many professional anthropologists and geneticists have tried to push race in the background, yet these researchers have never claimed that race did not exist in science, they just prayed it would be pushed aside and all people would be looked upon as "human beings".
This has long been the dream of minorities and especially the "Black establishment intellegensia" and "bourgeois" since the 1920's. Everytime these Blacks have been allowed to "associate" with whites freely, they build up this imagined reality of a race neutral society. And as is the case, this "dream"-- fantasy is smashed to smithereens as the "race card" has a resurgence. These Blacks continue this "race neutral" rhectoric until it smacks them in the face.
I am sorry to tell you this but no matter how you seek to hide in your "bourgeois" imaginations race will always rise its head up in science because race(s) exist.
You guys can attack me as long as you wish. It is the geneticists at 13 leading research institutions that maintain that RACE EXIST.
Here you cowardly attack the reporters of the message, instead of the Messengers of race. In this case leading geneticist from 13 research institutions. Instead of writing disparaging statements about Lord and I, you should be trying to form committees to write letters to the journals who published this study, and the newspapers and other media that publicized it .
But alas, this would be too "manly" and you might feel jeopardize your job or standing with your non-Black/African friends. Instead , you find articles written by other "bourgeois" Blacks praying that the idea of race in science will disappear like Duster--who at least has the forthrightness to admit that the view is pervasive among many scientists.
But like most cowardly Negroes, you attack another Afro-American, instead of standing up like a man and voicing your concern in the media. Shame on you.
There are just under 30,000 genes in the human genome, which consists of about 3 billion "letters" of the DNA code. The scientists found that more than 10 per cent of these genes appear to be multiplied in the 270 people who took part in the study. They do not know why some genes are copied and some are not. One gene, called CCL3L1, which is copied many times in people of African descent, appears to confer resistance to HIV. Another gene involved in making a blood protein is copied many times in people from south-east Asia and seems to help against malaria. Other research has shown that variation in the number of copies of some genes is involved in Alzheimer's and Parkinson's disease.
Are there any other practical applications?
The scientists looked at people from three broad racial groups - African, Asian and European. Although there was an underlying similarity in terms of how common it was for genes to be copied, there were enough racial differences to assign every person bar one to their correct ethnic origin. This might help forensic scientists wishing to know more about the race of a suspect.
Who made the discovery and where can we read more about it?
Scientists from 13 research centres were involved, including Britain's Sanger Institute in Cambridge, which also took a lead role in deciphering the human genome. The research is published in Nature, Nature Genetics and Genome Research.
Posted by Djehuti (Member # 6698) on :
quote:Originally posted by rasol: No they do not. The populations were separated into 4 distinct ethnic groups beforehand.
Concievably you could separate out 4 populations in Nigeria, or in Utah for that matter and still produce 4 distinct, Nigerian, or Utah clusters.
Would that prove the existence of 4 Nigeria races, or 4 Utah races, or 4 Chinese races? No.
Nor do the authors claim otherwise.
The only one claiming the study validates race, is you.
quote:Originally posted by Calypso:
Dr. Winters wrote: "Because these geneticists claim they can differiate people into racial categories based on biological differences."
So what? The factors underlying the criteria used to separate the individuals into groups in the first place (probably hair texture, skin color, etc.,)are also biological. How does that prove the reality of races? No one has ever contended that there are no regional differences among people.
Poor Winters and his fanfare just don't (won't) get it.
So, by the studies I suppose all 'Asians' are of the same race. Black Asian Dravidians of India are the same race as Siberians and Japanese. But I forgot all those blacks of India are (according to you) descended from African Saharan Manding! LOLAnd What about Europeans? Is not Europe a part of greater Asia hence the geologically correct term Eurasia?
You of course failed to answer any of Rasol's questions because you cannot. Biological 'race' does not exist plain and simple!
Posted by alTakruri (Member # 10195) on :
When the word race was used in the GENETIC BREAKTHROUGH article, who was using it? The population geneticists or the journalist who wrote the article?
I see population geneticists talking about geographic populations.
I see a journalist dumbing it down writing about races.
James Lupski uses "human genetics." Matthew Hurles uses "genetic differences." Stephen Scherer, Charles Lee, Mark Walport, Nigel Carter, none of them are quoted using the word race.
Steve Connors, journalist, is the one who took the three regional identifiers, African, Asian, and European, and inferred the involvement of races rather than geographical populations.
We need be careful when attributing words to a source. Does the source indeed use the word or concepts we ascribe to them?
Posted by Djehuti (Member # 6698) on :
^^Excellent observation, Takruri! Of course, the individual who cited the source obviously missed this and in his frantic emotional rush to cite it (mis-cite it), he did not realize that the scientists never made the claim nor used the term 'races'!!
I wonder what Clyde will say now. He might as well go back to his rantings on Saharan Dravidians and Mandingo Olmecs.
Posted by Arwa (Member # 11172) on :
Dr. Clyde Winters
Not even a four year old child would fall on what you wrote.
Would you mind and quote Troy Duster (& his colleagues) claiming the existence of race in science.
Posted by Arwa (Member # 11172) on :
Dr. Clyde Winters wrote:
quote:I am sorry to tell you this but no matter how you seek to hide in your "bourgeois" imaginations race will always rise its head up in science because race(s) exist.
you confuse the word race with racism. If race excists in science, don't you think every child in this world would know where the gene of race is found on which chromosome?
Posted by Djehuti (Member # 6698) on :
^LOL Deep down Clyde knows this, but is desperate to deny it!
He knows no recent and most of all accurate scientific study supports the notion of 'race' and for the very reason that it debunks his own nonsense claims that Dravidian blacks of India are NOT recently descended from Africa let alone have any links with West African Mandingos, and that the Olmecs of Central America despite having features like broad noses and lips are NOT of West African descent as well since neither populations carries recent African ancestry!!
He knows that in racial typology this man below is 'negroid'...
..even though he and his people are the most genetically distant in relation to Africans despite their very black very 'African' appearances.
Whereas a blonde hair, blue-eyed Nordic European who carries E3b is closely related to Africans.
Thus genetics has blown 'racial' typology up into smoke, so now people like Clyde and Evil-Euro can do nothing but desperately breathe in that smoke only to choke on it. Posted by Lord of the Nile (Member # 10305) on :
Deadhuti
What is your genetic classification? I asked because as I was walking down the street today I met two E3B guy one from the Philipines and the other from Algeria who were ranting about how some phenotypically black individuals were planning to undermine the genetic integrity of the R1a and R1b categories....
What a dumbo...the E3B guys.
Tehehe
Lord
Posted by rasol (Member # 4592) on :
^ You are not funny, just stupid.
Now go away.
Posted by rasol (Member # 4592) on :
quote:Originally posted by alTakruri: When the word race was used in the GENETIC BREAKTHROUGH article, who was using it? The population geneticists or the journalist who wrote the article?
I see population geneticists talking about geographic populations.
I see a journalist dumbing it down writing about races.
James Lupski uses "human genetics." Matthew Hurles uses "genetic differences." Stephen Scherer, Charles Lee, Mark Walport, Nigel Carter, none of them are quoted using the word race.
Steve Connors, journalist, is the one who took the three regional identifiers, African, Asian, and European, and inferred the involvement of races rather than geographical populations.
We need be careful when attributing words to a source. Does the source indeed use the word or concepts we ascribe to them?
Anyone who isn't as dumb as Winters needs them to be would realise that in this entire thread - not a single sentense in support of race has been atributed to any biologist.
Meanwhile Alan Templeton, Shomarka Keita, Spencer Wells, Rick Kittles and Nina Jablonsky have all been quoted directly and in opposition to race-typologies.
Actual comments from these scholars go unaddressed by Winters, because he has no idea of how to respond.
That's why he spams instead of addressing the citations or answering the questions.
It adds up....
Another boring pointless fiasco of a thread by Winters.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by rasol:
Actual comments from these scholars go unaddressed by Winters, because he has no idea of how to respond...
Funny. I find it interesting that Clyde thinks that people who confront his claims are behaving "cowardly", while his "unaddressing" of what he was requested to address, speaks of a "manly" behavior. Posted by Clyde Winters (Member # 10129) on :
Dr. George Gill (and Jaime Stuart) Does Race Exist? A proponent's perspective by George W. Gill Slightly over half of all biological/physical anthropologists today believe in the traditional view that human races are biologically valid and real. Furthermore, they tend to see nothing wrong in defining and naming the different populations of Homo sapiens. The other half of the biological anthropology community believes either that the traditional racial categories for humankind are arbitrary and meaningless, or that at a minimum there are better ways to look at human variation than through the "racial lens."
Are there differences in the research concentrations of these two groups of experts? Yes, most decidedly there are. As pointed out in a recent 2000 edition of a popular physical anthropology textbook, forensic anthropologists (those who do skeletal identification for law-enforcement agencies) are overwhelmingly in support of the idea of the basic biological reality of human races, and yet those who work with blood-group data, for instance, tend to reject the biological reality of racial categories.
Where does George Gill stand in the "great race debate?" Read on. I happen to be one of those very few forensic physical anthropologists who actually does research on the particular traits used today in forensic racial identification (i.e., "assessing ancestry," as it is generally termed today). Partly this is because for more than a decade now U.S. national and regional forensic anthropology organizations have deemed it necessary to quantitatively test both traditional and new methods for accuracy in legal cases. I volunteered for this task of testing methods and developing new methods in the late 1980s. What have I found? Where do I now stand in the "great race debate?" Can I see truth on one side or the other—or on both sides—in this argument?
Findings First, I have found that forensic anthropologists attain a high degree of accuracy in determining geographic racial affinities (white, black, American Indian, etc.) by utilizing both new and traditional methods of bone analysis. Many well-conducted studies were reported in the late 1980s and 1990s that test methods objectively for percentage of correct placement. Numerous individual methods involving midfacial measurements, femur traits, and so on are over 80 percent accurate alone, and in combination produce very high levels of accuracy. No forensic anthropologist would make a racial assessment based upon just one of these methods, but in combination they can make very reliable assessments, just as in determining sex or age. In other words, multiple criteria are the key to success in all of these determinations.
While he doesn't believe in socially stipulated "age" categories, Gill says, he can "age" skeletions with great accuracy. I have a respected colleague, the skeletal biologist C. Loring Brace, who is as skilled as any of the leading forensic anthropologists at assessing ancestry from bones, yet he does not subscribe to the concept of race. [Read Brace's position on the concept of race.] Neither does Norman Sauer, a board-certified forensic anthropologist. My students ask, "How can this be? They can identify skeletons as to racial origins but do not believe in race!" My answer is that we can often function within systems that we do not believe in.
As a middle-aged male, for example, I am not so sure that I believe any longer in the chronological "age" categories that many of my colleagues in skeletal biology use. Certainly parts of the skeletons of some 45-year-old people look older than corresponding portions of the skeletons of some 55-year-olds. If, however, law enforcement calls upon me to provide "age" on a skeleton, I can provide an answer that will be proven sufficiently accurate should the decedent eventually be identified. I may not believe in society's "age" categories, but I can be very effective at "aging" skeletons. The next question, of course, is how "real" is age biologically? My answer is that if one can use biological criteria to assess age with reasonable accuracy, then age has some basis in biological reality even if the particular "social construct" that defines its limits might be imperfect. I find this true not only for age and stature estimations but for sex and race identification.
"I am more accurate at assessing race from skeletal remains that from looking at living people standing before me," Gill says. The "reality of race" therefore depends more on the definition of reality than on the definition of race. If we choose to accept the system of racial taxonomy that physical anthropologists have traditionally established—major races: black, white, etc.—then one can classify human skeletons within it just as well as one can living humans. The bony traits of the nose, mouth, femur, and cranium are just as revealing to a good osteologist as skin color, hair form, nose form, and lips to the perceptive observer of living humanity. I have been able to prove to myself over the years, in actual legal cases, that I am more accurate at assessing race from skeletal remains than from looking at living people standing before me. So those of us in forensic anthropology know that the skeleton reflects race, whether "real" or not, just as well if not better than superficial soft tissue does. The idea that race is "only skin deep" is simply not true, as any experienced forensic anthropologist will affirm.
Position on race Where I stand today in the "great race debate" after a decade and a half of pertinent skeletal research is clearly more on the side of the reality of race than on the "race denial" side. Yet I do see why many other physical anthropologists are able to ignore or deny the race concept. Blood-factor analysis, for instance, shows many traits that cut across racial boundaries in a purely clinal fashion with very few if any "breaks" along racial boundaries. (A cline is a gradient of change, such as from people with a high frequency of blue eyes, as in Scandinavia, to people with a high frequency of brown eyes, as in Africa.)
"Clines" represent gradients of change, such as that between areas where most people have blue eyes and areas in which brown eyes predominate. Morphological characteristics, however, like skin color, hair form, bone traits, eyes, and lips tend to follow geographic boundaries coinciding often with climatic zones. This is not surprising since the selective forces of climate are probably the primary forces of nature that have shaped human races with regard not only to skin color and hair form but also the underlying bony structures of the nose, cheekbones, etc. (For example, more prominent noses humidify air better.) As far as we know, blood-factor frequencies are not shaped by these same climatic factors.
So, serologists who work largely with blood factors will tend to see human variation as clinal and races as not a valid construct, while skeletal biologists, particularly forensic anthropologists, will see races as biologically real. The common person on the street who sees only a person's skin color, hair form, and face shape will also tend to see races as biologically real. They are not incorrect. Their perspective is just different from that of the serologist.
So, yes, I see truth on both sides of the race argument.
Those who believe that the concept of race is valid do not discredit the notion of clines, however. Yet those with the clinal perspective who believe that races are not real do try to discredit the evidence of skeletal biology. Why this bias from the "race denial" faction? This bias seems to stem largely from socio-political motivation and not science at all. For the time being at least, the people in "race denial" are in "reality denial" as well. Their motivation (a positive one) is that they have come to believe that the race concept is socially dangerous. In other words, they have convinced themselves that race promotes racism. Therefore, they have pushed the politically correct agenda that human races are not biologically real, no matter what the evidence.
Consequently, at the beginning of the 21st century, even as a majority of biological anthropologists favor the reality of the race perspective, not one introductory textbook of physical anthropology even presents that perspective as a possibility. In a case as flagrant as this, we are not dealing with science but rather with blatant, politically motivated censorship. But, you may ask, are the politically correct actually correct? Is there a relationship between thinking about race and racism?
Does discussing the concept of race promote racism? Race and racism Does discussing human variation in a framework of racial biology promote or reduce racism? This is an important question, but one that does not have a simple answer. Most social scientists over the past decade have convinced themselves that it runs the risk of promoting racism in certain quarters. Anthropologists of the 1950s, 1960s, and early 1970s, on the other hand, believed that they were combating racism by openly discussing race and by teaching courses on human races and racism. Which approach has worked best? What do the intellectuals among racial minorities believe? How do students react and respond?
Three years ago, I served on a NOVA-sponsored panel in New York, in which panelists debated the topic "Is There Such a Thing as Race?" Six of us sat on the panel, three proponents of the race concept and three antagonists. All had authored books or papers on race. Loring Brace and I were the two anthropologists "facing off" in the debate. The ethnic composition of the panel was three white and three black scholars. As our conversations developed, I was struck by how similar many of my concerns regarding racism were to those of my two black teammates. Although recognizing that embracing the race concept can have risks attached, we were (and are) more fearful of the form of racism likely to emerge if race is denied and dialogue about it lessened. We fear that the social taboo about the subject of race has served to suppress open discussion about a very important subject in need of dispassionate debate. One of my teammates, an affirmative-action lawyer, is afraid that a denial that races exist also serves to encourage a denial that racism exists. He asks, "How can we combat racism if no one is willing to talk about race?"
"How can we combat racism," asks an affirmative-action lawyer, "if no one is willing to talk about race?" Who will benefit? In my experience, minority students almost invariably have been the strongest supporters of a "racial perspective" on human variation in the classroom. The first-ever black student in my human variation class several years ago came to me at the end of the course and said, "Dr. Gill, I really want to thank you for changing my life with this course." He went on to explain that, "My whole life I have wondered about why I am black, and if that is good or bad. Now I know the reasons why I am the way I am and that these traits are useful and good."
A human-variation course with another perspective would probably have accomplished the same for this student if he had ever noticed it. The truth is, innocuous contemporary human-variation classes with their politically correct titles and course descriptions do not attract the attention of minorities or those other students who could most benefit. Furthermore, the politically correct "race denial" perspective in society as a whole suppresses dialogue, allowing ignorance to replace knowledge and suspicion to replace familiarity. This encourages ethnocentrism and racism more than it discourages it.
Dr. George W. Gill is a professor of anthropology at the University of Wyoming. He also serves as the forensic anthropologist for Wyoming law-enforcement agencies and the Wyoming State Crime Laboratory.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Clyde Winters:
Dr. George Gill (and Jaime Stuart) Does Race Exist? A proponent's perspective by George W. Gill
Slightly over half of all biological/physical anthropologists today believe in the traditional view that human races are biologically valid and real....
This would be a distortion of reality by George Gill, if this claim is attributed to him, because we've already cited geneticists and bio-anthropologists, and indeed the AAA, who have made it clear that they don't see the validity of "social constructs" of human "races" in science. Are you calling these experts, at their own very words, liars? If not, then is Geogre Gill correct to characterize and generalize as he did? If yes, what is George Gill's basis for this; reading the minds of bio-anthropologists, when they haven't actually said anything of the sort to him? If you have no answers to these questions, then case is dismissed!
Posted by Calypso (Member # 8587) on :
Clyde Winters wrote:
quote: I have been able to prove to myself over the years, in actual legal cases, that I am more accurate at assessing race from skeletal remains than from looking at living people standing before me.
A physical anthropologists who believes in the fundamental division of human beings into races yet admits that he cannot look at a living person and accurately determine their race!!! Do the dead have more definite racial affiliations than do the living?
Posted by Supercar (Member # 6477) on :
In fact, how many "races" does George Gill propose there are; what are the basis of these "races" other than mere "physical" resemblances?
It seems to me that George Gill is defending the "concept" of races, because apparently as a "Forensic" anthropologist, that is what he is expected to do. The pressure of the job to seek divisions and characterize people based on unscientific 'socially' constructed as opposed to biologically authenticated 'races', warrants him to defend the said social constructs. There is a difference between human 'races' being a real 'social construct' and being a 'real' biological phenomenon.
Posted by Clyde Winters (Member # 10129) on :
Supercar
quote:
It seems to me that George Gill is defending the "concept" of races, because apparently as a "Forensic" anthropologist, that is what he is expected to do. The pressure of the job to seek divisions and characterize people based on unscientific 'socially' constructed as opposed to biologically authenticated 'races', warrants him to defend the said social constructs. There is a difference between human 'races' being a real 'social construct' and being a 'real' biological phenomenon.
