posted
An important extract from the article I posted yesterday:
quote: With the hindsight provided by a full century, we can see with great clarity how the professions of law and medicine, and the science that influences them, are all enshrouded in the dominant assumptions of the era. Slavery and Reconstruction were both influenced and “explained” by evolutionary theory – from the ways in which scientists studied the shape and size of human skulls to justify slavery and racial stratification,to the medical diagnosis of the pathological conditions that would impel a slave to try to run away from her or his master. The legally upheld criminal-surety agreement and Dred Scott are now characterized as obviously flawed legal theory, but the cog-like fit of these legal views with the science of the period is explicable by the theoretical warrant provided by “the spirit of the times” – the Zeitgeist. We can clearly see how Dr. Cartwright could get away with medicalizing escape and thus medicalizing “deviance.” Yet we fail to see how our own medicalization of escape from boredom in the classroom by youngsters from certain class backgrounds (brought up on channel-flipping, cascading flip-frame video imagery) reflects the current Zeitgeist. This will undoubtedly bemuse historians who, 150 years hence – in the middle of the 22nd century – may re-analyze why the nation was so ready to deploy Ritalin to deal with a runaway diagnosis of ADHD.
In a parallel fashion, most of those engaged in the search for the genetic basis of criminality are now scrupulously avoiding the issue of race. But this is only because of the current hypersensitivity of the connection in the public domain, termed “politically incorrect” in the now prevailing political winds. That will change as the war on drugs, declining welfare support, a down-sized labor force in the secondary sector of the economy, and the skyrocketing growth of prisons converge. People of color will dominate the population of those incarcerated in state and federal prisons even more than they do now. Just as the attack on welfare and affirmative action were simmering issues in private boardrooms and private golf clubs for decades before the full-scale political attack moved to the public domain, so too the next decade will witness an outburst of behavioral genetics research, buttressed by the molecular reinscription of race tying crime to biological processes, and then correlating those biological processes to race. It is not beyond conjecture that it will be an African-American who will lead the charge, fully supported by the Pioneer Fund or some equivalent wellfunded, conservative think tank or funding source. The banner will be the academic and intellectual freedom to fearlessly pursue a topic wherever it may lead. Most people will fail to recognize that such work will be driven by the prevailing winds, the Zeitgeist. Those winds will be perceived as natural and normal. “The spirit of the times” will be taken for granted.
Will that be you, Dr. Clyde Winthers?
Posts: 2198 | Registered: Jun 2006
| IP: Logged |
quote:Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic)
Nope. Nowhere does Tang claim Hispanics are a race. The very fact that a group that includes Mexicans, Dominicans and Puerto Ricans, with their vastly different ancestries, can nontheless be labeled and clustered in a genetic study illustrates the *distinction* between population clustering and 'race'.
Sorry Winters, you've produced no evidence, addressed none of the cited scholars, and failed to answer everyone's questions.
That about sums up this thread, wouldn't you say?
Posts: 15202 | Registered: Jun 2004
| IP: Logged |
quote:Originally posted by Calypso: Dr. Winters how does this help you? Other than the dubious use of the word "caucasian" the highlighted passage above says that a group of people, who we know may look very similar, continue to carry the mtdna of their maternal ancestry - from different parts of the world. This seriously undermines your position regarding race.
lol. He just doesn't get it. Winters is demonstrating that advocacy of race depends upon a lack of comprehension of modern science.
Posts: 15202 | Registered: Jun 2004
| IP: Logged |
posted
I can't read either because I don't find the word race anywhere in the supplied materials.
The first one mentions * a national population - Caucasian (Spanish) * a color - Black (presumably Africans not Fijians) * a regional population - Orientals * socio-economic class - low & middle class mestije Hispanics * population genetics (not racial studies)
The second one mentions * racial/ethnic groups, but as unscientifically defined self-identifiers * genetic clusters Genetic cluster analysis matched self-identified racial/ethnic classification. This is the closest but no cigar. Race and ethnicity are two distinct social concepts. Birth certificates in New York state for instance have separate slots for entry of both race and ethnicity.
