...
Post A Reply
my profile
|
directory
login
|
register
|
search
|
faq
|
forum home
»
EgyptSearch Forums
»
Egyptology
»
O.T. Races Exist: Global variation in copy number in the human genome
» Post A Reply
Post A Reply
Login Name:
Password:
Message Icon:
Message:
HTML is not enabled.
UBB Code™ is enabled.
[QUOTE]Originally posted by Clyde Winters: [QB] Gill has already made it clear that about half the scientists believe race exist and the other half belive race does not exist. The biology literature is full of reference to race. Race From Wikipedia, the free encyclopedia Jump to: navigation, search This article may benefit form being shortened by the use of summary style. Summary style moves large sections to sub-articles that are summarized in the main article. For other uses, see Race (disambiguation). The term race distinguishes a population of humans (or non-humans) from other populations. The most widely used human racial categories are based on visible traits (especially skin color and facial features), genes, and self-identification. Conceptions of race, as well as specific racial groupings, vary by culture and over time and are often controversial, for scientific reasons as well as their impact on social identity and identity politics. Legal definitions, common usage, and scientific meaning can all be conflated, causing confusion and controversy. Webster's Dictionary defines race as "a group of people of common ancestry or stock". Descent is defined as 'derivation from an ancestor'. The term Caucasian race or Caucasian is used to refer to people whose ancestry can be traced back to Europe, North Africa, West Asia, South Asia and parts of Central Asia. It was once considered a useful taxonomical categorization of human racial groups based on a presumed common geographic and/or linguistic origin. Below are science articles where race is discussed. This makes it clear that race is part of the science discourse. [QUOTE] Forensic value of the multicopy Y-STR marker DYS464 John M. Butler * , Richard Schoske 1 Biotechnology Division, National Institute of Standards and Technology, Gaithersburg, MD, USA Abstract. The tetranucleotide Y-chromosome short tandem repeat (Y-STR) marker, DYS464, first reported by Redd et al. [Forensic Sci. Int. 130 (2002) 97] appears to be the most polymorphic Y-STR marker discovered to date. A single primer pair can generate up to four distinct peaks over an allele range of 9–20 repeats. Allele calls can be made based on peaks that are present (conservative approach; C-type) or a combination of alleles and peak height ratios (expanded typing method; E- type). We have observed 113 C-types and 179 E-types in 679 males from three US populations. D 2003 Elsevier B.V. All rights reserved. Keywords: Y-STR; Y-chromosome; DYS464; Multicopy loci; DNA typing 1. Introduction DYS464 occurs at least four times in the highly palindromic region near the center of the long arm of the Y-chromosome [1–3]. In forensic casework applications where the amount of typable DNA material may be limited, the use of highly polymorphic markers is advantageous in order to limit the number of markers needed to distinguish unrelated individuals. Page 2 The primers VIC-CTTTGGGCTATGCCTCAGTTT and GCCATACCTGGGTAACAGA- GAGAC produce green-labeled amplicons in the size range of 242–286 bp for DYS464 alleles 9–20, while the primers 6FAM-AGTTTACGAGCTTTGGGCTATG and GTGGCAAGATCTCATTTCTTCAA generate blue dye-labeled polymerase chain reac- tion (PCR) products that are 327–367 bp in size. PCR conditions are as previously described for the Y-STR 20plex [5]. An allelic ladder was created for DYS464 (Fig. 1), which contains all of the major alleles as well as single-base variants observed in our population study [3]. 3. Results and discussion[b] We observed 179 expanded types with DYS464 in 679 male samples from three different US population sets: 265 African–Americans, 262 Caucasians, and 152 His- panics. [/b] Race is a key element in biological research. Biological researchers constantly use the term caucasian in reference to individuals and human populations. Lets look at the definitions of this term: Caucasian "A caucasoid person". Caucasoid: " of the major divisions of the human species whose members characteristically have skin color ranging from very light to brown...." These definitions make it clear that use of this term implies discussion of race or the caucasoid human species. This term is frequently used in reference to the caucasoid species in numerous biological studies. Use of this term makes it clear race exist. Below are examples from different biological research papers. http://www.centrelink.org/KearnsDNA.html Indigenous Puerto Rico: DNA evidence upsets established history By Rick Kearns Reprinted with permission, from Indian Country Today Posted: October 06, 2003 - 1:34pm EST by: Rick Kearns / Correspondent / Indian Country Today History is written by the conquerors. The Native peoples of North America know this all too well, as they are still trying to bring the truth to light. Now, their long-lost Caribbean cousins are beginning the same process. It’s an uphill battle. Most Puerto Ricans know, or think they know, their ethnic and racial history: a blending of Taino (Indian), Spanish and African. Students of the islands’ past have read the same account for over 300 years; that the Native people, and their societies, were killed off by the Spanish invaders by the 1600s. It was always noted though, how many of the original colonists married Taino women or had Taino concubines, producing the original mestizaje (mixture) that, when blended with African, would produce Puerto Ricans. Those first unions, according to the conventional wisdom, explain why some Puerto Ricans have "a little bit" of Native heritage. Mainly we are Spanish, we are told, with a little African blood and far-away Taino ancestry. But the order of that sequence will have to change. Dr. Juan Martinez Cruzado, a geneticist from the University of Puerto Rico Mayaguez who designed an island-wide DNA survey, has just released the final numbers and analysis of the project, and these results tell a different story. [b] According to the study funded by the U.S. National Science Foundation, 61 percent of all Puerto Ricans have Amerindian mitochondrial DNA, 27 percent have African and 12 percent Caucasian. (Nuclear DNA, or the genetic material present in a gene’s nucleus, is inherited in equal parts from one’s father and mother.