Here you are going too far. Other physical anthropologist outside of forensics can also determine race scientifically and not as a social construct. http://www.kacike.org/MartinezEnglish.html
The Use of Mitochondrial DNA to Discover Pre-Columbian Migrations to the Caribbean: Results for Puerto Rico and Expectations for the Dominican Republic
Dr. Juan C. Martínez Cruzado
A slide show, for use with Internet Explorer, accompanies this paper PDF Version for printing 360 KB
In this study, we use Mitochrondrial DNA technology (mtDNA) to improve our understanding of the pre-Columbian migrations to the Antilles that gave rise to the Taínos. As a basis for our work, we need to review various studies, principally of the archaeological type, that have given us knowledge of the pre-Columbian migrations to the Greater Antilles. [1]
It is known that more than 8,000 years ago the Greater Antilles were inhabited by nomads who depended for their survival upon the foods that they could collect and the animals that they could hunt. That era is known as the Lithic Era, which is distinguished by the stone tools that these people made. [2]
Some 4,000 years later, we begin to note a great quantity of tools and adornments made of shells and some made of bone. That era is known as the Archaic Era, populated by nomads who appear to have subsisted principally on seafoods, but who also ate terrestrial products. It was not until some 2,200 years ago that a ceramic culture arrived in the Greater Antilles, consisting of agriculturalists who built permanent settlements near their areas of cultivation. [3]
Little is known about the migrations from which the nomads originated, better known as the pre-ceramic culture. Three routes have been identified by which there could have been migratory waves to the Greater Antilles: proceeding from the Florida Peninsula by means of Cuba, proceeding from the Yucatan Peninsula also by means of Cuba, and proceeding from the Orinoco Delta by means of the Lesser Antilles. Dental studies done by Dr. Edwin Crespo, as in other studies, suggest that there were at least two migratory waves to the Greater Antilles. For this reason, confirmation of the use of the routes does not necessarily indicate that the other routes were not also used. [4]
Distinct ceramic cultures existed in the Greater Antilles. Even before the time of Christ, on the island of Vieques, there already existed a Huecoid culture and Saladoid culture, clearly distinguishable by their ceramics, but also through other cultural aspects. For example, while the burials of the Saladoids can be found relatively easily, the remains of Huecoid bones have never been found. All that has been found is one milk tooth. For this reason, it is believed that the religions of both cultures could have contained very different elements. Furthermore the Huecoids were specialists in working with semi-precious stones, which they frequently sculpted in the form of animals. Among them the figure of a bird stands out that many have identified as the Andean condor, for which reason they attach a continental origin to this region. Deposits with ceramic elements very similar to those of the Huecoids have been found near the mouth of the Guapo River in Venezuela. From there they would have taken the maritime route eastward toward Puerto Rico, Vieques, and other islands in the Northeastern Caribbean. The Saladoids, on the other hand, migrated from the region of Saladero near the mouth of the Orinoco River by means of the Lesser Antilles until they arrived in the Greater Antilles. [5]
The Huecoid culture lasted some few hundred years, but the Saladoid culture, evolving with time, lasted until approximately the year A.D. 600. Certain evidence has been found in Puerto Rico that suggests great, natural events of a catastrophic nature that could have put an end to the Saladoid culture. What is certain is that a clearly distinct culture developed beginning from that date, the Ostionoid, which is divided into two stages known as pre-Taíno and Taíno. We do not know if the Ostionoid culture represents a marked cultural change of the Saladoid culture people due to the natural catastrophic events or some other type of event, or if it represents the arrival of a new migratory wave of Southamerican origin. [6]
In conclusion, the archaeological evidence can identify four pre-Columbian migrations to the Greater Antilles: two pre-ceramic and two ceramic. The actual number of pre-Columbian migrations very well might have been only four, but there could have been many more. [7]
We will see now what the mtDNA that we can extract from the contemporary inhabitants of the Major Antilles could offer us. The vast majority of our genetic material, perhaps better known as DNA, is found in the nucleus of the cell. The mtDNA, however, is not located in the nucleus of the cell but in an organelle known as the mitochondria. While nuclear DNA is inherited in equal parts from one’s father and mother, mtDNA is inherited only from one’s mother. It does not mix with that of the father and for that reason remains intact generation after generation, thus maintaining its original identity. That is to say, despite the intensive mestizaje (genetic “mixture”) that has characterized our region over the centuries, we Caribbeans have mtDNAs that have maintained their original identity and that can be identified as African, Indian, or Caucasian . Their identity depends upon the women in our genetic tree at the end of the strictly maternal ancestral line. If this great-great-great grandmother were indigenous, then the corresponding Caribbean would have an indigenous mtDNA. He or she would have inherited it intact from that great-great-great grandmother who lived through those terrible first years of the colonization by means of his or her great-great grandmothers, great grandmothers, and maternal grandmother. [8]
In addition to the geneticists at the 13 research institutes that found races can be determined biologically; other geneticists through their research have also determined the race of individuals based on genes.
Tang H, Quertermous T, Rodriguez B, Kardia SL, Zhu X, Brown A, Pankow JS, Province MA, Hunt SC, Boerwinkle E, Schork NJ, Risch NJ.
Division of Public Health Sciences, Fred Hutchinson Cancer Research Center, Seattle, WA, USA.
We have analyzed genetic data for 326 microsatellite markers that were typed uniformly in a large multiethnic population-based sample of individuals as part of a study of the genetics of hypertension (Family Blood Pressure Program). Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic) and were recruited from 15 different geographic locales within the United States and Taiwan. Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories. Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity. On the other hand, we detected only modest genetic differentiation between different current geographic locales within each race/ethnicity group. Thus, ancient geographic ancestry, which is highly correlated with self-identified race/ethnicity--as opposed to current residence--is the major determinant of genetic structure in the U.S. population. Implications of this genetic structure for case-control association studies are discussed. In this paper Tang was using genetics to explore ancestry. Since he is using genetics to explore racial ancestry the paper is concerned with biology, not geography.
Most importantly caucasian is a racial term it is not a geographical term. Caucasians live in many different geographic regions (Europe, Auatralia, Latin America and etc.) therefore the term can only be applied to race, not geography.
.
Posted by Clyde Winters (Member # 10129) on :
Gill has already made it clear that about half the scientists believe race exist and the other half belive race does not exist. The biology literature is full of reference to race.
Race From Wikipedia, the free encyclopedia Jump to: navigation, search This article may benefit form being shortened by the use of summary style. Summary style moves large sections to sub-articles that are summarized in the main article. For other uses, see Race (disambiguation). The term race distinguishes a population of humans (or non-humans) from other populations. The most widely used human racial categories are based on visible traits (especially skin color and facial features), genes, and self-identification. Conceptions of race, as well as specific racial groupings, vary by culture and over time and are often controversial, for scientific reasons as well as their impact on social identity and identity politics. Legal definitions, common usage, and scientific meaning can all be conflated, causing confusion and controversy.
Webster's Dictionary defines race as "a group of people of common ancestry or stock". Descent is defined as 'derivation from an ancestor'.
The term Caucasian race or Caucasian is used to refer to people whose ancestry can be traced back to Europe, North Africa, West Asia, South Asia and parts of Central Asia. It was once considered a useful taxonomical categorization of human racial groups based on a presumed common geographic and/or linguistic origin. Below are science articles where race is discussed. This makes it clear that race is part of the science discourse.
[QUOTE]
Forensic value of the multicopy Y-STR marker DYS464
John M. Butler * , Richard Schoske 1 Biotechnology Division, National Institute of Standards and Technology, Gaithersburg, MD, USA Abstract. The tetranucleotide Y-chromosome short tandem repeat (Y-STR) marker, DYS464, first reported by Redd et al. [Forensic Sci. Int. 130 (2002) 97] appears to be the most polymorphic Y-STR marker discovered to date. A single primer pair can generate up to four distinct peaks over an allele range of 9–20 repeats. Allele calls can be made based on peaks that are present (conservative approach; C-type) or a combination of alleles and peak height ratios (expanded typing method; E- type). We have observed 113 C-types and 179 E-types in 679 males from three US populations. D 2003 Elsevier B.V. All rights reserved. Keywords: Y-STR; Y-chromosome; DYS464; Multicopy loci; DNA typing 1. Introduction DYS464 occurs at least four times in the highly palindromic region near the center of the long arm of the Y-chromosome [1–3]. In forensic casework applications where the amount of typable DNA material may be limited, the use of highly polymorphic markers is advantageous in order to limit the number of markers needed to distinguish unrelated individuals. Page 2 The primers VIC-CTTTGGGCTATGCCTCAGTTT and GCCATACCTGGGTAACAGA- GAGAC produce green-labeled amplicons in the size range of 242–286 bp for DYS464 alleles 9–20, while the primers 6FAM-AGTTTACGAGCTTTGGGCTATG and GTGGCAAGATCTCATTTCTTCAA generate blue dye-labeled polymerase chain reac- tion (PCR) products that are 327–367 bp in size. PCR conditions are as previously described for the Y-STR 20plex [5]. An allelic ladder was created for DYS464 (Fig. 1), which contains all of the major alleles as well as single-base variants observed in our population study [3]. 3. Results and discussion We observed 179 expanded types with DYS464 in 679 male samples from three different US population sets: 265 African–Americans, 262 Caucasians, and 152 His- panics.
Race is a key element in biological research. Biological researchers constantly use the term caucasian in reference to individuals and human populations. Lets look at the definitions of this term: Caucasian "A caucasoid person". Caucasoid: " of the major divisions of the human species whose members characteristically have skin color ranging from very light to brown...."
These definitions make it clear that use of this term implies discussion of race or the caucasoid human species. This term is frequently used in reference to the caucasoid species in numerous biological studies. Use of this term makes it clear race exist. Below are examples from different biological research papers.
Indigenous Puerto Rico: DNA evidence upsets established history By Rick Kearns
Reprinted with permission, from Indian Country Today Posted: October 06, 2003 - 1:34pm EST by: Rick Kearns / Correspondent / Indian Country Today
History is written by the conquerors. The Native peoples of North America know this all too well, as they are still trying to bring the truth to light. Now, their long-lost Caribbean cousins are beginning the same process.
It’s an uphill battle.
Most Puerto Ricans know, or think they know, their ethnic and racial history: a blending of Taino (Indian), Spanish and African. Students of the islands’ past have read the same account for over 300 years; that the Native people, and their societies, were killed off by the Spanish invaders by the 1600s. It was always noted though, how many of the original colonists married Taino women or had Taino concubines, producing the original mestizaje (mixture) that, when blended with African, would produce Puerto Ricans.
Those first unions, according to the conventional wisdom, explain why some Puerto Ricans have "a little bit" of Native heritage. Mainly we are Spanish, we are told, with a little African blood and far-away Taino ancestry.
But the order of that sequence will have to change.
Dr. Juan Martinez Cruzado, a geneticist from the University of Puerto Rico Mayaguez who designed an island-wide DNA survey, has just released the final numbers and analysis of the project, and these results tell a different story. According to the study funded by the U.S. National Science Foundation, 61 percent of all Puerto Ricans have Amerindian mitochondrial DNA, 27 percent have African and 12 percent Caucasian. (Nuclear DNA, or the genetic material present in a gene’s nucleus, is inherited in equal parts from one’s father and mother. Mitochondrial DNA is inherited only from one’s mother and does not change or blend with other materials over time.) http://www.biomedcentral.com/1471-2350/6/30
High frequency of the IVS2-2A>G DNA sequence variation in SLC26A5, encoding the cochlear motor protein prestin, precludes its involvement in hereditary hearing loss Hsiao-Yuan Tang1 , Anping Xia1 , John S Oghalai1 , Fred A Pereira1, 2 and Raye L Alford1
Background Cochlear outer hair cells change their length in response to variations in membrane potential. This capability, called electromotility, is believed to enable the sensitivity and frequency selectivity of the mammalian cochlea. Prestin is a transmembrane protein required for electromotility. Homozygous prestin knockout mice are profoundly hearing impaired. In humans, a single nucleotide change in SLC26A5, encoding prestin, has been reported in association with hearing loss. This DNA sequence variation, IVS2-2A>G, occurs in the exon 3 splice acceptor site and is expected to abolish splicing of exon 3. Methods To further explore the relationship between hearing loss and the IVS2-2A>G transition, and assess allele frequency, genomic DNA from hearing impaired and control subjects was analyzed by DNA sequencing. SLC26A5 genomic DNA sequences from human, chimp, rat, mouse, zebrafish and fruit fly were aligned and compared for evolutionary conservation of the exon 3 splice acceptor site. Alternative splice acceptor sites within intron 2 of human SLC26A5 were sought using a splice site prediction program from the Berkeley Drosophila Genome Project. Results The IVS2-2A>G variant was found in a heterozygous state in 4 of 74 hearing impaired subjects of Hispanic, Caucasian or uncertain ethnicity and 4 of 150 Hispanic or Caucasian controls (p = 0.45). The IVS2-2A>G variant was not found in 106 subjects of Asian or African American descent. No homozygous subjects were identified (n = 330). Sequence alignment of SLC26A5 orthologs demonstrated that the A nucleotide at position IVS2-2 is invariant among several eukaryotic species. Sequence analysis also revealed five potential alternative splice acceptor sites in intron 2 of human SLC26A5.
http://www.ecacc.org.uk/default.asp?Reload=detail2.asp?itemid=92970 ECACC Releases all 5 Human Random Control (HRC) DNA (480 HRC individual DNAs) in Convenient 96 Well Panels Building on the success of the ECACC Human Random Control (HRC) DNA in genetics research (see selected publications list) ECACC has responded to customer demand and re-formatted all 480 HRC DNA samples into a more convenient 96 well format. This new development has been made possible by ECACC’s investment, during 2005, in automated liquid handling technologies. This development along with more efficient work practises has had the added benefit of substantially reducing the price of obtaining the whole 480 HRC DNA resources, bringing it within the scope of individual consumable budgets. The HRC DNA consists of authenticated, high quality purified human genomic DNA. Each of the available 480 samples is from a single individual, providing a control population of randomly selected, non-related UK Caucasian blood donors. The HRC DNA is available as a series of five panels each containing samples from 96 separate individuals in a convenient 8 x 12 well format. This is a readily available, cost effective and renewable source of standardised control DNA samples for use in a range of applications that include: • Population studies • Mutation analysis • SNP genotyping • Validation of technology • Assay development and validation • Association analysis • Comparative genomic hybridisation • Genomic DNA library construction http://www.funpecrp.com.br/gmr/year2002/vol2-1/gmr0004_full_text.htm Frequency of the hypervariable DNA loci D18S849, D3S1744, D12S1090 and D1S80 in a mixed ancestry population of Chilean blood donors M. Acuña1, H. Jorquera2, L. Cifuentes1 and L. Armanet3 1ICBM Genetic Program and 2Medical Technology School, Facultad de Medicina, Universidad de Chile, Casilla 70061, Santiago 7, Chile 3Forensic Medical Service, Santiago, Chile Corresponding author: M. Acuña E-mail: macuna@machi.med.uchile.cl Genet. Mol. Res. 1 (2): 139-146 (2002) Received April 11, 2002 Published June 27, 2002
Comparisons of D1S80 allele distribution between populations (Figure 2) using the ² test showed no significant differences between the Chilean population sample when compared with Southwestern US Hispanics and US Hispanics pooled (Zago et al., 1996; Huckenbeck et al., 1997). The research presented in this paper shows that the hypervariable DNA loci investigated are distinguishable from other Caucasian (Spanish), Black and Oriental populations, but that the D3S1744 locus is indistinguishable from the Caucasian population. All the loci studied are indistinguishable from USA Hispanic populations (Figures 2 and 3). This study provides the first database for DNA markers in low and middle socioeconomic strata in a Chilean population. The results presented indicate that the analysis of these loci may have useful applications in population genetics as well as in identity tests.
.
Posted by Doug M (Member # 7650) on :
Basically, what you are saying is that scientists are trying to find genetic markers that are UNIQUE to people with "white" skin complexion. The problem here is that people with "white" skin complexion VARY in so many genetic markers, that they CANNOT be lumped together as one RACE. They DONT all descend from one SPECIES of man called WHITE. WHITE skin is PURELY a function of environment and has NOTHING to do with being European. Just like most BLACK people on the planet, like the Andamanese, some South East Asians, Indians and Papuans and Australians all have DIFFERENT genetic markers. The fact that certain populations with "white" skin have common genetic or other biological markers does NOT make white skin, black skin or any other skin color the basis of some groups being from a FUNDAMENTALLY different STOCK of humans. ALL humans descend from Africans and ALL humans were ORIGINALLY black and even BLACK people are BORN white. SKIN COLOR is not RACE and RACE is not a SPECIES or indicator of some BIOLOGICAL difference between various human populations. MOST humans share the SAME BASIC biology, meaning ALL of them are the SAME SPECIES. The variations of markers from one person to the next is NOT an indication of RACE.
Forensics is about TRENDS in a LOCAL population. Therefore, because LOCAL populations can be analyzed and craniofacial data correlated with phenotypical traits, cultural traits and other "superficial" characteristics, it is easier to identify skeletal remains from a FORENSIC perpective. HOWEVER, introduce a skeletal sample FROM OUTSIDE the SAMPLE set of the LOCAL population and you will SEE how LIMITED forensics can be. If I dropped off the skeleton of a Mongolian steppes person at the lab of a forensics expert, the ODDs that his RECONSTRUCTION would MATCH that of a Mongolian is extremely UNLIKELY. Why? Because the sample data that they use MAY or MAY not cause the skeleton to be MIS analyzed or MIS identified. But how often are you going to find the skeleton of a Mongolian in a field in Northern Oklahoma? MOST times localized sample sets, work just fine. But there are MANY cases where they wont. And in the case of a Mongolian, if that MOngolian was of DARKER skin complexion, then it is even LESS likely that the forensics reconstruction would match.
Posted by Clyde Winters (Member # 10129) on :
DougM
quote: The fact that certain populations with "white" skin have common genetic or other biological markers does NOT make white skin, black skin or any other skin color the basis of some groups being from a FUNDAMENTALLY different STOCK of humans. ALL humans descend from Africans and ALL humans were ORIGINALLY black and even BLACK people are BORN white. SKIN COLOR is not RACE and RACE is not a SPECIES or indicator of some BIOLOGICAL difference between various human populations. MOST humans share the SAME BASIC biology, meaning ALL of them are the SAME SPECIES. The variations of markers from one person to the next is NOT an indication of RACE.
These scientists are not talking about skin color. They are talking about genes.
You are not a scientist. You are a layman. Why should anyone listen to your ranting if you have not done original/primary research disconfirming the particular findings of these scientists.
These scientist claim they have found a gene indicating the white race.
Your comments are only your opinion, unless you can cite some of your own research disputing this research. Or an article that specifically disconfirms the findings of these sicentist.
.
Posted by Arwa (Member # 11172) on :
quote: These scientist claim they have found a gene indicating the white race.
Dr. Clyde, would you please quote any article, thank you.
Posted by Clyde Winters (Member # 10129) on :
Arwa Can't you read
quote:
• Genomic DNA library construction http://www.funpecrp.com.br/gmr/year2002/vol2-1/gmr0004_full_text.htm Frequency of the hypervariable DNA loci D18S849, D3S1744, D12S1090 and D1S80 in a mixed ancestry population of Chilean blood donors M. Acuña1, H. Jorquera2, L. Cifuentes1 and L. Armanet3 1ICBM Genetic Program and 2Medical Technology School, Facultad de Medicina, Universidad de Chile, Casilla 70061, Santiago 7, Chile 3Forensic Medical Service, Santiago, Chile Corresponding author: M. Acuña E-mail: macuna@machi.med.uchile.cl Genet. Mol. Res. 1 (2): 139-146 (2002) Received April 11, 2002 Published June 27, 2002
Comparisons of D1S80 allele distribution between populations (Figure 2) using the ² test showed no significant differences between the Chilean population sample when compared with Southwestern US Hispanics and US Hispanics pooled (Zago et al., 1996; Huckenbeck et al., 1997). The research presented in this paper shows that the hypervariable DNA loci investigated are distinguishable from other Caucasian (Spanish), Black and Oriental populations, but that the D3S1744 locus is indistinguishable from the Caucasian population. All the loci studied are indistinguishable from USA Hispanic populations (Figures 2 and 3). This study provides the first database for DNA markers in low and middle socioeconomic strata in a Chilean population. The results presented indicate that the analysis of these loci may have useful applications in population genetics as well as in identity tests.