Somewhere in the unsearchable archive is more commentary on Tang et al from the last go round this forum had the validity of the social construct of race viability in population genetics.
quote:Originally posted by Clyde Winters: Arwa Can't you read
quote:
• Genomic DNA library construction http://www.funpecrp.com.br/gmr/year2002/vol2-1/gmr0004_full_text.htm Frequency of the hypervariable DNA loci D18S849, D3S1744, D12S1090 and D1S80 in a mixed ancestry population of Chilean blood donors M. Acuña1, H. Jorquera2, L. Cifuentes1 and L. Armanet3 1ICBM Genetic Program and 2Medical Technology School, Facultad de Medicina, Universidad de Chile, Casilla 70061, Santiago 7, Chile 3Forensic Medical Service, Santiago, Chile Corresponding author: M. Acuña E-mail: macuna@machi.med.uchile.cl Genet. Mol. Res. 1 (2): 139-146 (2002) Received April 11, 2002 Published June 27, 2002
Comparisons of D1S80 allele distribution between populations (Figure 2) using the ² test showed no significant differences between the Chilean population sample when compared with Southwestern US Hispanics and US Hispanics pooled (Zago et al., 1996; Huckenbeck et al., 1997). The research presented in this paper shows that the hypervariable DNA loci investigated are distinguishable from other Caucasian (Spanish), Black and Oriental populations, but that the D3S1744 locus is indistinguishable from the Caucasian population. All the loci studied are indistinguishable from USA Hispanic populations (Figures 2 and 3). This study provides the first database for DNA markers in low and middle socioeconomic strata in a Chilean population. The results presented indicate that the analysis of these loci may have useful applications in population genetics as well as in identity tests.
Tang et al:
quote: Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic) and were recruited from 15 different geographic locales within the United States and Taiwan. Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories. Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity.
Posts: 8014 | From: the Tekrur in the Western Sahel | Registered: Feb 2006
| IP: Logged |
quote: -------------------------------------------------------------------------------- Dr. Winters highlighted this portion of study cited: quote: -------------------------------------------------------------------------------- That is to say, despite the intensive mestizaje (genetic “mixture”) that has characterized our region over the centuries, we Caribbeans have mtDNAs that have maintained their original identity and that can be identified as African, Indian, or Caucasian . Their identity depends upon the women in our genetic tree at the end of the strictly maternal ancestral line. If this great-great-great grandmother were indigenous, then the corresponding Caribbean would have an indigenous mtDNA. He or she would have inherited it intact from that great-great-great grandmother who lived through those terrible first years of the colonization by means of his or her great-great grandmothers, great grandmothers, and maternal grandmother. --------------------------------------------------------------------------------
Dr. Winters how does this help you? Other than the dubious use of the word "caucasian" the highlighted passage above says that a group of people, who we know may look very similar, continue to carry the mtdna of their maternal ancestry - from different parts of the world. This seriously undermines your position regarding race.
This helps support my position because some of these people are identified as caucasian, which identifies a race. It shows that races can be identified biologically and that these people were disguishd by their race andt geographical ancestry.
.
-------------------- C. A. Winters Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
quote: -------------------------------------------------------------------------------- With the hindsight provided by a full century, we can see with great clarity how the professions of law and medicine, and the science that influences them, are all enshrouded in the dominant assumptions of the era. Slavery and Reconstruction were both influenced and “explained” by evolutionary theory – from the ways in which scientists studied the shape and size of human skulls to justify slavery and racial stratification,to the medical diagnosis of the pathological conditions that would impel a slave to try to run away from her or his master. The legally upheld criminal-surety agreement and Dred Scott are now characterized as obviously flawed legal theory, but the cog-like fit of these legal views with the science of the period is explicable by the theoretical warrant provided by “the spirit of the times” – the Zeitgeist. We can clearly see how Dr. Cartwright could get away with medicalizing escape and thus medicalizing “deviance.” Yet we fail to see how our own medicalization of escape from boredom in the classroom by youngsters from certain class backgrounds (brought up on channel-flipping, cascading flip-frame video imagery) reflects the current Zeitgeist. This will undoubtedly bemuse historians who, 150 years hence – in the middle of the 22nd century – may re-analyze why the nation was so ready to deploy Ritalin to deal with a runaway diagnosis of ADHD.