[/b] Mitochondrial DNA is inherited only from one’s mother and does not change or blend with other materials over time.) http://www.biomedcentral.com/1471-2350/6/30 High frequency of the IVS2-2A>G DNA sequence variation in SLC26A5, encoding the cochlear motor protein prestin, precludes its involvement in hereditary hearing loss Hsiao-Yuan Tang1 , Anping Xia1 , John S Oghalai1 , Fred A Pereira1, 2 and Raye L Alford1 Background Cochlear outer hair cells change their length in response to variations in membrane potential. This capability, called electromotility, is believed to enable the sensitivity and frequency selectivity of the mammalian cochlea. Prestin is a transmembrane protein required for electromotility. Homozygous prestin knockout mice are profoundly hearing impaired. In humans, a single nucleotide change in SLC26A5, encoding prestin, has been reported in association with hearing loss. This DNA sequence variation, IVS2-2A>G, occurs in the exon 3 splice acceptor site and is expected to abolish splicing of exon 3. Methods To further explore the relationship between hearing loss and the IVS2-2A>G transition, and assess allele frequency, genomic DNA from hearing impaired and control subjects was analyzed by DNA sequencing. SLC26A5 genomic DNA sequences from human, chimp, rat, mouse, zebrafish and fruit fly were aligned and compared for evolutionary conservation of the exon 3 splice acceptor site. Alternative splice acceptor sites within intron 2 of human SLC26A5 were sought using a splice site prediction program from the Berkeley Drosophila Genome Project. Results[b] The IVS2-2A>G variant was found in a heterozygous state in 4 of 74 hearing impaired subjects of Hispanic, Caucasian or uncertain ethnicity and 4 of 150 Hispanic or Caucasian controls (p = 0.45). The IVS2-2A>G variant was not found in 106 subjects of Asian or African American descent. [/b]No homozygous subjects were identified (n = 330). Sequence alignment of SLC26A5 orthologs demonstrated that the A nucleotide at position IVS2-2 is invariant among several eukaryotic species. Sequence analysis also revealed five potential alternative splice acceptor sites in intron 2 of human SLC26A5. http://www.ecacc.org.uk/default.asp?Reload=detail2.asp?itemid=92970 ECACC Releases all 5 Human Random Control (HRC) DNA (480 HRC individual DNAs) in Convenient 96 Well Panels Building on the success of the ECACC Human Random Control (HRC) DNA in genetics research (see selected publications list) ECACC has responded to customer demand and re-formatted all 480 HRC DNA samples into a more convenient 96 well format. This new development has been made possible by ECACC’s investment, during 2005, in automated liquid handling technologies. This development along with more efficient work practises has had the added benefit of substantially reducing the price of obtaining the whole 480 HRC DNA resources, bringing it within the scope of individual consumable budgets. The HRC DNA consists of authenticated, high quality purified human genomic DNA.[b] Each of the available 480 samples is from a single individual, providing a control population of randomly selected, non-related UK Caucasian blood donors. [/b]The HRC DNA is available as a series of five panels each containing samples from 96 separate individuals in a convenient 8 x 12 well format. This is a readily available, cost effective and renewable source of standardised control DNA samples for use in a range of applications that include: • Population studies • Mutation analysis • SNP genotyping • Validation of technology • Assay development and validation • Association analysis • Comparative genomic hybridisation • Genomic DNA library construction http://www.funpecrp.com.br/gmr/year2002/vol2-1/gmr0004_full_text.htm Frequency of the hypervariable DNA loci D18S849, D3S1744, D12S1090 and D1S80 in a mixed ancestry population of Chilean blood donors M. Acuña1, H. Jorquera2, L. Cifuentes1 and L. Armanet3 1ICBM Genetic Program and 2Medical Technology School, Facultad de Medicina, Universidad de Chile, Casilla 70061, Santiago 7, Chile 3Forensic Medical Service, Santiago, Chile Corresponding author: M. Acuña E-mail: macuna@machi.med.uchile.cl Genet. Mol. Res. 1 (2): 139-146 (2002) Received April 11, 2002 Published June 27, 2002 Comparisons of D1S80 allele distribution between populations (Figure 2) using the ² test showed no significant differences between the Chilean population sample when compared with Southwestern US Hispanics and US Hispanics pooled (Zago et al., 1996; Huckenbeck et al., 1997).[b] The research presented in this paper shows that the hypervariable DNA loci investigated are distinguishable from other Caucasian (Spanish), Black and Oriental populations, but that the D3S1744 locus is indistinguishable from the Caucasian population. All the loci studied are indistinguishable from USA Hispanic populations (Figures 2 and 3). [/b]This study provides the first database for DNA markers in low and middle socioeconomic strata in a Chilean population. The results presented indicate that the analysis of these loci may have useful applications in population genetics as well as in identity tests. . [/QB][/QUOTE]
Instant Graemlins
Instant UBB Code™
What is UBB Code™?
Options
Disable Graemlins in this post.
*** Click here to review this topic. ***
Contact Us
|
EgyptSearch!
(c) 2015 EgyptSearch.com
Powered by UBB.classic™ 6.7.3