Tang et al:
quote: Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic) and were recruited from 15 different geographic locales within the United States and Taiwan. Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories. Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity.
Posted by Arwa (Member # 11172) on :
what does " distinguishable" mean, Dr. Clyde?
phenotype is not what I'm looking for.
Posted by Arwa (Member # 11172) on :
quote:The research presented in this paper shows that the hypervariable DNA loci investigated are distinguishable from other Caucasian (Spanish), Black and Oriental populations, but that the D3S1744 locus is indistinguishable from the Caucasian population. All the loci studied are indistinguishable from USA Hispanic populations (Figures 2 and 3). This study provides the first database for DNA markers in low and middle socioeconomic strata in a Chilean population. The results presented indicate that the analysis of these loci may have useful applications in population genetics as well as in identity tests.
This study shows allelic frequencies variation in a Chilean population. It is a X^2 test.
Posted by Clyde Winters (Member # 10129) on :
Arwa: The test shows a genetic marker for races mentioned in the study: Caucasian, Black and Oriental.
.
Posted by Clyde Winters (Member # 10129) on :
Tang et al noted that genetics can differiate the races:
quote: Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic) and were recruited from 15 different geographic locales within the United States and Taiwan. Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories. Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity.
This finding is supported by Redon et al in their Nature study who note that:
quote:
In contrast to other classes of human genetic variation, the population genetics of copy number variation remains unexplored. The distribution of copy number variation within and among different populations is shaped by mutation, selection and demographic history. A range of polymorphisms, including SNPs25, microsatellites59 and Alu insertion variants60, has been used to investigate population structure. To demonstrate the utility of copy number variation genotypes for population genetic inference we performed population clustering61 on 67 genotyped biallelic CNVs. We obtained the optimal clustering with the assumption of three ancestral populations, with the African, European and Asian populations clearly differentiated (Fig. 7). Population differentiation of individual variants is commonly estimated by the statistic FST, which varies from 0 (undifferentiated) to 1 (population-specific)62. The average FST for the same 67 autosomal CNVs was 0.11, very similar to that observed for all autosomal Phase I HapMap SNPs (0.13)25.
Dr. Winters highlighted this portion of study cited:
quote:That is to say, despite the intensive mestizaje (genetic “mixture”) that has characterized our region over the centuries, we Caribbeans have mtDNAs that have maintained their original identity and that can be identified as African, Indian, or Caucasian . Their identity depends upon the women in our genetic tree at the end of the strictly maternal ancestral line. If this great-great-great grandmother were indigenous, then the corresponding Caribbean would have an indigenous mtDNA. He or she would have inherited it intact from that great-great-great grandmother who lived through those terrible first years of the colonization by means of his or her great-great grandmothers, great grandmothers, and maternal grandmother.
Dr. Winters how does this help you? Other than the dubious use of the word "caucasian" the highlighted passage above says that a group of people, who we know may look very similar, continue to carry the mtdna of their maternal ancestry - from different parts of the world. This seriously undermines your position regarding race.
Posted by Arwa (Member # 11172) on :
Dr. Clyde,
You can't distinguish "races" from one another by allelic frequencies for any gene. ^Read the article you posted^
Another exemple, the ABO blood groups.
As long homo sapiens exchanges (by sex) genes within self and can't do with other groups, then you will always have homo sapiens
Posted by alTakruri (Member # 10195) on :
A journalist writing about the work of the geneticists used the word race. So far no quotes from any of the scientists has been posted showing that they themselves propound the social concept of race as a concept with valid application in population genetics.
Until such quotes manifest please refrain from repeating the innacurate, erroneous, misstatement that:
quote: ... geneticists at the 13 research institutes [] found races can be determined biologically
Posted by Arwa (Member # 11172) on :
An important extract from the article I posted yesterday:
quote: With the hindsight provided by a full century, we can see with great clarity how the professions of law and medicine, and the science that influences them, are all enshrouded in the dominant assumptions of the era. Slavery and Reconstruction were both influenced and “explained” by evolutionary theory – from the ways in which scientists studied the shape and size of human skulls to justify slavery and racial stratification,to the medical diagnosis of the pathological conditions that would impel a slave to try to run away from her or his master. The legally upheld criminal-surety agreement and Dred Scott are now characterized as obviously flawed legal theory, but the cog-like fit of these legal views with the science of the period is explicable by the theoretical warrant provided by “the spirit of the times” – the Zeitgeist. We can clearly see how Dr. Cartwright could get away with medicalizing escape and thus medicalizing “deviance.” Yet we fail to see how our own medicalization of escape from boredom in the classroom by youngsters from certain class backgrounds (brought up on channel-flipping, cascading flip-frame video imagery) reflects the current Zeitgeist. This will undoubtedly bemuse historians who, 150 years hence – in the middle of the 22nd century – may re-analyze why the nation was so ready to deploy Ritalin to deal with a runaway diagnosis of ADHD.
In a parallel fashion, most of those engaged in the search for the genetic basis of criminality are now scrupulously avoiding the issue of race. But this is only because of the current hypersensitivity of the connection in the public domain, termed “politically incorrect” in the now prevailing political winds. That will change as the war on drugs, declining welfare support, a down-sized labor force in the secondary sector of the economy, and the skyrocketing growth of prisons converge. People of color will dominate the population of those incarcerated in state and federal prisons even more than they do now. Just as the attack on welfare and affirmative action were simmering issues in private boardrooms and private golf clubs for decades before the full-scale political attack moved to the public domain, so too the next decade will witness an outburst of behavioral genetics research, buttressed by the molecular reinscription of race tying crime to biological processes, and then correlating those biological processes to race. It is not beyond conjecture that it will be an African-American who will lead the charge, fully supported by the Pioneer Fund or some equivalent wellfunded, conservative think tank or funding source. The banner will be the academic and intellectual freedom to fearlessly pursue a topic wherever it may lead. Most people will fail to recognize that such work will be driven by the prevailing winds, the Zeitgeist. Those winds will be perceived as natural and normal. “The spirit of the times” will be taken for granted.
Will that be you, Dr. Clyde Winthers?
Posted by rasol (Member # 4592) on :
quote:Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic)
Nope. Nowhere does Tang claim Hispanics are a race. The very fact that a group that includes Mexicans, Dominicans and Puerto Ricans, with their vastly different ancestries, can nontheless be labeled and clustered in a genetic study illustrates the *distinction* between population clustering and 'race'.
Sorry Winters, you've produced no evidence, addressed none of the cited scholars, and failed to answer everyone's questions.
That about sums up this thread, wouldn't you say?
Posted by rasol (Member # 4592) on :
quote:Originally posted by Calypso: Dr. Winters how does this help you? Other than the dubious use of the word "caucasian" the highlighted passage above says that a group of people, who we know may look very similar, continue to carry the mtdna of their maternal ancestry - from different parts of the world. This seriously undermines your position regarding race.
lol. He just doesn't get it. Winters is demonstrating that advocacy of race depends upon a lack of comprehension of modern science.
Posted by alTakruri (Member # 10195) on :
I can't read either because I don't find the word race anywhere in the supplied materials.
The first one mentions * a national population - Caucasian (Spanish) * a color - Black (presumably Africans not Fijians) * a regional population - Orientals * socio-economic class - low & middle class mestije Hispanics * population genetics (not racial studies)
The second one mentions * racial/ethnic groups, but as unscientifically defined self-identifiers * genetic clusters Genetic cluster analysis matched self-identified racial/ethnic classification. This is the closest but no cigar. Race and ethnicity are two distinct social concepts. Birth certificates in New York state for instance have separate slots for entry of both race and ethnicity.
Somewhere in the unsearchable archive is more commentary on Tang et al from the last go round this forum had the validity of the social construct of race viability in population genetics.
quote:Originally posted by Clyde Winters: Arwa Can't you read
quote:
• Genomic DNA library construction http://www.funpecrp.com.br/gmr/year2002/vol2-1/gmr0004_full_text.htm Frequency of the hypervariable DNA loci D18S849, D3S1744, D12S1090 and D1S80 in a mixed ancestry population of Chilean blood donors M. Acuña1, H. Jorquera2, L. Cifuentes1 and L. Armanet3 1ICBM Genetic Program and 2Medical Technology School, Facultad de Medicina, Universidad de Chile, Casilla 70061, Santiago 7, Chile 3Forensic Medical Service, Santiago, Chile Corresponding author: M. Acuña E-mail: macuna@machi.med.uchile.cl Genet. Mol. Res. 1 (2): 139-146 (2002) Received April 11, 2002 Published June 27, 2002
Comparisons of D1S80 allele distribution between populations (Figure 2) using the ² test showed no significant differences between the Chilean population sample when compared with Southwestern US Hispanics and US Hispanics pooled (Zago et al., 1996; Huckenbeck et al., 1997). The research presented in this paper shows that the hypervariable DNA loci investigated are distinguishable from other Caucasian (Spanish), Black and Oriental populations, but that the D3S1744 locus is indistinguishable from the Caucasian population. All the loci studied are indistinguishable from USA Hispanic populations (Figures 2 and 3). This study provides the first database for DNA markers in low and middle socioeconomic strata in a Chilean population. The results presented indicate that the analysis of these loci may have useful applications in population genetics as well as in identity tests.
Tang et al:
quote: Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic) and were recruited from 15 different geographic locales within the United States and Taiwan. Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories. Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity.
Posted by Clyde Winters (Member # 10129) on :
Calypso
quote: -------------------------------------------------------------------------------- Dr. Winters highlighted this portion of study cited: quote: -------------------------------------------------------------------------------- That is to say, despite the intensive mestizaje (genetic “mixture”) that has characterized our region over the centuries, we Caribbeans have mtDNAs that have maintained their original identity and that can be identified as African, Indian, or Caucasian . Their identity depends upon the women in our genetic tree at the end of the strictly maternal ancestral line. If this great-great-great grandmother were indigenous, then the corresponding Caribbean would have an indigenous mtDNA. He or she would have inherited it intact from that great-great-great grandmother who lived through those terrible first years of the colonization by means of his or her great-great grandmothers, great grandmothers, and maternal grandmother. --------------------------------------------------------------------------------
Dr. Winters how does this help you? Other than the dubious use of the word "caucasian" the highlighted passage above says that a group of people, who we know may look very similar, continue to carry the mtdna of their maternal ancestry - from different parts of the world. This seriously undermines your position regarding race.
This helps support my position because some of these people are identified as caucasian, which identifies a race. It shows that races can be identified biologically and that these people were disguishd by their race andt geographical ancestry.
.
Posted by Clyde Winters (Member # 10129) on :
Arwa
quote:
quote: -------------------------------------------------------------------------------- With the hindsight provided by a full century, we can see with great clarity how the professions of law and medicine, and the science that influences them, are all enshrouded in the dominant assumptions of the era. Slavery and Reconstruction were both influenced and “explained” by evolutionary theory – from the ways in which scientists studied the shape and size of human skulls to justify slavery and racial stratification,to the medical diagnosis of the pathological conditions that would impel a slave to try to run away from her or his master. The legally upheld criminal-surety agreement and Dred Scott are now characterized as obviously flawed legal theory, but the cog-like fit of these legal views with the science of the period is explicable by the theoretical warrant provided by “the spirit of the times” – the Zeitgeist. We can clearly see how Dr. Cartwright could get away with medicalizing escape and thus medicalizing “deviance.” Yet we fail to see how our own medicalization of escape from boredom in the classroom by youngsters from certain class backgrounds (brought up on channel-flipping, cascading flip-frame video imagery) reflects the current Zeitgeist. This will undoubtedly bemuse historians who, 150 years hence – in the middle of the 22nd century – may re-analyze why the nation was so ready to deploy Ritalin to deal with a runaway diagnosis of ADHD.
In a parallel fashion, most of those engaged in the search for the genetic basis of criminality are now scrupulously avoiding the issue of race. But this is only because of the current hypersensitivity of the connection in the public domain, termed “politically incorrect” in the now prevailing political winds. That will change as the war on drugs, declining welfare support, a down-sized labor force in the secondary sector of the economy, and the skyrocketing growth of prisons converge. People of color will dominate the population of those incarcerated in state and federal prisons even more than they do now. Just as the attack on welfare and affirmative action were simmering issues in private boardrooms and private golf clubs for decades before the full-scale political attack moved to the public domain, so too the next decade will witness an outburst of behavioral genetics research, buttressed by the molecular reinscription of race tying crime to biological processes, and then correlating those biological processes to race. It is not beyond conjecture that it will be an African-American who will lead the charge, fully supported by the Pioneer Fund or some equivalent wellfunded, conservative think tank or funding source. The banner will be the academic and intellectual freedom to fearlessly pursue a topic wherever it may lead. Most people will fail to recognize that such work will be driven by the prevailing winds, the Zeitgeist. Those winds will be perceived as natural and normal. “The spirit of the times” will be taken for granted. --------------------------------------------------------------------------------
Will that be you, Dr. Clyde Winthers?
Not I.
Posted by Clyde Winters (Member # 10129) on :
Rasol
quote: quote: -------------------------------------------------------------------------------- Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic) --------------------------------------------------------------------------------
Nope. Nowhere does Tang claim Hispanics are a race. The very fact that a group that includes Mexicans, Dominicans and Puerto Ricans, with their vastly different ancestries, can nontheless be labeled and clustered in a genetic study illustrates the *distinction* between population clustering and 'race'.
You can't read he says that the subjects of his study were divided into race/ethnicity. This makes it clear that he was talking about the race of the people in the study.
Tang H, Quertermous T, Rodriguez B, Kardia SL, Zhu X, Brown A, Pankow JS, Province MA, Hunt SC, Boerwinkle E, Schork NJ, Risch NJ.
Division of Public Health Sciences, Fred Hutchinson Cancer Research Center, Seattle, WA, USA.
We have analyzed genetic data for 326 microsatellite markers that were typed uniformly in a large multiethnic population-based sample of individuals as part of a study of the genetics of hypertension (Family Blood Pressure Program). Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic) and were recruited from 15 different geographic locales within the United States and Taiwan. Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories. Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity. On the other hand, we detected only modest genetic differentiation between different current geographic locales within each race/ethnicity group. Thus, ancient geographic ancestry, which is highly correlated with self-identified race/ethnicity--as opposed to current residence--is the major determinant of genetic structure in the U.S. population. Implications of this genetic structure for case-control association studies are discussed.
This finding by Tang et al make it clear that genetic research can support the racial self identification of individuals. Posted by Djehuti (Member # 6698) on :
quote:Originally posted by Lord of the Nile: Deadhuti
What is your genetic classification? I asked because as I was walking down the street today I met two E3B guy one from the Philipines and the other from Algeria who were ranting about how some phenotypically black individuals were planning to undermine the genetic integrity of the R1a and R1b categories....
What a dumbo...the E3B guys.
Tehehe
quote:rasol responds: ^ You are not funny, just stupid.
Now go away.
LMAO Of course. Apparently 'Lord of denial' does not even know that E3b is not indigenous to the Philippines. Regardless, the only "dumbo" was him for telling that ridiculous lie.
Moving on..
Posted by Djehuti (Member # 6698) on :
Clyde, you are waging a war that has been lost a long time ago.
Everyone who has addressed you in this thread have already shown to you how your source contradicts your claims and proves them wrong.
THERE ARE NO GENES THAT CORRELATE TO RACIAL TYPOLOGY.
Why? BECAUSE RACIAL CLASSIFICATIONS ARE ARBITRARILY SUBJECTIVE.
Phenotype does NOT correlate to lineage. 'Negroid' Andamanese are no more African than Japanese. 'Negroid' Dravidians are no more African than Chinese or Eastern Europeans.
Case closed.
Posted by Clyde Winters (Member # 10129) on :
Djehuti
quote:
Clyde, you are waging a war that has been lost a long time ago.
Everyone who has addressed you in this thread have already shown to you how your source contradicts your claims and proves them wrong.
THERE ARE NO GENES THAT CORRELATE TO RACIAL TYPOLOGY.
Why? BECAUSE RACIAL CLASSIFICATIONS ARE ARBITRARILY SUBJECTIVE.
Phenotype does NOT correlate to lineage. 'Negroid' Andamanese are no more African than Japanese. 'Negroid' Dravidians are no more African than Chinese or Eastern Europeans.
Case closed.
If the case is closed why do all these scientist continue to confirm that race has a biological signiture.
Race is a key element in biological research. Biological researchers constantly use the term caucasian in reference to individuals and human populations. Lets look at the definitions of this term: Caucasian "A caucasoid person". Caucasoid: " of the major divisions of the human species whose members characteristically have skin color ranging from very light to brown...."
These definitions make it clear that use of this term implies discussion of race or the caucasoid human species. This term is frequently used in reference to the caucasoid species in numerous biological studies. Use of this term makes it clear race exist. Below are examples from different biological research papers.
Webster's Dictionary defines race as "a group of people of common ancestry or stock". Descent is defined as 'derivation from an ancestor'.
The term Caucasian race or Caucasian is used to refer to people whose ancestry can be traced back to Europe, North Africa, West Asia, South Asia and parts of Central Asia. It was once considered a useful taxonomical categorization of human racial groups based on a presumed common geographic and/or linguistic origin. Below are science articles where race is discussed. This makes it clear that race is part of the science discourse.
[QUOTE]
Forensic value of the multicopy Y-STR marker DYS464
John M. Butler * , Richard Schoske 1 Biotechnology Division, National Institute of Standards and Technology, Gaithersburg, MD, USA Abstract. The tetranucleotide Y-chromosome short tandem repeat (Y-STR) marker, DYS464, first reported by Redd et al. [Forensic Sci. Int. 130 (2002) 97] appears to be the most polymorphic Y-STR marker discovered to date. A single primer pair can generate up to four distinct peaks over an allele range of 9–20 repeats. Allele calls can be made based on peaks that are present (conservative approach; C-type) or a combination of alleles and peak height ratios (expanded typing method; E- type). We have observed 113 C-types and 179 E-types in 679 males from three US populations. D 2003 Elsevier B.V. All rights reserved. Keywords: Y-STR; Y-chromosome; DYS464; Multicopy loci; DNA typing 1. Introduction DYS464 occurs at least four times in the highly palindromic region near the center of the long arm of the Y-chromosome [1–3]. In forensic casework applications where the amount of typable DNA material may be limited, the use of highly polymorphic markers is advantageous in order to limit the number of markers needed to distinguish unrelated individuals. Page 2 The primers VIC-CTTTGGGCTATGCCTCAGTTT and GCCATACCTGGGTAACAGA- GAGAC produce green-labeled amplicons in the size range of 242–286 bp for DYS464 alleles 9–20, while the primers 6FAM-AGTTTACGAGCTTTGGGCTATG and GTGGCAAGATCTCATTTCTTCAA generate blue dye-labeled polymerase chain reac- tion (PCR) products that are 327–367 bp in size. PCR conditions are as previously described for the Y-STR 20plex [5]. An allelic ladder was created for DYS464 (Fig. 1), which contains all of the major alleles as well as single-base variants observed in our population study [3]. 3. Results and discussion We observed 179 expanded types with DYS464 in 679 male samples from three different US population sets: 265 African–Americans, 262 Caucasians, and 152 His- panics.