In a parallel fashion, most of those engaged in the search for the genetic basis of criminality are now scrupulously avoiding the issue of race. But this is only because of the current hypersensitivity of the connection in the public domain, termed “politically incorrect” in the now prevailing political winds. That will change as the war on drugs, declining welfare support, a down-sized labor force in the secondary sector of the economy, and the skyrocketing growth of prisons converge. People of color will dominate the population of those incarcerated in state and federal prisons even more than they do now. Just as the attack on welfare and affirmative action were simmering issues in private boardrooms and private golf clubs for decades before the full-scale political attack moved to the public domain, so too the next decade will witness an outburst of behavioral genetics research, buttressed by the molecular reinscription of race tying crime to biological processes, and then correlating those biological processes to race. It is not beyond conjecture that it will be an African-American who will lead the charge, fully supported by the Pioneer Fund or some equivalent wellfunded, conservative think tank or funding source. The banner will be the academic and intellectual freedom to fearlessly pursue a topic wherever it may lead. Most people will fail to recognize that such work will be driven by the prevailing winds, the Zeitgeist. Those winds will be perceived as natural and normal. “The spirit of the times” will be taken for granted. --------------------------------------------------------------------------------
Will that be you, Dr. Clyde Winthers?
Not I.
-------------------- C. A. Winters Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
quote: quote: -------------------------------------------------------------------------------- Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic) --------------------------------------------------------------------------------
Nope. Nowhere does Tang claim Hispanics are a race. The very fact that a group that includes Mexicans, Dominicans and Puerto Ricans, with their vastly different ancestries, can nontheless be labeled and clustered in a genetic study illustrates the *distinction* between population clustering and 'race'.
You can't read he says that the subjects of his study were divided into race/ethnicity. This makes it clear that he was talking about the race of the people in the study.
Tang H, Quertermous T, Rodriguez B, Kardia SL, Zhu X, Brown A, Pankow JS, Province MA, Hunt SC, Boerwinkle E, Schork NJ, Risch NJ.
Division of Public Health Sciences, Fred Hutchinson Cancer Research Center, Seattle, WA, USA.
We have analyzed genetic data for 326 microsatellite markers that were typed uniformly in a large multiethnic population-based sample of individuals as part of a study of the genetics of hypertension (Family Blood Pressure Program). Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic) and were recruited from 15 different geographic locales within the United States and Taiwan. Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories. Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity. On the other hand, we detected only modest genetic differentiation between different current geographic locales within each race/ethnicity group. Thus, ancient geographic ancestry, which is highly correlated with self-identified race/ethnicity--as opposed to current residence--is the major determinant of genetic structure in the U.S. population. Implications of this genetic structure for case-control association studies are discussed.
This finding by Tang et al make it clear that genetic research can support the racial self identification of individuals. Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
quote:Originally posted by Lord of the Nile: Deadhuti
What is your genetic classification? I asked because as I was walking down the street today I met two E3B guy one from the Philipines and the other from Algeria who were ranting about how some phenotypically black individuals were planning to undermine the genetic integrity of the R1a and R1b categories....
What a dumbo...the E3B guys.
Tehehe
quote:rasol responds: ^ You are not funny, just stupid.
Now go away.
LMAO Of course. Apparently 'Lord of denial' does not even know that E3b is not indigenous to the Philippines. Regardless, the only "dumbo" was him for telling that ridiculous lie.
Moving on..
Posts: 26243 | From: Atlanta, Georgia, USA | Registered: Feb 2005
| IP: Logged |
posted
Clyde, you are waging a war that has been lost a long time ago.
Everyone who has addressed you in this thread have already shown to you how your source contradicts your claims and proves them wrong.
THERE ARE NO GENES THAT CORRELATE TO RACIAL TYPOLOGY.
Why? BECAUSE RACIAL CLASSIFICATIONS ARE ARBITRARILY SUBJECTIVE.
Phenotype does NOT correlate to lineage. 'Negroid' Andamanese are no more African than Japanese. 'Negroid' Dravidians are no more African than Chinese or Eastern Europeans.
Case closed.