Race is a key element in biological research. Biological researchers constantly use the term caucasian in reference to individuals and human populations. Lets look at the definitions of this term: Caucasian "A caucasoid person". Caucasoid: " of the major divisions of the human species whose members characteristically have skin color ranging from very light to brown...."
These definitions make it clear that use of this term implies discussion of race or the caucasoid human species. This term is frequently used in reference to the caucasoid species in numerous biological studies. Use of this term makes it clear race exist. Below are examples from different biological research papers.
Indigenous Puerto Rico: DNA evidence upsets established history By Rick Kearns
Reprinted with permission, from Indian Country Today Posted: October 06, 2003 - 1:34pm EST by: Rick Kearns / Correspondent / Indian Country Today
History is written by the conquerors. The Native peoples of North America know this all too well, as they are still trying to bring the truth to light. Now, their long-lost Caribbean cousins are beginning the same process.
It’s an uphill battle.
Most Puerto Ricans know, or think they know, their ethnic and racial history: a blending of Taino (Indian), Spanish and African. Students of the islands’ past have read the same account for over 300 years; that the Native people, and their societies, were killed off by the Spanish invaders by the 1600s. It was always noted though, how many of the original colonists married Taino women or had Taino concubines, producing the original mestizaje (mixture) that, when blended with African, would produce Puerto Ricans.
Those first unions, according to the conventional wisdom, explain why some Puerto Ricans have "a little bit" of Native heritage. Mainly we are Spanish, we are told, with a little African blood and far-away Taino ancestry.
But the order of that sequence will have to change.
Dr. Juan Martinez Cruzado, a geneticist from the University of Puerto Rico Mayaguez who designed an island-wide DNA survey, has just released the final numbers and analysis of the project, and these results tell a different story. According to the study funded by the U.S. National Science Foundation, 61 percent of all Puerto Ricans have Amerindian mitochondrial DNA, 27 percent have African and 12 percent Caucasian. (Nuclear DNA, or the genetic material present in a gene’s nucleus, is inherited in equal parts from one’s father and mother. Mitochondrial DNA is inherited only from one’s mother and does not change or blend with other materials over time.) http://www.biomedcentral.com/1471-2350/6/30
High frequency of the IVS2-2A>G DNA sequence variation in SLC26A5, encoding the cochlear motor protein prestin, precludes its involvement in hereditary hearing loss Hsiao-Yuan Tang1 , Anping Xia1 , John S Oghalai1 , Fred A Pereira1, 2 and Raye L Alford1
Background Cochlear outer hair cells change their length in response to variations in membrane potential. This capability, called electromotility, is believed to enable the sensitivity and frequency selectivity of the mammalian cochlea. Prestin is a transmembrane protein required for electromotility. Homozygous prestin knockout mice are profoundly hearing impaired. In humans, a single nucleotide change in SLC26A5, encoding prestin, has been reported in association with hearing loss. This DNA sequence variation, IVS2-2A>G, occurs in the exon 3 splice acceptor site and is expected to abolish splicing of exon 3. Methods To further explore the relationship between hearing loss and the IVS2-2A>G transition, and assess allele frequency, genomic DNA from hearing impaired and control subjects was analyzed by DNA sequencing. SLC26A5 genomic DNA sequences from human, chimp, rat, mouse, zebrafish and fruit fly were aligned and compared for evolutionary conservation of the exon 3 splice acceptor site. Alternative splice acceptor sites within intron 2 of human SLC26A5 were sought using a splice site prediction program from the Berkeley Drosophila Genome Project. Results The IVS2-2A>G variant was found in a heterozygous state in 4 of 74 hearing impaired subjects of Hispanic, Caucasian or uncertain ethnicity and 4 of 150 Hispanic or Caucasian controls (p = 0.45). The IVS2-2A>G variant was not found in 106 subjects of Asian or African American descent. No homozygous subjects were identified (n = 330). Sequence alignment of SLC26A5 orthologs demonstrated that the A nucleotide at position IVS2-2 is invariant among several eukaryotic species. Sequence analysis also revealed five potential alternative splice acceptor sites in intron 2 of human SLC26A5.
http://www.ecacc.org.uk/default.asp?Reload=detail2.asp?itemid=92970 ECACC Releases all 5 Human Random Control (HRC) DNA (480 HRC individual DNAs) in Convenient 96 Well Panels Building on the success of the ECACC Human Random Control (HRC) DNA in genetics research (see selected publications list) ECACC has responded to customer demand and re-formatted all 480 HRC DNA samples into a more convenient 96 well format. This new development has been made possible by ECACC’s investment, during 2005, in automated liquid handling technologies. This development along with more efficient work practises has had the added benefit of substantially reducing the price of obtaining the whole 480 HRC DNA resources, bringing it within the scope of individual consumable budgets. The HRC DNA consists of authenticated, high quality purified human genomic DNA. Each of the available 480 samples is from a single individual, providing a control population of randomly selected, non-related UK Caucasian blood donors. The HRC DNA is available as a series of five panels each containing samples from 96 separate individuals in a convenient 8 x 12 well format. This is a readily available, cost effective and renewable source of standardised control DNA samples for use in a range of applications that include: • Population studies • Mutation analysis • SNP genotyping • Validation of technology • Assay development and validation • Association analysis • Comparative genomic hybridisation • Genomic DNA library construction http://www.funpecrp.com.br/gmr/year2002/vol2-1/gmr0004_full_text.htm Frequency of the hypervariable DNA loci D18S849, D3S1744, D12S1090 and D1S80 in a mixed ancestry population of Chilean blood donors M. Acuña1, H. Jorquera2, L. Cifuentes1 and L. Armanet3 1ICBM Genetic Program and 2Medical Technology School, Facultad de Medicina, Universidad de Chile, Casilla 70061, Santiago 7, Chile 3Forensic Medical Service, Santiago, Chile Corresponding author: M. Acuña E-mail: macuna@machi.med.uchile.cl Genet. Mol. Res. 1 (2): 139-146 (2002) Received April 11, 2002 Published June 27, 2002
Comparisons of D1S80 allele distribution between populations (Figure 2) using the ² test showed no significant differences between the Chilean population sample when compared with Southwestern US Hispanics and US Hispanics pooled (Zago et al., 1996; Huckenbeck et al., 1997). The research presented in this paper shows that the hypervariable DNA loci investigated are distinguishable from other Caucasian (Spanish), Black and Oriental populations, but that the D3S1744 locus is indistinguishable from the Caucasian population. All the loci studied are indistinguishable from USA Hispanic populations (Figures 2 and 3). This study provides the first database for DNA markers in low and middle socioeconomic strata in a Chilean population. The results presented indicate that the analysis of these loci may have useful applications in population genetics as well as in identity tests.
http://www.biomedcentral.com/1471-2415/5/5 A polymorphism at codon 31 of gene p21 is not associated with primary open angle glaucoma in Caucasians Thomas Ressiniotis1, 2 , Philip G Griffiths1 , Sharon M Keers2 , Patrick F Chinnery2 and Michael Birch1 1Department of Ophthalmology, Royal Victoria Infirmary, Newcastle upon Tyne, UK 2Department of Neurology, The Medical School, The University of Newcastle upon Tyne, UK
The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2415/5/5 Received 18 January 2005 Accepted 4 April 2005 Published 4 April 2005
Background Primary open angle glaucoma (POAG) is considered to be a neurodegenerative optic neuropathy, in which cell death occurs by apoptosis. p21, is an important protective component of the apoptotic pathway, regulating cellular arrest in the presence of DNA damage. An unstable or altered p21 protein could modify the cellular response to genomic injury and abolish the effect of p21. A previous study on a Chinese cohort suggested that the p21 codon 31 polymorphism may alter the state of apoptosis in glaucomatous optic neuropathy, failing to protect the ganglion cells.The aim of this study was to test the hypothesis that a p21 codon 31 polymorphism is associated with POAG on a Caucasian cohort. Methods 140 POAG patients and a control group of 73 healthy individuals were included in the study. All the subjects were of Caucasian origin. Genomic DNA was amplified by polymerase chain reaction, followed by enzymatic restriction fragment length polymorphism technique (PCR-RFLP). Patients and controls were genotyped for a single nucleotide polymorphism (C/A transversion) in the third base of codon 31 of p21, which leads to a serine (Ser)/arginine (Arg) substitution.
J Forensic Sci, Mar. 2005, Vol. 50, No. 2 Paper ID JFS2004293 Available online at: www.astm.org TECHNICAL NOTE Margaret C. Kline,1 M.S.; Peter M. Vallone,1 Ph.D.; Janette W. Redman;1 David L. Duewer,2 Ph.D.; Cassandra D. Calloway,3,4 M.S.; and John M. Butler,1 Ph.D. Mitochondrial DNA Typing Screens with Control Region and Coding Region SNPs∗
ABSTRACT: Mitochondrial DNA (mtDNA) analysis has found an important niche in forensic DNA typing. It is used with highly degraded samples or low-copy number materials such as might be found from shed hair or bones exposed to severe environmental conditions. The primary advantage of mtDNA is that it is present in high copy number within cells and therefore more likely to be recovered from highly degraded specimens. A major disadvantage to traditional forensic mtDNA analysis is that it is time-consuming and labor-intensive to generate and review the 610 nucleotides of sequence information commonly targeted in hypervariable regions I and II (HVI and HVII) of the control region. In addition, common haplotypes exist in HVI/HVII mtDNA sequences that can reduce the ability to differentiate two unrelated samples. In this report we describe the utility of two newly available screening assays for rapid exclusion of non-matching samples. The LINEAR ARRAY mtDNA HVI/HVII Region-Sequencing Typing Kit (Roche Applied Science, Indianapolis, IN) was used to type 666 individuals from U.S. Caucasian, African American, and Hispanic groups. Processing of the LINEAR ARRAY probe panels “mito strips” was automated on a ProfiBlot workstation. Observable variation in 666 individuals is reported and frequencies of the mitotypes within and between populations are presented. Samples exhibiting the most common Caucasian mitotype were subdivided with a multiplexed amplification and detection assay using eleven single nucleotide polymorphisms in the mitochondrial genome. These types of screening assays should enable more rapid evaluation of forensic casework samples such that only samples not excluded would be subjected to further characterization through full HVI/HVII mtDNA sequence analysis.
This paper makes it clear that a popular race used in biological research is caucasian.
Posted by Calypso (Member # 8587) on :
I asked Dr. Winters:
quote: how does this help you? Other than the dubious use of the word "caucasian" the highlighted passage above says that a group of people, who we know may look very similar, continue to carry the mtdna of their maternal ancestry - from different parts of the world. This seriously undermines your position regarding race.
Dr. Winters replied
quote: This helps support my position because some of these people are identified as caucasian, which identifies a race. It shows that races can be identified biologically and that these people were disguishd by their race andt geographical ancestry.
Dr. Winters, based on the findings of the study you cited, can one look at a Hispanic woman and, from just her outer appearance, predict what type of ancestral mtdna she has?
Posted by Clyde Winters (Member # 10129) on :
Calypso
quote:
I asked Dr. Winters: quote: -------------------------------------------------------------------------------- how does this help you? Other than the dubious use of the word "caucasian" the highlighted passage above says that a group of people, who we know may look very similar, continue to carry the mtdna of their maternal ancestry - from different parts of the world. This seriously undermines your position regarding race. --------------------------------------------------------------------------------
Dr. Winters replied quote: -------------------------------------------------------------------------------- This helps support my position because some of these people are identified as caucasian, which identifies a race. It shows that races can be identified biologically and that these people were disguishd by their race andt geographical ancestry. --------------------------------------------------------------------------------
Dr. Winters, based on the findings of the study you cited, can one look at a Hispanic woman and, from just her outer appearance, predict what type of ancestral mtdna she has?
No.
Posted by Arwa (Member # 11172) on :
quote: Will that be you, Dr. Clyde Winthers?
Not I.
You are not far to lead us there.
If anything Faust teaches us, then it must be incapacity of humanity.
Posted by Djehuti (Member # 6698) on :
^ If anything, Winters teaches us that there is no end to his silly notions, even if it means the of logic itself.
quote:Calypso asks: Dr. Winters, based on the findings of the study you cited, can one look at a Hispanic woman and, from just her outer appearance, predict what type of ancestral mtdna she has?
quote:Clyde Winters replied: No.
Then does this not mean that biological race does not exist? Posted by Calypso (Member # 8587) on :
I asked Dr. Winters:
quote:Dr. Winters, based on the findings of the study you cited, can one look at a Hispanic woman and, from just her outer appearance, predict what type of ancestral mtdna she has?
Dr. Winters replied:
quote:No.
Thanks for the reply Dr. Winters. Your answer is absolutely correct. One cannot look at any particular human being and tell with certainty their ancestral mtdna or Y chromosome.
This is one of the big problems with racial categories. Race is not merely phenotype but also lineage.
From your answer you've conceded that phenotype can belie lineage.
Humans have been so mobile that you have West African men with R lineages; Europeans with E3b; J in North and East Africa as well as Europe; european maternal DNA in North Africa; on and on it goes.
Look at any mtdna or Y chromosome map and what strikes you immediately is how confusing it is. Lineages far flung are all over the map criss-crossing continents, deserts, oceans!!!
You just don't have the necessary isolation that would be required for any groups to develop into sub-species.
No subspecies mean no races. Posted by Supercar (Member # 6477) on :
quote:Originally posted by Clyde Winters:
Supercar
quote:
It seems to me that George Gill is defending the "concept" of races, because apparently as a "Forensic" anthropologist, that is what he is expected to do. The pressure of the job to seek divisions and characterize people based on unscientific 'socially' constructed as opposed to biologically authenticated 'races', warrants him to defend the said social constructs. There is a difference between human 'races' being a real 'social construct' and being a 'real' biological phenomenon.
Here you are going too far. Other physical anthropologist outside of forensics can also determine race scientifically and not as a social construct. http://www.kacike.org/MartinezEnglish.html
I am not sure what you mean I'm going too far, when you haven't answered my questions with regards to George Gill. But just to take bio-anthropologists in America as an example, since George Gill is one of them; outside of the AAA, how many American bio-anthropologists who are not "forensics" or work with cops in criminal investigation, claim that social constructs of human 'races' are scientifically valid? They had better outnumber the members of the AAA, and their work has to be up-to-date, not from the 19th century. I ask this, because the AAA stance on human 'races' is quite clear, and doesn't support you. Moreover, how many "human" races do these folks propose up-to-date, and on what basis? Please get back to me on this a.s.a.p.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Clyde Winters:
Gill has already made it clear that about half the scientists believe race exist and the other half belive race does not exist. The biology literature is full of reference to race.
Do you have the comprehensive list of 'half' of these scientists, and how Gill has communicated with them. Do these scientists fall outside of Gill's line of work, which is "forensics", and do you have their up-to-date peer reviewed defense of human 'races'?
With regards to your mention of "literature full of references of race", are these "scientific" definitions of race as opposed to "social contructs" of ethnicity? For instance, you post...
Race
From Wikipedia, the free encyclopedia
Jump to: navigation, search
This article may benefit form being shortened by the use of summary style.
Summary style moves large sections to sub-articles that are summarized in the main article. For other uses, see Race (disambiguation).
The term race distinguishes a population of humans (or non-humans) from other populations. The most widely used human racial categories are based on visible traits (especially skin color and facial features), genes, and self-identification. Conceptions of race, as well as specific racial groupings, vary by culture and over time and are often controversial, for scientific reasons as well as their impact on social identity and identity politics. Legal definitions, common usage, and scientific meaning can all be conflated, causing confusion and controversy.
Do you think that the above is a scientific definition of race? Notwithstanding the pending answer, the wiki piece has something quite instructive therein, i.e. concepts of "races", essentially with regards to social constructs, vary from culture to culture; in this regard, who is to say whose social construct is the valid one, and whose isn't? You bet ya, science does! Science is the discipline that deals with anatomy and the corresponding genetic constituents. You cannot separate anatomy from DNA. Science is the discipline that puts forth the challenge, i.e. via falsefiable material, and any one from any culture, should feel free to objectively disprove the matter at hand. So science isn't subject to cultural variation. It is the study of the natural world, understanding it, and adopting to such accordingly. And now, to the rest of your post...
Webster's Dictionary defines race as "a group of people of common ancestry or stock". Descent is defined as 'derivation from an ancestor'.
Please show us how, George Gill's 'divisions' of humans based on mere physical 'resemblance' fits this definition?
Posted by Doug M (Member # 7650) on :
What Mr. Winters doesnt understand is that from a forensic perspective BLACK is ONLY meaningful as a statistic. When it comes to measuring poverty levels, health care, crime rates, access to affordable housing and other population statistics, BLACK is a meaningful term. However, that does NOT mean that BLACK is a race. Race and socio-economic statistics based on superficial characteristics are TWO different things. More importantly, the FACT that SUPERFICIAL characteristics, like skin color, are the MAIN determiner of socio-economic status, based on HISTORICALLY invalid concepts of race are the REASON why we should NOT be parroting OUTDATED racist IDEOLOGIES. It is only if you FOLLOW such a SOCIO ECONOMIC model that the SUFFERING of BLACKS world wide is JUSTIFIED and NECESSARY because THEY are too much of a burden on the ADVANCED "civilizations" of the Western World and WHITE "race". In other words, RACE and SOCIO-ECONOMIC policy go hand in hand, because you CANT have one without the OTHER and historically that is the BASIS for the DISPARITY between WHITES and BLACKS in the world today. But remember, NONE of this has ANYTHING to do with RACE being a SCIENTIFICALLY VALID concept. It ONLY has to do with using SUPERFICIAL characteristics to define RACE as a MECHANISM for enforcing SOCIAL and ECONOMIC POLICY.
Posted by Clyde Winters (Member # 10129) on :
^^DougM The scientist in the papers under discussion are not talking about SES, they are talking about race from a biological perspective.
Posted by Clyde Winters (Member # 10129) on :
Supercar
quote: Do you have the comprehensive list of 'half' of these scientists, and how Gill has communicated with them. Do these scientists fall outside of Gill's line of work, which is "forensics", and do you have their up-to-date peer reviewed defense of human 'races'?
Supercar this is not how research works. Gill has made a claim. This claim remains confirmed until someone shows otherwise. If you believe he is wrong about the demographics of who does and does not support the concept of race it is up to you to disconfirm his thesis. Right now his statement remains valid.
The fact that the articles by Tang et al and others were concerned with race confirms the reality of race being a part of science as even noted by Duster.
Supercar
quote:
Please show us how, George Gill's 'divisions' of humans based on mere physical 'resemblance' fits this definition?
Gill's definition of race is probably based on his discipline. Every definition of this or that phenomena is depended upon the field or discipline in which the term is used.
Your job is show how Gill's definition of race is not supported by his field of study.
.
Posted by rasol (Member # 4592) on :
No, Dr. Winters, the problem is that you don't understand what you are citing.
Nor do you want to.
That's why you never answer anyone's questions or reply to specifics. You just spam materials you don't understand and pretend you are making some kind of point, but it never works, because no one on ES is that stupid.
At least when you discuss some of your wilder linguistic theories you honestly seem to think you know what you're talking about, and it's fun to discuss.
But your pseudo-biology threads are boring, because you don't even know *how* to discuss the topic. Posted by rasol (Member # 4592) on :
quote:Your job is show how Gill's definition of race is not supported by his field of study.
The following statement was adopted by the Executive Board of the American Anthropological Association, acting on a draft prepared by a committee of representative American anthropologists.
We believe that it represents generally the contemporary thinking and scholarly positions of a majority of anthropologists.
In the United States both scholars and the general public have been conditioned to viewing human races as natural and separate divisions within the human species based on visible physical differences.
With the vast expansion of scientific knowledge in this century, however, it has become clear that human populations are not unambiguous, clearly demarcated, biologically distinct groups. Evidence from the analysis of genetics (e.g., DNA) indicates that most physical variation, about 94%, lies within so-called racial groups. Conventional geographic "racial" groupings differ from one another only in about 6% of their genes. This means that there is greater variation within "racial" groups than between them. In neighboring populations there is much overlapping of genes and their phenotypic (physical) expressions. Throughout history whenever different groups have come into contact, they have interbred. The continued sharing of genetic materials has maintained all of humankind as a single species.
Physical variations in any given trait tend to occur gradually rather than abruptly over geographic areas. And because physical traits are inherited independently of one another, knowing the range of one trait does not predict the presence of others. For example, skin color varies largely from light in the temperate areas in the north to dark in the tropical areas in the south; its intensity is not related to nose shape or hair texture. Dark skin may be associated with frizzy or kinky hair or curly or wavy or straight hair, all of which are found among different indigenous peoples in tropical regions. These facts render any attempt to establish lines of division among biological populations both arbitrary and subjective.[ Posted by Clyde Winters (Member # 10129) on :
^ This is fine statement but individual anthropolgists conduct research in any way they wish. It is just wishful thinking to believe that everyone follows this policy as noted by Dr. Gill.
Posted by Clyde Winters (Member # 10129) on :
copyright January 13, 2003 Scientific American Magazine
The Reality of Race There's hardly any difference in the DNA of human races. That doesn't mean, argues sociologist Troy Duster, that genomics research can ignore the concept.
By Sally Lehrman
Race doesn't exist, the mantra went. The DNA inside people with different complexions and hair textures is 99.9 percent alike, so the notion of race had no meaning in science. At a National Human Genome Research Institute (NHGRI) meeting five years ago, geneticists were all nodding in agreement. Then sociologist Troy Duster pulled a forensics paper out of his briefcase. It claimed that criminologists could find out whether a suspect was Caucasian, Afro-Caribbean or Asian Indian merely by analyzing three sections of DNA.
"It was chilling," recalls Francis S. Collins, director of the institute. He had not been aware of DNA sequences that could identify race, and it shocked him that the information can be used to investigate crimes. "It stopped the conversation in its tracks."
In large part thanks to Duster, Collins and other geneticists have begun grappling with forensic, epidemiological and pharmacogenomic data that raise the question of race at the DNA level. The NHGRI now routinely includes experts from the social disciplines to assist in guiding research priorities and framing the results for the public. "The complexities of the DNA sequence require not just simplistic statements about similarities between groups but a full appreciation of history, anthropology, social science and politics," Collins has realized. "Duster is a person that rather regularly gets tapped on the shoulder and asked for help."
The urbane 66-year-old Duster, who splits his time between appointments at the University of California at Berkeley and New York University, examines how the public absorbs news about genetics into existing beliefs and how those perceptions also shape the use of genetic sequencing, DNA probes and other molecular techniques.
Those techniques have revealed that race is minor at the DNA level. The genetic differences between any two randomly selected individuals in one socially recognized population account for 85 percent of the variation one might find between people of separate populations. Put another way, the genetic difference between two individuals of the same race can be greater than those between individuals of different races--table sugar may look like salt, but it has more similarities with corn syrup. But genetics cannot prove that race doesn't exist, Duster explains. No amount of logic will erase the concept or destroy the disparities that arise from it, because people use race to sort their social groupings and to define their social and economic interactions. Moreover, they do so in ways that have significant biological consequences. Duster recently helped to draft a 15-page statement for the American Sociological Association showing how race persists as a factor in disparities in health and other areas of life. "You cannot just get rid of the concept without doing tremendous damage to the epidemiologic research done so far," Duster says. African-Americans are three times as likely to die from heart disease, for example. "Blacks are redlined by banks, followed by department store security, pulled over by the police. This can produce hypertension," he points out. "It can give you a heart attack."
A new approach, gene clustering, avoids race by dividing according to medically important markers, such as genes for the enzymes necessary to metabolize drugs. But society will very likely re-create racial categories and rankings under the new terms, Duster predicts. And by failing to name the social context, this strategy gives base-pair differences undue emphasis at the expense of environmental influences. Race is a social reality, Duster observes, and he warns that science itself is a social institution susceptible to essentialist perceptions of race.
Raised in poverty during the Great Depression by a mother from an upper-class family, Duster, whose father died when he was nine, grew up navigating between Chicago's tough streets and its privileged intellectual and civic parlors. He witnessed firsthand the complexities of social categories and learned to "code-switch" from one to another, much as he capably moves among sociology, anthropology and genetics now.
Duster started out as a journalist but quit in moral indignation when chided for failing to interview a trapped subway motorman waiting for a leg amputation. He turned to sociology and joined Berkeley in 1967, quickly developing a reputation for thought-provoking work on drugs and social policy. In the 1970s Duster was a familiar voice in National Institutes of Health committees reviewing grants for research on mental health and drug abuse. While sitting on a panel for President Jimmy Carter's Commission on Mental Health, he began to hear researchers speculate that drug addiction and mental illness were linked to genetic susceptibilities.
Duster found the conversations alarming. His book, Backdoor to Eugenics, aimed to stimulate public debate by showing how genetic-screening policies tended to reinforce the power structures already within society. Since then, he has pressed geneticists and molecular biologists to consider the social meaning that emerges from what they perceive as unbiased fact.
At first they resisted. As a member of the Ethical, Legal and Social Implications Working Group advising the agencies on human genome research, Duster urged the NIH and the Department of Energy to challenge The Bell Curve, the 1994 best-seller that argued that race correlated with intelligence. Government officials held up a response for eight months, convinced that the nonexistence of race at the genome level spoke for itself.
Duster, along with fellow committee member Dorothy Nelkin of New York University, highlighted the ways in which cultural context influences the application of medical and behavioral genetics. Now Collins is relying on Duster and other collaborators, such as University of Wisconsin molecular biologist Pilar Ossorio, to help explain why race must be acknowledged even if it is biologically inconsequential. "It's a tightrope between trying to rescue the importance and meaning of research on race without giving it a false reality," Duster says.
Indeed, although he maintains that race is significant in genetics, Duster insists it is misleading to reinscribe race as a definitive system to group people who share geographic origins and thus some genes. For one, concepts of race vary geographically as well as historically. The ethnic status of South Asians, for example, has changed over the past century in the U.S. and more often serves to define a political and cultural "other" than something biological. In 1920 Oregon granted citizenship to Bhagat Singh Thind of India during a ban on Asian immigration. But the U.S. Supreme Court disagreed, stating that even though Thind should be considered "Caucasian," he still wasn't "white." (Thind, who had joined the U.S. Army during World War I, managed to stay in the country, earn a Ph.D. and publish 15 books on metaphysics.)
Researchers have also advocated assessing health risks within ethnic groups based on inherited variations in just one DNA base pair. But such single-nucleotide polymorphism (SNP) profiles can be deceptive, Duster warns. Ethnic differences in drug metabolism or response to tobacco exist, but they appear to be minimal and depend strongly on the environment. The emphasis on DNA, he remarks, transforms health status into a biological inevitability, and it is tempting to use the same tools to profile criminality or intelligence at the genome level.
Specific variations in DNA can be linked to ancestral geographic origins, but those differences only occasionally offer a medically important clue. They fail to define any essential characteristics of a whole group. Race, itself a fluid idea, is part of the environmental context of the genome, Duster suggests. "Race is a relationship," he says. "When you talk about race as a relationship, it prevents anyone from giving it false meaning."
-------------------------------------------------------------------------------- Sally Lehrman is a medical technology and health policy journalist based in San Francisco.
Posted by rasol (Member # 4592) on :
quote:Originally posted by Clyde Winters: This is fine statement but individual anthropolgists conduct research in any way they wish.
The above is and immaterial comment, with no bearing on the fact that the majority of scholars in the field disagree with your ill-informed opinion.
quote: It is just wishful thinking to believe that everyone follows this policy
Incorrect, as it is not a *policy*, but rather a professional assessment from leading scholars in the field.
You may not agree with it, but you know nothing about anthropology, and show a very poor aptitude for learning.
Therefore you can't intelligently refute it.
This is why you resort to blind google/spamming and rhetorical response in hopes of finding something to somehow support your racialist views. You've failed to do so.
Posted by rasol (Member # 4592) on :
quote:There's hardly any difference in the DNA of [human races.]
Invalidates race biologically, hence conceding the material point.
quote: That doesn't mean, argues sociologist Troy Duster
Sociologist = Appeal to Authority fallacy.
quote:But genetics cannot prove that race doesn't exist, Duster explains.
Burdan of proof fallacy. The burdan is actually on racialist to prove fundamental genetic divisions within designated races....which your article admits do not exist.
quote: No amount of logic will erase the concept or destroy the disparities that arise from it, because people use race to sort their social groupings
Non-sequitur. Social groupings are sociology, not biology. No amount of reference to social groups can validate race biologically.
Well that didn't help you did it?
Google up something else.....something more relevant and less desparate sounding.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Clyde Winters:
Supercar
quote: Do you have the comprehensive list of 'half' of these scientists, and how Gill has communicated with them. Do these scientists fall outside of Gill's line of work, which is "forensics", and do you have their up-to-date peer reviewed defense of human 'races'?
Supercar this is not how research works. Gill has made a claim. This claim remains confirmed until someone shows otherwise.
Been done. Now, try answering the questions I asked as per layout, without a single one unaddressed.
quote:Clyde Winters:
If you believe he is wrong about the demographics of who does and does not support the concept of race it is up to you to disconfirm his thesis.
Gill is an American 'forensics' physical anthropologist. The question is, do you know what the AAA is?
quote:Clyde Winters:
quote:Supercar:
Please show us how,George Gill's 'divisions' of humans based on mere physical 'resemblance' fits this definition?
Gill's definition of race is probably based on his discipline. Every definition of this or that phenomena is depended upon the field or discipline in which the term is used.
What definition would that be; the social constructs of race, or the biological, and hence, valid definition of 'race'? If you are capable enough to blindly quote people, then surely you should be just as capable of citing their definitions.
quote:Clyde:
Your job is show how Gill's definition of race is not supported by his field of study.
Why, because you can't read, and therefore, keep asking for things that have already been addressed. It is your job to answer the questions I asked you pertaining to George Gill's unsubstantiated claims. Why have you failed in doing your job?
Posted by Clyde Winters (Member # 10129) on :
Do you have the comprehensive list of 'half' of these scientists, and how Gill has communicated with them. Do these scientists fall outside of Gill's line of work, which is "forensics", and do you have their up-to-date peer reviewed defense of human 'races'?
Supercar this is not how research works. Gill has made a claim. This claim remains confirmed until someone shows otherwise. --------------------------------------------------------------------------------
Been done. Now, try answering the questions I asked as per layout, without a single one unaddressed.
As I said before you will have to prove that Gill is wrong not me. The research of Tang et al, and the other researchers cited in this thread prove that race is part of the scientific discourse.
Supercar
quote:
Gill is an American 'forensics' physical anthropologist. The question is, do you know what the AAA is?
[quote]
Yes I belong to the organization. In addition I have presented papers at the AAA annual conferences on my Indus Valley and Olmec decipherments. How many papers have you presented at the AAA.
Your job is show how Gill's definition of race is not supported by his field of study. --------------------------------------------------------------------------------
Why, because you can't read, and therefore, keep asking for things that have already been addressed. It is your job to answer the questions I asked you pertaining to George Gill's unsubstantiated claims. Why have you failed in doing your job?
I am doing my job posting research and researchers who claim race exist. It is your job to illustrate that these reseachers are wrong.
Up to now you have not done so.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Clyde Winters:
I am doing my job...
...then where are the answers to my questions? You are at least smart enough to know that not doing your job, can get you fired.
Posted by Clyde Winters (Member # 10129) on :
^ You have never asked a legitimate question. You are asking questions about Gill's, these are questions only Dr. Gill can answer. Since you're so smart maybe you can read his mind and find the answer to your question.
The fact remains, I have confirmed that race is part of the scientific discourse my job is well done.
.
Posted by Supercar (Member # 6477) on :
quote:Clyde:
Yes I belong to the organization.
LOL. You belong to the American Anthropological Association, and yet, cannot see that the AAA stance on race [clickable] doesn't support you?
quote:Clyde:
In addition I have presented papers at the AAA annual conferences on my Indus Valley and Olmec decipherments.
You belong to AAA, and yet, still don't know the biological definition of race? Does AAA go by the biological definition of race, or your social constructs?
quote:Clyde Winter:
How many papers have you presented at the AAA.
^Clumsy smokescreen. What genetics or bio-anthropological papers have you presented at the AAA?
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Clyde Winters:
^ You have never asked a legitimate question.
What questions are legitimate to you; the ones that you can actually answer?
Hey trolls don't think it is legitimate to ask them questions; that doesn't stop me though.
quote:Clyde:
You are asking questions about Gill's, these are questions only Dr. Gill can answer.
You've got to be kidding; you mean, you can cite George Gills, and not know what he is talking about?
quote:Clyde:
The fact remains, I have confirmed that race is part of the scientific discourse my job is well done.
That fact would be a figment of your imagination. You can snap out of it, by answering my questions.
Will pick this up from where I left; got some business to take care of at the moment.
Posted by Djehuti (Member # 6698) on :
^ Then you are wasting your time, Supe! LOL
I almost feel sorry for Clyde who is humiliating himself yet again on this board!
LMAO @ ".. I belong to the organization. In addition I have presented papers at the AAA annual conferences..."
If I didn't know any better, I'd say Clyde has resorted to outright lying. Either that or the AAA is ROTFL at him as much as I am! Posted by Clyde Winters (Member # 10129) on :
You are asking questions about Gill's, these are questions only Dr. Gill can answer. --------------------------------------------------------------------------------
You've got to be kidding; you mean, you can cite George Gills, and not know what he is talking about?
I know exactly what he's talking about. Race exist as a scientific reality. You're the one questioning his statistics.
Gill, like Tang et al make it clear race is part of the scientific discourse.
How many papers have you presented at the AAA. --------------------------------------------------------------------------------
^Clumsy smokescreen. What genetics or bio-anthropological papers have you presented at the AAA?
Friday, April 16th ... in Highland Chiapas. 9:30. Clyde Winters (Loyola U - Chicago) Olmec Symbolism in the Mayan Writing. 9:50. Nestor Quiroa (U Illinois ... www.aaanet.org/csas/mtg99/program/pfri.html - 47k - Cached - Similar pages
Saturday, April 17th ... 11:15. Samuel Cooper (Bar Ilan U) The Classification of Biblical Sacrifice. 11:35. Clyde Winters (Loyola U - Chicago) Harappan Origins of Yogi. 11:55. ... www.aaanet.org/csas/mtg99/program/psat.html - 50k - Cached - Similar pages preliminary program csas98
... Mexican Villages. 4:10 Clyde A. Winters (Uthman dan Fodio I) Jaguar Kings: Olmec Royalty and Religious Leaders in the First Person. 4:30 ... www.aaanet.org/csas/mtg98/Prelimp5.htm - 39k - Cached - Similar pages
Thursday April, 3 - Early Afternoon ... Russia [1413]. 2:30 pm - Clyde A. Winters (Uthman dan Fodio Institute) - The Decipherment of Olmec Writing [1414]. 2:50 pm - James ... www.aaanet.org/csas/mtg97/final.htm
.
Posted by Djehuti (Member # 6698) on :
^ No it doesn't and for the reasons already cited including from your own source!
'Race' implies genetic distinctions that correlate with phenotype such as skin color and facial features. However, genetics has shown this not to be the case.
Black Dravidians and Black Andamanese are no more related to black Africans that light skinned Chinese and Japanese. 'White Europeans' if they carry recent African lineages are on the other hand closely related to black Africans.
The groups in study labelled as 'African', 'European', and 'Asian' were done so based on geography. This does NOT imply racial divisions as not all Asians are 'racially' the same.
Race is purely a social construct with no basis on biology.
You still have not answered Rasol and Supe's fundamental questions pertaining to your notions, so therefore it is over. You lost so give it a rest Winters. Posted by lamin (Member # 5777) on :
To Djehuti:
I assume that one can discount with the term "race" since biologists don't use it in their analyses of biological species and sub-species.
On the basis of your argument then humans all belong to 1 species for which there no subgroupings.
If so, then shouldn't that mean that every person is equally related to every other person--as should be be evidenced by genetic research.
But we are told that some groups or humans are related to other groups but not related to other groups based on lineages and the notion of MRCA.
The question then is how do we parse or interpret all of this?
Problems are compounded in the case of humans because humans do not have natural habitats or sub-species modes of communication or even specific diets.
But the impact of the environment is evident for humans in that some phenotypical traits seem to have adaptive qualities as say in the case pigmentation.
So is there some biologic principle at work here in much the same way that such a principle works in nature as a whole.
I guess the situation is similar to that of an atheist or agnostic in a world where the majority of humans believe in a Deity and take it so seriously that they pattern their whole lives on their beliefs. The non-believer could hardly ever convince such persons of his/her own beliefs.
Similarly people who believe that races exist act very confidently on such--as the Police(with deadly force) and Immigration personnel(holding cells) in the West. If told that "race is social construct" such individuals would be puzzled but amused--while they slip on the handcuffs.
Posted by rasol (Member # 4592) on :
quote:Originally posted by lamin: To Djehuti:
On the basis of your argument then humans all belong to 1 species for which there no subgroupings.
To Lamin: Your question is slippery.
What is the conjunctive sub-grouping beneath species in biology if not sub-species?
Since you can't prove sub-species you change the term to sub-grouping.
Well a family is a 'group'.
A group can be defined in most any way, by most any standard.
But you can't reduce 'race' to any trivially designated group.
It's like claiming there are Martians, and then reducing the burden of evidence to "people who live in Australia."
The existence of Australians does not prove Martians.
The existence of 'group' does not prove race.
Posted by rasol (Member # 4592) on :
quote:If so, then shouldn't that mean that every person is equally related to every other person
Nope. The existence of families negates this - family isn't a race or sub-species.
What you are seeking is an escape from your burden of proof. It won't work.
Pretend that family demarcates race - and now every species on earth has millions of 'races'.
Race works the other way around: It is the specific and *falsified* claim regarding millions of individual humans placed in one assumptive breeding class.
Ideologically many people are addicted to these assumptions.
Winters has grounded much of his fallacious work on them: for example, the idea that Dravidians are a branch of the Mandingo.
And idea genetics has completely exploded.
That's why Winters hates genetics.
btw: Make no mistake that Winters know this.
He is akin to Evil Euro in this respect - waging a war against the terrible truth. His goal is simply to find a sucker who will believe him.
Volunteers?
Posted by rasol (Member # 4592) on :
quote:The question then is how do we parse or interpret all of this?
This reminds me of a comment I once read on another forum.
A discussant stated that if anthropologists couldn't tell us who belonged to which race - then anthropology was a waste of time.
Another discussant - obviously with their thinking cap on - noted that it is not only *not* the duty of a scientific discipline to affirm and a priori' ideology, but that even attempting to do so was the every essence of bad science.
Population geneticists study genetic traits within and between groups - or populations.
It is not the job of science to affirm 'race'.
Nor does interpretation of population genetics require race.
Race is more akin to superstition - it is what people use when they either do not have, or cannot comprehend a scientific answer.
Posted by Supercar (Member # 6477) on :
Picking up from where I left ...
quote:Clyde Winters:
I know exactly what he's talking about. Race exist as a scientific reality. You're the one questioning his statistics.
How can you claim to know what the man is talking about, when you can't even do the no-brainer thing of telling us what the man's definition is for "races". Does it conform to the unwavering 'objective' definition of biology, or does it take the shape of the variable, subjective and pseudo-scientific social constructs?
quote:Originally posted by Clyde Winters:
Supercar
quote: ^Clumsy smokescreen. What genetics or bio-anthropological papers have you presented at the AAA?
Friday, April 16th ... in Highland Chiapas. 9:30. Clyde Winters (Loyola U - Chicago) Olmec Symbolism in the Mayan Writing. 9:50. Nestor Quiroa (U Illinois ... www.aaanet.org/csas/mtg99/program/pfri.html - 47k - Cached - Similar pages
Saturday, April 17th ... 11:15. Samuel Cooper (Bar Ilan U) The Classification of Biblical Sacrifice. 11:35. Clyde Winters (Loyola U - Chicago) Harappan Origins of Yogi. 11:55. ... www.aaanet.org/csas/mtg99/program/psat.html - 50k - Cached - Similar pages preliminary program csas98
... Mexican Villages. 4:10 Clyde A. Winters (Uthman dan Fodio I) Jaguar Kings: Olmec Royalty and Religious Leaders in the First Person. 4:30 ... www.aaanet.org/csas/mtg98/Prelimp5.htm - 39k - Cached - Similar pages
Thursday April, 3 - Early Afternoon ... Russia [1413]. 2:30 pm - Clyde A. Winters (Uthman dan Fodio Institute) - The Decipherment of Olmec Writing [1414]. 2:50 pm - James ... www.aaanet.org/csas/mtg97/final.htm
Your mind must be out of this world; how do these qualify as 'molecular genetics' and bio-anthropology?
Posted by Clyde Winters (Member # 10129) on :
Supercar I have listed my presentations at AAA.
You make it appear that you are an expert on everything. It should be a no brainer for you present a list of some of your presentations, books and articles on genetics, bio-anthropology or anything related to anthropology.
.
Posted by Arwa (Member # 11172) on :
Dr. Clyde,
Until now, you present allel frquencies in different area--no dispute about that!
But do you dispute leading scienties, even chairmen of the National Human Genome Research Institute (NHGRI)?
quote: Current genetic data also refute the notion that races are genetically distinct human populations. There are no gene variants that are present in all individuals of one population group and in no individuals of another. No sharp genetic boundaries can be drawn between human population groups. However, frequencies of genetic variants and haplotypes differ across the world.
quote:The vast majority of common genetic variants present today existed in our common ancestral pool. This is not surprising, given the relative recency of the migration of humans out of Africa and the continuous exchange of DNA between populations. Trade, war, and exploration led to well-documented travel among peoples geographically distant from one another as far back as the Middle Ages, if not earlier (Smedley, 1999). However, because of evolutionary forces, such as genetic drift, founder effect, and selection, the frequencies of some genetic differences are not constant in all populations throughout the world.
In addition, because of our evolutionary past, variation itself is not spread evenly among population groups
NOTE!!!!!
quote:Still, researchers using new technologies have shown that DNA variation measured in humans from across the globe can be used to roughly categorize individuals into clusters based on the similarity of certain sections of their genetic code (Risch, Burchard, Ziv, & Tang, 2002; Rosenberg et al., 2002). Those categories—labeled by Risch and his colleagues as Africans, Caucasians, Pacific Islanders, East Asians, and Native Americans—loosely correspond to the social categories of race (Risch et al., 2002; Rosenberg et al., 2002). It should be noted, however, that these findings only result if one starts with individuals whose recent ancestors all derive from one geographic area—and of course that does not apply to an increasing proportion of individuals. It should also be noted that the number of “groups” is subject to the analysis of the data and the geographic areas of the world that are sampled. Human genetic variation is a continuum across the world (Serre & Pääbo, 2004).
And NOTE!!! AGAIN !!!!
quote:Race and ethnicity are complex sociopolitical constructs. They are variable and fluid, changing over time and differing throughout the world (see, e.g., Harris, Consorte, Lang, & Byrne, 1993; Jacobson, 1998; Snowden, 1983). How can researchers reconcile what may at first blush seem contradictory claims?
So when it comes to the relationship between self-identified race and the genetic contribution to the likelihood of developing a disease or a given trait, self-identified race is a surrogate for ancestral geographic origin, which is a surrogate for variation across the genome, which is a surrogate for variation in disease-relevant alleles, which is a surrogate for individual disease risk (Collins, 2004).
You question about the Hispanic woman is to broad of a category because this depends on the social construct of the observer and the participant (i.e Hispanic). The Hispanic label is a North American one placed on people who speak Spanish as a way to lump them all in a neat 'target'. The Hispanic may not want to be labelled as such but by default that is what it ends up to be, hence a category that one is forced to deal with!
Americans look at Hispanics and many cannot differentiate. Hispanics can be Indio (indigena/native american as in Aztec, Maya, Quechua, Carib, etc), African, European (Spaniard), but many are mestizo/mulato referencing origins, be it Cuba, PR, RD, now Mexico (since most recent are Indians-check out your gardner vs the TV version (telemundo/univision) of Hispanics. Again, some people are proud of their native origins and neglect the Hispanic image (the few) while the many adopt it to hide those same origins.
Posted by Arwa (Member # 11172) on :
I guess, no more talk about Tang, H. et al. Posted by Djehuti (Member # 6698) on :
^ We are waiting for valid answers, Clyde.
Though I doubt we'll get any except a repition of previously stated fallacies (which have already been corrected). Posted by Clyde Winters (Member # 10129) on :
Arwa you did not post the entire paper. The authors of the study you posted mentions that some scientist believe they are able to use genetic research to detect specific self-identified races.
quote:
Race and Ethnicity in the Genome Era: The Complexity of the Constructs Vence L. Bonham, Esther Warshauer-Baker, Francis S. Collins, from National Human Genome Research Institute, National Institutes of Health
American Psychologist, Vol. 60, No. 1, p 9-15 Still, researchers using new technologies have shown that DNA variation measured in humans from across the globe can be used to roughly categorize individuals into clusters based on the similarity of certain sections of their genetic code (Risch, Burchard, Ziv, & Tang, 2002; Rosenberg et al., 2002). Those categories—labeled by Risch and his colleagues as Africans, Caucasians, Pacific Islanders, East Asians, and Native Americans—loosely correspond to the social categories of race (Risch et al., 2002; Rosenberg et al., 2002).It should be noted, however, that these findings only result if one starts with individuals whose recent ancestors all derive from one geographic area—and of course that does not apply to an increasing proportion of individuals. It should also be noted that the number of “groups” is subject to the analysis of the data and the geographic areas of the world that are sampled. Human genetic variation is a continuum across the world (Serre & Pääbo, 2004). She continues
quote: At the present time, most of the specific gene variants involved in particular traits have not yet been discovered (Collins et al., 2003). However, researchers do have the tools with which to study variation across the entire genome in a set of individuals and to try to correlate that with health outcomes. Variation across the genome, in turn, can correlate with ancestral geographic origin, but this correlation is far from perfect. Ancestral geographic origins, in turn, correlate to some degree with self-identified race or ethnicity, but as noted earlier, this relationship is blurry and context dependent. So when it comes to the relationship between self-identified race and the genetic contribution to the likelihood of developing a disease or a given trait, self-identified race is a surrogate for ancestral geographic origin, which is a surrogate for variation across the genome, which is a surrogate for variation in disease-relevant alleles, which is a surrogate for individual disease risk (Collins, 2004).
This passage makes it clear that use of geographical terms to designate populations is just a continuation of grouping people into races.
It supports my contention that many scientist believe genetics can be used to determine race. It also illustrates why the journalists who wrote about the 13 institutes that determined genes can be correlated to individuals who self-identify their race were accurately reporting what the research means:
There are just under 30,000 genes in the human genome, which consists of about 3 billion "letters" of the DNA code. The scientists found that more than 10 per cent of these genes appear to be multiplied in the 270 people who took part in the study. They do not know why some genes are copied and some are not. One gene, called CCL3L1, which is copied many times in people of African descent, appears to confer resistance to HIV. Another gene involved in making a blood protein is copied many times in people from south-east Asia and seems to help against malaria. Other research has shown that variation in the number of copies of some genes is involved in Alzheimer's and Parkinson's disease.
Are there any other practical applications?
The scientists looked at people from three broad racial groups - African, Asian and European. Although there was an underlying similarity in terms of how common it was for genes to be copied, there were enough racial differences to assign every person bar one to their correct ethnic origin. This might help forensic scientists wishing to know more about the race of a suspect.
Who made the discovery and where can we read more about it?
Scientists from 13 research centres were involved, including Britain's Sanger Institute in Cambridge, which also took a lead role in deciphering the human genome. The research is published in Nature, Nature Genetics and Genome Research.
Posted by Arwa (Member # 11172) on :
Dr. Clyde,
You are either a lousy linguist or you just come here to play around.
And stop quoting that article. You have misused it to a certain point that it wants to get help at UNHCHR. Start to search a scientific article, where it claims to have found a gene in only one human group.
You quoted:
quote:Ancestral geographic origins, in turn, correlate to some degree with self-identified race or ethnicity, but as noted earlier, this relationship is blurry and context dependent.
blurrycontext dependent<<< any alarm bell ringing!!
Speaking of context, the segment you quoted is called:
The Series of Weak Correlations In this section the authors were summarizing the weak allegation on connections between genetic and race.
Now allow me to quote the whole segment:
quote:The Series of Weak Correlations
The real connections between genetic variation and self-identified race travel through several intermediate steps. It is true that variation in specific genes can increase the likelihood of developing certain diseases and/or human traits. These are not deterministic “DNA oracles,” however—the role of the environmentis extremely important for nearly all behaviors and common diseases, and gene-environment interactions are complex and dynamic. As a result, the presence of specific susceptibility genesis far from a perfect predictor of the true probability of experiencing a given illness or exhibiting a given trait.
At the present time, most of the specific gene variants involved in particular traits have not yet been discovered (Collins et al., 2003). However, researchers do have the tools with which to study variation across the entire genome in a set of individuals and to try to correlate that with health outcomes. Variation across the genome, in turn, can correlate with ancestral geographic origin, but this correlationis far from perfect. Ancestral geographic origins, in turn, correlate to some degree with self-identified race or ethnicity, but as noted earlier, this relationshipis blurry and context dependent. So when it comes to the relationship between self-identified race and the genetic contribution to the likelihood of developing a disease or a given trait, self-identified raceis a surrogate for ancestral geographic origin, which is a surrogate for variation across the genome, which is a surrogate for variation in disease-relevant alleles, which is a surrogate for individual disease risk ( Collins, 2004).
Now, it's your turn.
Posted by Djehuti (Member # 6698) on :
^His turn to what?... embarass himself again?
quote:rasol says: He [Winters] is akin to Evil Euro in this respect - waging a war against the terrible truth. His goal is simply to find a sucker who will believe him.
Volunteers?
Posted by Arwa (Member # 11172) on :
To all forum members. Does this segment support grouping people into races? http://tinyurl.com/sz9kt
quote:Still, researchers using new technologies have shown that DNA variation measured in humans from across the globe can be used to roughly categorize individuals into clusters based on the similarity of certain sections of their genetic code (Risch, Burchard, Ziv, & Tang, 2002; Rosenberg et al., 2002). Those categories—labeled by Risch and his colleagues as Africans, Caucasians, Pacific Islanders, East Asians, and Native Americans—loosely correspond to the social categories of race (Risch et al., 2002; Rosenberg et al., 2002). It should be noted, however, that these findings only result if one starts with individuals whose recent ancestors all derive from one geographic area—and of course that does not apply to an increasing proportion of individuals. It should also be noted that the number of “groups” is subject to the analysis of the data and the geographic areas of the world that are sampled. Human genetic variation is a continuum across the world (Serre & Pääbo, 2004).
Race and ethnicity are complex sociopolitical constructs. They are variable and fluid, changing over time and differing throughout the world (see, e.g., Harris, Consorte, Lang, & Byrne, 1993; Jacobson, 1998; Snowden, 1983). How can researchers reconcile what may at first blush seem contradictory claims?
Posted by Djehuti (Member # 6698) on :
^ Arwa, there is no reason to address all members of the forum since all members (save a few) are not only able to read but comprehend what is read from all the scientific citations.
A shame there are just a few who would rather take mere snippets of it to distort to what they believe and not what it actually says. Posted by Supercar (Member # 6477) on :
quote:Originally posted by Clyde Winters:
Supercar I have listed my presentations at AAA.
Which have what to do with molecular genetics and bio-anthropology?
quote:Clyde Winters:
You make it appear that you are an expert on everything. It should be a no brainer for you present a list of some of your presentations, books and articles on genetics, bio-anthropology or anything related to anthropology.
Gibberish.
This is a forum open to anyone who registers. I reserve the right to fully express my observations on any matter brought up; it is not some fascistic outlet whereby my views necessarily have to concord with yours. Anyone can come here and disprove anything I put forth, whether it be a scholar, professional or layman. Those who choose to remain silent while they have something to prove, well then, that is their choice. One can either speak up or forever maintain his/her silence. If you feel that my observations reflect sophisticated thinking, it is because that is how they are projected to you. I choose to not remain silent on matters on which I consider your observations flawed. I hereby demonstrate this, by showing that when the very immaterial questions you pose on others are then imposed on yourself, you are incapable of answering; e.g.
What molecular geneticsANDbio-anthropological papers have you presented at the AAA?
^Clyde's response to the very sort of questions he asks others to deliver on > No answer!
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Arwa:
To all forum members. Does this segment support grouping people into races? http://tinyurl.com/sz9kt
quote:Still, researchers using new technologies have shown that DNA variation measured in humans from across the globe can be used to roughly categorize individuals into clusters based on the similarity of certain sections of their genetic code (Risch, Burchard, Ziv, & Tang, 2002; Rosenberg et al., 2002). Those categories—labeled by Risch and his colleagues as Africans, Caucasians, Pacific Islanders, East Asians, and Native Americans—loosely correspond to the social categories of race (Risch et al., 2002; Rosenberg et al., 2002). It should be noted, however, that these findings only result if one starts with individuals whose recent ancestors all derive from one geographic area—and of course that does not apply to an increasing proportion of individuals. It should also be noted that the number of “groups” is subject to the analysis of the data and the geographic areas of the world that are sampled. Human genetic variation is a continuum across the world (Serre & Pääbo, 2004).
Race and ethnicity are complex sociopolitical constructs. They are variable and fluid, changing over time and differing throughout the world (see, e.g., Harris, Consorte, Lang, & Byrne, 1993; Jacobson, 1998; Snowden, 1983). How can researchers reconcile what may at first blush seem contradictory claims?
Of course, none other than the likes of Clyde would mistake this for some sort of a twisted vindication of human 'races'. 'Clusters' are dependent on specific variables under consideration, and as mentioned, dependent on the background of Samples, in terms of population bio-history, sample size and geographical areas combed for sampling, which do not necessarily concord with the "social constructs" of 'race' or 'ethnicity' in one or more regions sampled. As an example, Y chromosome sampling from Greece has shown that there are Greeks who would relatively cluster close to sub-Saharan East and North Africans, than Europeans in the sampling from some region in the northern portions of Europe. Does this mean that Greeks necessarily socially view themselves as the same 'race' as these Africans they 'cluster' with, or vice versa? Likely not; nonetheless genetics would show that they cluster. That is the reality of biology, transcending social constructs. Posted by Clyde Winters (Member # 10129) on :
Arwa
quote:
Dr. Clyde,
You are either a lousy linguist or you just come here to play around.
And stop quoting that article. You have misused it to a certain point that it wants to get help at UNHCHR. Start to search a scientific article, where it claims to have found a gene in only one human group.
You quoted:
quote: -------------------------------------------------------------------------------- Ancestral geographic origins, in turn, correlate to some degree with self-identified race or ethnicity, but as noted earlier, this relationship is blurry and context dependent. --------------------------------------------------------------------------------
blurry context dependent<<< any alarm bell ringing!!
Speaking of context, the segment you quoted is called:
The Series of Weak Correlations In this section the authors were summarizing the weak allegation on connections between genetic and race.
You are the person who can't read. If one vists the article they will see I cited the entire paragraph. It doesn't matter if the person writing the article does not agree with the concept of race in science the authors( who are psychologists and not biologist) clearly says:
quote:
Race and Ethnicity in the Genome Era: The Complexity of the Constructs Vence L. Bonham, Esther Warshauer-Baker, Francis S. Collins, from National Human Genome Research Institute, National Institutes of Health
American Psychologist, Vol. 60, No. 1, p 9-15 Still, researchers using new technologies have shown that DNA variation measured in humans from across the globe can be used to roughly categorize individuals into clusters based on the similarity of certain sections of their genetic code (Risch, Burchard, Ziv, & Tang, 2002; Rosenberg et al., 2002). Those categories—labeled by Risch and his colleagues as Africans, Caucasians, Pacific Islanders, East Asians, and Native Americans—loosely correspond to the social categories of race (Risch et al., 2002; Rosenberg et al., 2002).It should be noted, however, that these findings only result if one starts with individuals whose recent ancestors all derive from one geographic area—and of course that does not apply to an increasing proportion of individuals. It should also be noted that the number of “groups” is subject to the analysis of the data and the geographic areas of the world that are sampled. Human genetic variation is a continuum across the world (Serre & Pääbo, 2004).
The authors continues quote: --------------------------------------------------------------------------------
At the present time, most of the specific gene variants involved in particular traits have not yet been discovered (Collins et al., 2003). However, researchers do have the tools with which to study variation across the entire genome in a set of individuals and to try to correlate that with health outcomes. Variation across the genome, in turn, can correlate with ancestral geographic origin, but this correlation is far from perfect. Ancestral geographic origins, in turn, correlate to some degree with self-identified race or ethnicity, but as noted earlier, this relationship is blurry and context dependent. So when it comes to the relationship between self-identified race and the genetic contribution to the likelihood of developing a disease or a given trait, self-identified race is a surrogate for ancestral geographic origin, which is a surrogate for variation across the genome, which is a surrogate for variation in disease-relevant alleles, which is a surrogate for individual disease risk (Collins, 2004).
You show your ignorance of discourse and linguistics. Just because the authors say something is "blurry " and the says "context dependent" is not saying that grouping people into geographical populations is dissimilar to grouping people into races. Use of the term "context dependent" indicates that in specific context race correlates with the double speak "geographical populations".
In otherwords, the authors of this article make it clear that race=geographical population.
You are reading into these papers what you want to read. They al recognize that scientists recognize that races exist, and use genes to correlate self-reported racial identity . This paper only confirms the findings of Tang et al.
Posted by Clyde Winters (Member # 10129) on :
Supercar
quote: If you feel that my observations reflect sophisticated thinking, it is because that is how they are projected to you.
I don't think they reflect sophisticated thinking they are the rantings of a bully. This is clearly indicatd by your frequent attacks on anyone that disagrees with you.
.
Posted by Supercar (Member # 6477) on :
quote:Originally posted by Clyde Winters:
Supercar I don't think they reflect sophisticated thinking they are the rantings of a bully. This is clearly indicatd by your frequent attacks on anyone that disagrees with you.
Then why do you think I make myself "appear to be an expert on everything", if that isn't the impression you got from my postings. I never claimed to be 'anything', and you don't know me. It is you, who went off-topic, by getting to my personal affairs, and now that you have been given a dose of your own bitter medicine, you whine like a helpless child, otherwise, we would have already had an answer to my last question. Matter of fact, I think that this very post reflects a whiner, not an adult, much less one capable of the slightest sophisticated thinking. You are a sore loser.
Posted by Arwa (Member # 11172) on :
quote:Originally posted by Clyde Winters:
You are the person who can't read. If one vists the article they will see I cited the entire paragraph. It doesn't matter if the person writing the article does not agree with the concept of race in science the authors( who are psychologists and not biologist) clearly says:
Wrong!!
They are invited guest writers from National Human Genome Research Institute, National Institutes of Health http://tinyurl.com/sz9kt Try again
Posted by Arwa (Member # 11172) on :
quote: You are reading into these papers what you want to read.
I quoted the policy of Nature paper. I quoted the leaders of National Human Genome Research Institute.
and I'm selective reader? Posted by Clyde Winters (Member # 10129) on :
Arwa
quote:
I quoted the policy of Nature paper. I quoted the leaders of National Human Genome Research Institute.
and I'm selective reader?
The author of this paper was V.J. Bonham, who is a lawyer, not geneticist.
Vence L Bonham, J.D. Career Mr. Bonham completed his J.D. at Ohio State Unviersity. His research interests include health policy and services; race, socioeconomic status, and health services; race ethnicity, and genomics; and interdisciplinary medical and legal education. Mr. Bonham is a reviewer for the Agency and Healthcare and Research Quality, a consultant for the Michigan Law Review Commission, and a consultant for the Secretary of the U.S. Health and Human Services Advisory Committee on Genetic Testing. Contact Information Tower B B212 Clinical Ctr East Lansing, MI 48824-1313 (517) 355-4488
Contact via Email
The face that Mr. Bonham works for this magazine makes it clear that when he claims that geographic origin is the same as race he knows what he's talking about.
quote:
At the present time, most of the specific gene variants involved in particular traits have not yet been discovered (Collins et al., 2003). However, researchers do have the tools with which to study variation across the entire genome in a set of individuals and to try to correlate that with health outcomes. Variation across the genome, in turn, can correlate with ancestral geographic origin, but this correlation is far from perfect. Ancestral geographic origins, in turn, correlate to some degree with self-identified race or ethnicity, but as noted earlier, this relationship is blurry and context dependent. So when it comes to the relationship between self-identified race and the genetic contribution to the likelihood of developing a disease or a given trait, self-identified race is a surrogate for ancestral geographic origin, which is a surrogate for variation across the genome, which is a surrogate for variation in disease-relevant alleles, which is a surrogate for individual disease risk (Collins, 2004).
Posted by rasol (Member # 4592) on :
quote:Originally posted by Arwa: Wrong!!
They are invited guest writers from National Human Genome Research Institute, National Institutes of Health http://tinyurl.com/sz9kt Try again
lol.
RIP Winters 'evidence' of race.
Let move on to the real issue of why he so desparately need to believe in this essentially European invented, and white supremacist ideology (?)
There is a smallish group of older African American intellectuals, mentally dominated by white supremacists, and desparately trying to fight them on their own terms - and so, being very unimaginative about it.
Thus the attempt to counter - k-zoid history, with n-groid history.
This is ideological reaction posing as radical.
Reactionaries 'react' to and agenda driven by others.
Radicals completely redefine the rules of the game - forcing others to....react.
Diop was a radical -> in his day. Quoting him and substitute for knowledge of modern science is a reactionary form of discourse.
Someone like SOY Keita - a radical for today.
Keita has been a scholar of tremendous importance and devastating impact on Eurocentrism, because he exposes the internal contradictions of Eurocentric pseudoscience that Winters still exposes and so cannot hope to effectively counter.
Dr. Winters should read SOY Keita.
There are other ways of thinking about human variation than on the terms of Carelton Coon, George Gil, and David Duke,
Nordicist, Medicentrist and Negrocentrist(?) all hate each other because they sling the same..er, excrement. Posted by Arwa (Member # 11172) on :
Clyde,
There are three authors, and one of them is Bonham , but why did you left out Francis S. Collins?
From the editors of American Psychologist
quote: Bonham, Warshauer-Baker, and Collins (2005, this issue) provide the first article for this special issue. The authors have leadership roles at the National Human Genome Research Institute (NHGRI) at the National Institutes of Health—one of them (Francis S. Collins) is director of NHGRI—so they are particularly qualified to provide an overview of the advances in genome science.The NHGRI played a lead role in the Human Genome Project. This article provides a glimpse into the future of genomics research and some perspectives on the definitions of race as seen from the field of genomics. Bonham et al. also provide an introduction to some of the ethical, legal, and social implications (ELSI) related to genomic research. ELSI is a field in which psychologists are especially poised to make contributions.
Accept your defeat!
Posted by Clyde Winters (Member # 10129) on :
Arwa
How am I defeated. These men specifically said that:
quote:
At the present time, most of the specific gene variants involved in particular traits have not yet been discovered (Collins et al., 2003). However, researchers do have the tools with which to study variation across the entire genome in a set of individuals and to try to correlate that with health outcomes. Variation across the genome, in turn, can correlate with ancestral geographic origin, but this correlation is far from perfect. Ancestral geographic origins, in turn, correlate to some degree with self-identified race or ethnicity, but as noted earlier, this relationship is blurry and context dependent. So when it comes to the relationship between self-identified race and the genetic contribution to the likelihood of developing a disease or a given trait, self-identified race is a surrogate for ancestral geographic origin, which is a surrogate for variation across the genome, which is a surrogate for variation in disease-relevant alleles, which is a surrogate for individual disease risk (Collins, 2004).
It's in Black and White, ancestral geographic origin is the same as race.
Posted by rasol (Member # 4592) on :
^ How does any of what you quoted help you?
This is just like when you quote linguists who disagree with your theories, and pretend that they agree?
The question is - since virtually everyone you correspond with can detect the conflict between your assertions and your miscited sources, how do you manage to delude yourself to the contrary?
Posted by Arwa (Member # 11172) on :
If it's in black and white, then definitly, flying pigs exist
ok if "ancestral geographic origin is the same as race" how come we humans are competent to exchange genes with other 'race'?
and to all, I have a question. Do I need to quote the whole segment?
Posted by Arwa (Member # 11172) on :
I have to go, NOW!
Posted by rasol (Member # 4592) on :
Ancestral geographic origins, in turn, correlate to some degree with self-identified race or ethnicity, but as noted earlier, this relationship is blurry and context dependent.
According to Winters the above paragraph translates to = Geographic origin is the same thing as race.
This is why your scholarship is suspect. You ignore the *context* of what your miscited sources are saying in order to delude yourself that your position is supported.
The above paragraph is making a distinction between self identified race -> which is really *ethnicity* [not biological race], and geographic origin, and in turn stating that the relationship can correlate depending on context.
Since you are determined to delude yourself via willfully poor reading comprehension, let us break down the distinct concepts mentioned:
Nothing stated with regards to 2 - 6 affirm position 1.
Posted by Clyde Winters (Member # 10129) on :
Arwa
quote:
ok if "ancestral geographic origin is the same as race" how come we humans are competent to exchange genes with other 'race'?
Some humans enjoy having sex with multiple partners from different races of course.
.
Posted by Clyde Winters (Member # 10129) on :
Arwa
quote:
and to all, I have a question. Do I need to quote the whole segment?
No the learned authors make it clear that race and geographic origin is the same in the quote I have been publishing.
quote: At the present time, most of the specific gene variants involved in particular traits have not yet been discovered (Collins et al., 2003). However, researchers do have the tools with which to study variation across the entire genome in a set of individuals and to try to correlate that with health outcomes. Variation across the genome, in turn, can correlate with ancestral geographic origin, but this correlation is far from perfect. Ancestral geographic origins, in turn, correlate to some degree with self-identified race or ethnicity, but as noted earlier, this relationship is blurry and context dependent. So when it comes to the relationship between self-identified race and the genetic contribution to the likelihood of developing a disease or a given trait, self-identified race is a surrogate for ancestral geographic origin, which is a surrogate for variation across the genome, which is a surrogate for variation in disease-relevant alleles, which is a surrogate for individual disease risk (Collins, 2004).
Please learn how to read. Surrogate=substitute.
Translation of above phrase: "race is a substitution for ancestral geographic origin".
.
Posted by rasol (Member # 4592) on :
^ According to Winters - a 'surrogate' mother is essentially the same as a biological mother.
And you wonder why your linguistic works are not taken seriously?
No translation, just a quote from your source.... Ancestral geographic origins, in turn, correlate to some degree with self-identified race or ethnicity
In these studies Hispanics are a self identified race or ethnicity, and can be modeled as a population in population genetics - yet geneticist do not claim that Hispanics are a biological race or sub-species. Such a claim would be ridiculous since Hispanics may 'originate' *by definition* in Latin America, but in fact have a patch quilt of pre-hispanic lineages relating them to population from all over the world.
Keep pretending to not understand the difference between and ethnic group, socially defined, and a sub-species or race as determined by biology.
Pretending to not understand is not effective as a form of debate.
It means your either disingenuous....or really slow.
Choose one.
Posted by rasol (Member # 4592) on :
Dr Winters vs. his cited sources.
Dr. Francis Collins.....
As those ancestral origins in many cases have a correlation, albeit often imprecise, with self-identified race or ethnicity, it is not strictly true that race or ethnicity has no biological connection. It must be emphasized, however, that the connection is generally quite blurry because of multiple other nongenetic connotations of race, the lack of defined boundaries between populations and the fact that many individuals have ancestors from multiple regions of the world.
Considered in this context, it is apparent why self-identified race or ethnicity might be correlated with health status, through genetic or nongenetic surrogate relationships or a combination of the two. It is also evident that a true understanding of disease risk requires us to go well beyond these weak and imperfect proxy relationships.
Winters translates a weak and imperfect proxy relationship as meaning..... one and the same.
You must be pleased. Posted by What Box (Member # 10819) on :
indeed, clyde, indeed.
Posted by Djehuti (Member # 6698) on :
quote:Originally posted by rasol: lol.
RIP Winters 'evidence' of race.
Let move on to the real issue of why he so desparately need to believe in this essentially European invented, and white supremacist ideology (?)
There is a smallish group of older African American intellectuals, mentally dominated by white supremacists, and desparately trying to fight them on their own terms - and so, being very unimaginative about it.
Thus the attempt to counter - k-zoid history, with n-groid history.
This is ideological reaction posing as radical.
Reactionaries 'react' to and agenda driven by others.
Radicals completely redefine the rules of the game - forcing others to....react.
Diop was a radical -> in his day. Quoting him and substitute for knowledge of modern science is a reactionary form of discourse.
Someone like SOY Keita - a radical for today.
Keita has been a scholar of tremendous importance and devastating impact on Eurocentrism, because he exposes the internal contradictions of Eurocentric pseudoscience that Winters still exposes and so cannot hope to effectively counter.
Dr. Winters should read SOY Keita.
There are other ways of thinking about human variation than on the terms of Carelton Coon, George Gil, and David Duke,
Nordicist, Medicentrist and Negrocentrist(?) all hate each other because they sling the same..er, excrement.
quote:Ancestral geographic origins, in turn, correlate to some degree with self-identified race or ethnicity, but as noted earlier, this relationship is blurry and context dependent. According to Winters the above paragraph translates to = Geographic origin is the same thing as race.
This is why your scholarship is suspect. You ignore the *context* of what your miscited sources are saying in order to delude yourself that your position is supported.
The above paragraph is making a distinction between self identified race -> which is really *ethnicity* [not biological race], and geographic origin, and in turn stating that the relationship can correlate depending on context.
Since you are determined to delude yourself via willfully poor reading comprehension, let us break down the distinct concepts mentioned:
Nothing stated with regards to 2 - 6 affirm position 1.
quote:Dr Winters vs. his cited sources.
Dr. Francis Collins.....
As those ancestral origins in many cases have a correlation, albeit often imprecise, with self-identified race or ethnicity, it is not strictly true that race or ethnicity has no biological connection. It must be emphasized, however, that the connection is generally quite blurry because of multiple other nongenetic connotations of race, the lack of defined boundaries between populations and the fact that many individuals have ancestors from multiple regions of the world.
Considered in this context, it is apparent why self-identified race or ethnicity might be correlated with health status, through genetic or nongenetic surrogate relationships or a combination of the two. It is also evident that a true understanding of disease risk requires us to go well beyond these weak and imperfect proxy relationships.
Winters translates a weak and imperfect proxy relationship as meaning..... one and the same.
Checkmate, Winters!
Posted by Clyde Winters (Member # 10129) on :
Dr. Francis Collins.....
quote: Is race biologically meaningless? First, it is essential to point out that 'race' and 'ethnicity' are terms without generally agreed-upon definitions. Both terms carry complex connotations that reflect culture, history, socioeconomics and political status, as well as a variably important connection to ancestral geographic origins. Well-intentioned statements over the past few years, some coming from geneticists, might lead one to believe there is no connection whatsoever between self-identified race or ethnicity and the frequency of particular genetic variants1, 2. Increasing scientific evidence, however, indicates that genetic variation can be used to make a reasonably accurate prediction of geographic origins of an individual, at least if that individual's grandparents all came from the same part of the world3.
Note that in this paragraph Dr. Collins use race and geographical origin as synonymous and is related to genetic variations. This view is supported by later statements in the same paragraph.
quote: As those ancestral origins in many cases have a correlation, albeit often imprecise, with self-identified race or ethnicity, it is not strictly true that race or ethnicity has no biological connection. It must be emphasized, however, that the connection is generally quite blurry because of multiple other nongenetic connotations of race, the lack of defined boundaries between populations and the fact that many individuals have ancestors from multiple regions of the world.
This quote does not contradict the reality of race in biology. Because they note that " As those ancestral origins in many cases have a correlation, albeit often imprecise, with self-identified race or ethnicity, it is not strictly true that race or ethnicity has no biological connection.".
It does not matter if the connection is "blurry" this professional biologists is maintains that :" it is not strictly true that race or ethnicity has no biological connection.
It is obvious that you guys can not read, or read into textual material what you want to read.
This doctor like Tang et al, and the researchers at the 13 research institutes mentioned earlier in this thread recognize a biological connection between race and biology.
.
Posted by Arwa (Member # 11172) on :
Mr. Clyde, Please note, the people on this forum can read, and you don't need to be brainy to understand what you have quoted:
quote:Francis S Collins:
Is race biologically meaningless?
First, it is essential to point out that 'race' and 'ethnicity' are terms without generally agreed-upon definitions. Both terms carry complex connotations that reflect culture, history, socioeconomics and political status, as well as a variably important connection to ancestral geographic origins. Well-intentioned statements over the past few years, some coming from geneticists, might lead one to believe there is no connection whatsoever between self-identified race or ethnicity and the frequency of particular genetic variants. Increasing scientific evidence, however, indicates that genetic variation can be used to make a reasonably accurate prediction of geographic origins of an individual, at least if that individual's grandparents all came from the same part of the world3. As those ancestral origins in many cases have a correlation, albeit often imprecise, with self-identified race or ethnicity, it is not strictly true that race or ethnicity has no biological connection. It must be emphasized, however, that the connection is generally quite blurry because of multiple other nongenetic connotations of race, the lack of defined boundaries between populations and the fact that many individuals have ancestors from multiple regions of the world.
If I were you, I would not quote that segment, because it shatters all your belief on race in biology.
Why does the author emphasis the importance of "geographic origins"? Because it is there where you take your samples to analyze (frequencies of genes). There is no indication that any allele frequencies can distinguish the geographic origins. A good example is ABO blood group allelic frequencies.
Posted by Arwa (Member # 11172) on :
I must admit, I have learned alot on this thread. T. Duster is right, when he said:
"In a parallel fashion, most of those engaged in the search for the genetic basis of criminality are now scrupulously avoiding the issue of race. But this is only because of the current hypersensitivity of the connection in the public domain, termed “politically incorrect” in the now prevailing political winds. That will change as the war on drugs, declining welfare support, a down-sized labor force in the secondary sector of the economy, and the skyrocketing growth of prisons converge. People of color will dominate the population of those incarcerated in state and federal prisons even more than they do now. Just as the attack on welfare and affirmative action were simmering issues in private boardrooms and private golf clubs for decades before the full-scale political attack moved to the public domain, so too the next decade will witness an outburst of behavioral genetics research, buttressed by the molecular reinscription of race tying crime to biological processes, and then correlating those biological processes to race. It is not beyond conjecture that it will be an African-American who will lead the charge, fully supported by the Pioneer Fund or some equivalent wellfunded, conservative think tank or funding source."
I guess, you don't need to be white to believe the superiority of the white "race". This is a big lesson for me personally, and I must thank Dr. Clyde Winters for that.
Posted by rasol (Member # 4592) on :
quote:It does not matter if the connection is "blurry"
Of course it matters to science, where confirmation of theory is based on clear definitions, and clear cause and effect connections.
Unclear relationships, per se, prove little precisely because they are unclear or "blurry", this is Collins point.
*You* are claiming clear support of a specific theory, and trying to use Collins as a source, which is mis-citation at best, and a lie, at worst.
The contradiction between your claims and your sources does not matter *to you* because you are not a scienticist.
You are and erstatz propagandist whose primary agenda is what *you admit is your racial ideology*, which you must/need assert regardless of lack of support/evidence.
About which Collins says....
the use of such concepts is *misleading or counterproductive.*
quote:Checkmate Winters
Winters was checkmated several pages ago. His discourse on race typology and African Dravidians has gone nowhere in nearly a year.
Posted by Arwa (Member # 11172) on :
Clyde, I must ask. Are you trying to show the superiority of the black "race"? Yes or no?
Posted by rasol (Member # 4592) on :
quote:Originally posted by Arwa: If I were you, I would not quote that segment, because it shatters all your belief on race in biology.
Winters pattern is to ignore 95% of what is said in order to distort the rest.
This is why he typically quotes out of context and provides no links, so attempting to hide what he his sources are actually saying.
This qualifies as propaganda, not science, and i'm glad ES discussants can see this.
Posted by Clyde Winters (Member # 10129) on :
Arwa
quote:
Clyde, I must ask. Are you trying to show the superiority of the black "race"? Yes or no? --------------------------------------------------------------------------------
No. My research is aimed at making it clear that the Ancient Model of civilization popularized by the Classical Writers and the Bible, that the ancient civilizations were founded by Blacks (a race) is correct.
Arwa
quote:
Why does the author emphasis the importance of "geographic origins"? Because it is there where you take your samples to analyze (frequencies of genes). There is no indication that any allele frequencies can distinguish the geographic origins. A good example is ABO blood group allelic frequencies.
[quote]
The point is not the author's emphasis on allele frequencies. Let's examine the statement of Collins: [quote]
Is race biologically meaningless? First, it is essential to point out that 'race' and 'ethnicity' are terms without generally agreed-upon definitions. Both terms carry complex connotations that reflect culture, history, socioeconomics and political status, as well as a variably important connection to ancestral geographic origins. Well-intentioned statements over the past few years, some coming from geneticists, might lead one to believe there is no connection whatsoever between self-identified race or ethnicity and the frequency of particular genetic variants1, 2. Increasing scientific evidence, however, indicates that genetic variation can be used to make a reasonably accurate prediction of geographic origins of an individual, at least if that individual's grandparents all came from the same part of the world3.
The point of the matter is that the author clearly indicates :
1. The term race does not have an agreed upon definition;
2." Well-intentioned statements over the past few years, some coming from geneticists, might lead one to believe there is no connection whatsoever between self-identified race or ethnicity and the frequency of particular genetic variants1."
3. " Increasing scientific evidence, however, indicates that genetic variation can be used to make a reasonably accurate prediction of geographic origins of an individual, at least if that individual's grandparents all came from the same part of the world3. "
This last statement makes it clear that some "well intentioned researchers may "lead one to believe there is no connection between self-identified race" and "frequency of a particular genetic variants", this is false because race correlates with geographic origins of one's parents.
Collins
quote:
As those ancestral origins in many cases have a correlation, albeit often imprecise, with self-identified race or ethnicity, it is not strictly true that race or ethnicity has no biological connection. It must be emphasized, however, that the connection is generally quite blurry because of multiple other nongenetic connotations of race, the lack of defined boundaries between populations and the fact that many individuals have ancestors from multiple regions of the world.
Here he makes it clear that
1. There is an imprecise correlation between self-identified race and ancestral geographical origin;
2. " it is not strictly true that race or ethnicity has no biological connection "; and
3." connection is generally quite blurry because of multiple other nongenetic connotations of race, the lack of defined boundaries between populations and the fact that many individuals have ancestors from multiple regions of the world. "
It is clear from Dr. Collins own words that race exist as a biological phenomena eventhough there is a lack of defined bondaries between populations and that ancestral geographical origins often correlate with the self-identified race of an individual.
I repeat Dr. Collins, Tang et al, and the researchers at 13 genetic research institutions around the world make it clear that race can be determined by genes. Stop trying to be politically correct by spreading this myth that many scientists correlate self-identified race to genes. The writings of even the people you use to support this myth prove you wrong.
Collins makes it clear that some " Well-intentioned statements over the past few years, some coming from geneticists, might lead one to believe there is no connection whatsoever between self-identified race or ethnicity and the frequency of particular genetic variants1." " , the facts prove otherwise. Given this reality you are fabricating a lie in this forum that some scientists don't believe self-identified race correlates with genes and the geographical origin of the individual possessing these genes.
Shame on You! Posted by Lord of the Nile (Member # 10305) on :
^^ Rasol
Do you get paid for posting your intellectually stunted garabage on this site? I have caught you arguing on both sides of the fence. When you wake up from the wrong side of the bed race exists for you and when you wake up from the other side it ceases to exist.
You are one boring, lieing and fake mal-adjusted cretin, who oozes malice and viciousness like some spoilt fruit. You have no argument. Just some ill-digested, poorly understood patches of information. A little learning can create great dangers for the mind.
Go get some day job! Or go back to college like your little puppy Deadhuti!
The Lord of the Nile
Posted by Clyde Winters (Member # 10129) on :
^^^ Agreed.
.
Posted by rasol (Member # 4592) on :
quote:Originally posted by Lord of the Nile: Rasol
Do you get paid for posting your intellectually stunted garabage on this site?
^ You mean for posting links to the actual studies that Winters mis-cites and lies about?
You mean, for exposing Winters as a weak propagandist, and enraging both you and him in the process?
No, I don't get paid for it.
It's free, and you're welcome.
quote: I have caught you arguing on both sides of the fence.
Really? Then prove it. Quote me and demonstrate -whatever- it is you're trying to say.
If you can't, the it means you've caught yourself not being intelligent enough to understand anything. Or, put it this way...
It means you just *exposed yourself* as being completely unable to intelligently argue *any point*, at all.
quote:When you wake up from the wrong side of the bed race exists for you and when you wake up from the other side it ceases to exist.
If this were true, you would provide specific quotes from me, making the claimed contradictory statements. But you quote nothing. Why is that?
quote: You are one boring, lieing and fake mal-adjusted cretin, who oozes malice and viciousness like some spoilt fruit.
Personal attacks just make me laugh. Especially coming from someone who doesn't even attempt to address the issue or provide evidence.
It's really and admission that you have a low opinion of your own intellect, and can only try to play the class clown and disrupt discussions with cheap insults.
quote:You have no argument.
Sure I do. It comes directly from biologists. You simply can't address it, which is why you prefer insults.
Here I'll give you another chance....
"Race" has little meaning biologically, certainly not genetically. - Geneticist Spencer Wells.
"Populations should be viewed processually as dynamic entities over time and not "static" entities. The prescence of M35/215 lineages and the Benin sickle cell variant in southern Europe illustrates this well." - Shomarka Keita
Classification into race has proven a futile excercise - C Sforza.
Skin color is of little use in determining phylo-genetic relationships - N. Jablonsky.
quote:Just some ill-digested, poorly understood patches of information.
translation: you don't understand, you feel stupid, so you rant and blame others.
quote:A little learning can create great dangers for the mind.
translation: ignorance is bliss.
quote:Go get some day job! Or go back to college like your little puppy Deadhuti!
Go get a book, any book and read it. Then you won't have such and obvious sense of intellectual inferiority resulting in a completely mindless hate rant, that manages to not address a single relevant point.
quote:Clyde Winters writes: I agree
I know you do. But agreeing with personal attacks while failing to answer questions or address evidence, amounts to admission of debate bankruptcy.
You've failed again Winters, so let your bitter venting flow, won't help you. Posted by What Box (Member # 10819) on :
quote:^^ Rasol
Do you get paid for posting your intellectually stunted garabage on this site? I have caught you arguing on both sides of the fence. When you wake up from the wrong side of the bed race exists for you and when you wake up from the other side it ceases to exist.
You do not know what your talking about! You probably haven't a clue.
quote:You are one boring, lieing and fake mal-adjusted cretin, who oozes malice and viciousness like some spoilt fruit.
Oh please. I saw how ferocious you were in another forum. And there're others like you. If rasol was lax or not presenting himself in an intelligent manner, you would be on him for that.
quote:You have no argument. Just some ill-digested, poorly understood patches of information.
On what basis do you make those on? what? cause you said so?
quote:A little learning can create great dangers for the mind.
Translation: A little learning can create great dangers for a certain status quo I hang on to and MY BIG DUMN A$$! (sorry if i'm not as comical as rasol can be)
quote:Go get some day job! Or go back to college like your little puppy Deadhuti!
One of the many Lords of Malignance
Trans: Plz!, Plz! don't hurt me! Posted by rasol (Member # 4592) on :
quote:My research is aimed at making it clear that the Ancient Model of civilization popularized by the Classical Writers and the Bible, that the ancient civilizations were founded by Blacks (a race) is correct.
If this is true, you should be able to prove this very easily, and right now...
You claim that West African Mandingo and South Indian Dravidans are the same race.
1) Please provide the name of a geneticist who agrees with this claim.
2) Please provide a source genetic study that claims that Dravidians and Mandingo belong to a specific claimed biological race.
My contention is that you will never answer this question: because you are a liar who knowingly makes false claims.
The challenge is clear and specific. Your move....
Posted by rasol (Member # 4592) on :
quote:Winters writes: He makes clear that there is an imprecise correlation between self-identified race and ancestral geographical origin.
Sorry Doctor, but a person who "self identifies as racially Hispanic", and thus allows impercise collelations to their geographic origin which may be ->
* possibly partly Native American,
* and or possible partly African,
* and or possibly partly Southern European,
* and or possibly partly something else....
...does not constitute proof that Hispanic is a race. Nor does any biologist claim otherwise. Indeed the very fact that self identified Hispanic, can be successfully modeled as a population in spite of it's provable heterogeniety is proof that such a concept does not equal biological race.
Everyone in this thread, *including you* understands this.
The redundancy exists only because you are ideologically committed to lying about it.
You keep lying, we'll keep exposing you.
We can do this for as long as you like, and your thread will get nowhere. Either that, or start answering our questions. It's up to you. Posted by rasol (Member # 4592) on :
What's taking so long?
quote:rasol writes: Dr. Winters, if this is true, you should be able to prove this very easily, and right now...
You claim that West African Mandingo and South Indian Dravidans are the same race.
1) Please provide the name of a geneticist who agrees with this claim.
2) Please provide a source genetic study that claims that Dravidians and Mandingo belong to a specific claimed biological race.
My contention is that you will never answer this question: because you are a liar who knowingly makes false claims.
The challenge is clear and specific. Your move....
Posted by Arwa (Member # 11172) on :
Dr. Clyde,
I very doubt you will ever going to use Francis S Collins' article as reference to public or any events, and you will lose your credibility if you quote him out of context, which you did on this thread.
Posted by Arwa (Member # 11172) on :
quote:Stop trying to be politically correct
I'm not trying to be PC. First, my faith tells me there is only one human race. Second, if race exists in science, then we would know the gene that codes the race gene.
Posted by Arwa (Member # 11172) on :
quote:Originally posted by rasol: Winters pattern is to ignore 95% of what is said in order to distort the rest.
This is why he typically quotes out of context and provides no links, so attempting to hide what he his sources are actually saying.
This qualifies as propaganda, not science, and i'm glad ES discussants can see this.
The code word is propaganda Posted by lamin (Member # 5777) on :
I find all this confusing. If, as is claimed, "Biological races do not exist" and "Race is a social construct"--then what is there to prevent anyone, for whatever reason, from claiming that "such and such a people constitute a [socially constructed]race. Or anyone could imaginatively combine 2 regionally disparate groups and claim "people A and people B" seem to be related on X, Y, Z grounds so I proclaim them to be a [socially constructed] race.
In the U.S. that is indeed the case when "Hispanics" or "Asians" or "Pacific Islanders", "Caucasians--to include North Africans and West Asians" are proclaimed to be "races" but implicitly in a "socially constructive" way.
Even the logic of the classifications is faulty: U.S. sociologists speak of "Hispanics" but not "Hispanic Americans", "Asians" but not "Asian Americans" yet they use "African American" but not just "African".
What is the explanatory ideological subtext when "races" are socially constructed then imposed on society as a whole?
Posted by rasol (Member # 4592) on :
quote:Originally posted by lamin: I find all this confusing.
I think people are reluctant to let go of ideological baggage.
This is what results in confusion.
quote: If, as is claimed, "Biological races do not exist
and "Race is a social construct"--then what is there to prevent anyone, for whatever reason, from claiming that "such and such a people constitute a [socially constructed]race.
Nothing can prevent anyone from making any claim, other than curtailment of free speech.
You can claim to be from the planet Mars, for instance.
I can choose to believe you. At this point we have a social construct.
A scientist may establish that there is no proof that any human comes from Mars.
At this point the social construct of Martian is scientifically invalid.
quote: Or anyone could imaginatively combine 2 regionally disparate groups and claim "people A and people B" seem to be related on X, Y, Z grounds so I proclaim them to be a [socially constructed] race.
That is exactly what self identified races are.
Hispanics are a perfect example.
The very fact that they can be clustered for -against- "non Hispanics" actually disproves race typology.
Race typology should either confirm that a Hispanic clusters only with other Hispanics, or obversely show that they are a hybrid mixture which can only be clustered in terms of 'other real races.'
But....there are no 'real races'.
Virtually all people have overlapping and variable lineages - usually from multiple parts of the world.
Moreover as this has always been so...there never have been any 'real races.'
quote: In the U.S. that is indeed the case when "Hispanics" or "Asians" or "Pacific Islanders", "Caucasians--to include North Africans and West Asians" are proclaimed to be "races" but implicitly in a "socially constructive" way.
Even the logic of the classifications is faulty: U.S. sociologists speak of "Hispanics" but not "Hispanic Americans", "Asians" but not "Asian Americans" yet they use "African American" but not just "African".
What is the explanatory ideological subtext when "races" are socially constructed then imposed on society as a whole?[
Dr's Keita and Kettles make a profound point:
The social construct that is race, draws its power from its natural science root.
It is the assertion of race as scientific truth that forces sheep-minded acceptance of the social construct.
Liken to 'scientific socialism'.
Scientific socialism and race [scientific racism?], are in fact both non scientific social constructs.
When a non-scientific idea draws it's power from belief that it *is* scientific - you have defined, pseudoscience.
Posted by Djehuti (Member # 6698) on :
Clyde Winters and Lord of Despair...
..
hard by Rasol!
I suggest you both of you save what is left of dignity and admit error or leave quietly. Preferably both. Posted by Arwa (Member # 11172) on :
I went back to first page on this thread, and you will notice how Dr. Clyde mixes the article from Nature and an article from mainstream media. Very amateur, Dr. Clyde.
Posted by Clyde Winters (Member # 10129) on :
Arwa
quote:
I went back to first page on this thread, and you will notice how Dr. Clyde mixes the article from Nature and an article from mainstream media. Very amateur, Dr. Clyde. --------------------------------------------------------------------------------
Not really. Dr. Collins has made it clear that 1)many well intention people maintain the myth that genes do not correlate with self-identified race and 2) that genes, and self-identified race coorrespond to geographic ancestral origin.
It was clear that the researchers at the 13 research institutes were talking about race in their article. The newspaper article about the research confirmed that these researchers were talking about race(s). Use of the article and citation from the journal was a masterful illustration of the fantasy world you guys live in--a world in which you claim race does not exist--but where scientist hearald their correlation of race and genes.
There are just under 30,000 genes in the human genome, which consists of about 3 billion "letters" of the DNA code. The scientists found that more than 10 per cent of these genes appear to be multiplied in the 270 people who took part in the study. They do not know why some genes are copied and some are not. One gene, called CCL3L1, which is copied many times in people of African descent, appears to confer resistance to HIV. Another gene involved in making a blood protein is copied many times in people from south-east Asia and seems to help against malaria. Other research has shown that variation in the number of copies of some genes is involved in Alzheimer's and Parkinson's disease.
Are there any other practical applications?
The scientists looked at people from three broad racial groups - African, Asian and European. Although there was an underlying similarity in terms of how common it was for genes to be copied, there were enough racial differences to assign every person bar one to their correct ethnic origin. This might help forensic scientists wishing to know more about the race of a suspect.
Who made the discovery and where can we read more about it?
Scientists from 13 research centres were involved, including Britain's Sanger Institute in Cambridge, which also took a lead role in deciphering the human genome. The research is published in Nature, Nature Genetics and Genome Research.
Posted by X-Ras (Member # 10328) on :
quote:Originally posted by Clyde Winters:
It was clear that the researchers at the 13 research institutes were talking about race in their article. The newspaper article about the research confirmed that these researchers were talking about race(s). Use of the article and citation from the journal was a masterful illustration of the fantasy world you guys live in--a world in which you claim race does not exist--but where scientist hearald their correlation of race and genes.
This is false, you still haven't pointed out where the study itself says race exist. I read the entire study from front to back and there's no evidence that supports your claim.
Posted by Clyde Winters (Member # 10129) on :
Arwa and X-RAS you live in a "Black/ Middle Class" fantasy in which race does not exist. Although this is your fantasy you can not transfer this feeling to the real world or win this argument because you have encased your views into a box which maintains that biologists do not believe genes can determine race.
Arwa, you have presented work by Duster, Bonham and Collins. A cursory reading of these articles pointed out that scientist have been able to correlate self-identified race to specific genes and races. Collins admitted what we all know to be true that self-identified race usually corresponds to geographical ancestry.
You can not win this argument because my claim is that some scientists believe race has a biological signature. You, on the otherhand claim that NO scientist believe in race. No way you can confirm this idea, because there is always two sides to every concept.
.
Posted by Arwa (Member # 11172) on :
It's not funny anymore to debate with you , Dr. Clyde Winters
Clyde, ^I got the chance read your last post,after I posted .
You wrote:
quote:You, on the otherhand claim that NO scientist believe in race. No way you can confirm this idea, because there is always two sides to every concept.
I never said, scienties don't believe in race, and if you go to first page, I wrote:
quote:You'll find racists in every milieu
And that includes scienties. BTW, why do misquote people? That is very offensive!
You wrote:
quote:My research is aimed at making it clear that the Ancient Model of civilization popularized by the Classical Writers and the Bible, that the ancient civilizations were founded by Blacks [ ]is correct
Well guess what, Doctor. I'm fighting for my people not to get exterminated. Why do you think the western world are funding these researches?
Posted by rasol (Member # 4592) on :
Times up Winters......
quote:Originally posted by rasol: What's taking so long?
quote:rasol writes: Dr. Winters, if this is true, you should be able to prove this very easily, and right now...
You claim that West African Mandingo and South Indian Dravidans are the same race.
1) Please provide the name of a geneticist who agrees with this claim.
2) Please provide a source genetic study that claims that Dravidians and Mandingo belong to a specific claimed biological race.
My contention is that you will never answer this question: because you are a liar who knowingly makes false claims.
The challenge is clear and specific. Your move....
quote: Arwa [] you live in a "Black/ Middle Class" fantasy
quote:But alas, this would be too "manly" and you might feel jeopardize your job or standing with your non-Black/African friends.
quote: But like most cowardly Negroes, you attack another Afro-American, instead of standing up like a man and voicing your concern in the media. Shame on you.
Posted by Arwa (Member # 11172) on :
Have a nice day Dr. Winters. It has been a pleasure to know you. I'll not be around here on this forum in next few months.
TaTa! Posted by Djehuti (Member # 6698) on :
^LMAO Arwa, excellent job in seeking the truth and utilizing that in a nice sound debate. we will miss you for you have made great contributions to this forum.
Posted by Arwa (Member # 11172) on :
Djehuti, thanks for the kind words, Posted by Clyde Winters (Member # 10129) on :
![[Big Grin]](biggrin.gif)
This might help forensic scientists wishing to know more about the race of a suspect. 
![[Cool]](cool.gif)
![[Eek!]](eek.gif)
![[Frown]](frown.gif)
![[Embarrassed]](redface.gif)
You of course failed to answer any of Rasol's questions because you cannot. Biological 'race' does not exist plain and simple!
![[Wink]](wink.gif)
indeed, clyde, ![[Roll Eyes]](rolleyes.gif)
![[Smile]](smile.gif)
..