Posts: 26243 | From: Atlanta, Georgia, USA | Registered: Feb 2005
| IP: Logged |
Clyde, you are waging a war that has been lost a long time ago.
Everyone who has addressed you in this thread have already shown to you how your source contradicts your claims and proves them wrong.
THERE ARE NO GENES THAT CORRELATE TO RACIAL TYPOLOGY.
Why? BECAUSE RACIAL CLASSIFICATIONS ARE ARBITRARILY SUBJECTIVE.
Phenotype does NOT correlate to lineage. 'Negroid' Andamanese are no more African than Japanese. 'Negroid' Dravidians are no more African than Chinese or Eastern Europeans.
Case closed.
If the case is closed why do all these scientist continue to confirm that race has a biological signiture.
Race is a key element in biological research. Biological researchers constantly use the term caucasian in reference to individuals and human populations. Lets look at the definitions of this term: Caucasian "A caucasoid person". Caucasoid: " of the major divisions of the human species whose members characteristically have skin color ranging from very light to brown...."
These definitions make it clear that use of this term implies discussion of race or the caucasoid human species. This term is frequently used in reference to the caucasoid species in numerous biological studies. Use of this term makes it clear race exist. Below are examples from different biological research papers.
Webster's Dictionary defines race as "a group of people of common ancestry or stock". Descent is defined as 'derivation from an ancestor'.
The term Caucasian race or Caucasian is used to refer to people whose ancestry can be traced back to Europe, North Africa, West Asia, South Asia and parts of Central Asia. It was once considered a useful taxonomical categorization of human racial groups based on a presumed common geographic and/or linguistic origin. Below are science articles where race is discussed. This makes it clear that race is part of the science discourse.
[QUOTE]
Forensic value of the multicopy Y-STR marker DYS464
John M. Butler * , Richard Schoske 1 Biotechnology Division, National Institute of Standards and Technology, Gaithersburg, MD, USA Abstract. The tetranucleotide Y-chromosome short tandem repeat (Y-STR) marker, DYS464, first reported by Redd et al. [Forensic Sci. Int. 130 (2002) 97] appears to be the most polymorphic Y-STR marker discovered to date. A single primer pair can generate up to four distinct peaks over an allele range of 9–20 repeats. Allele calls can be made based on peaks that are present (conservative approach; C-type) or a combination of alleles and peak height ratios (expanded typing method; E- type). We have observed 113 C-types and 179 E-types in 679 males from three US populations. D 2003 Elsevier B.V. All rights reserved. Keywords: Y-STR; Y-chromosome; DYS464; Multicopy loci; DNA typing 1. Introduction DYS464 occurs at least four times in the highly palindromic region near the center of the long arm of the Y-chromosome [1–3]. In forensic casework applications where the amount of typable DNA material may be limited, the use of highly polymorphic markers is advantageous in order to limit the number of markers needed to distinguish unrelated individuals. Page 2 The primers VIC-CTTTGGGCTATGCCTCAGTTT and GCCATACCTGGGTAACAGA- GAGAC produce green-labeled amplicons in the size range of 242–286 bp for DYS464 alleles 9–20, while the primers 6FAM-AGTTTACGAGCTTTGGGCTATG and GTGGCAAGATCTCATTTCTTCAA generate blue dye-labeled polymerase chain reac- tion (PCR) products that are 327–367 bp in size. PCR conditions are as previously described for the Y-STR 20plex [5]. An allelic ladder was created for DYS464 (Fig. 1), which contains all of the major alleles as well as single-base variants observed in our population study [3]. 3. Results and discussion We observed 179 expanded types with DYS464 in 679 male samples from three different US population sets: 265 African–Americans, 262 Caucasians, and 152 His- panics.
Race is a key element in biological research. Biological researchers constantly use the term caucasian in reference to individuals and human populations. Lets look at the definitions of this term: Caucasian "A caucasoid person". Caucasoid: " of the major divisions of the human species whose members characteristically have skin color ranging from very light to brown...."
These definitions make it clear that use of this term implies discussion of race or the caucasoid human species. This term is frequently used in reference to the caucasoid species in numerous biological studies. Use of this term makes it clear race exist. Below are examples from different biological research papers.
Indigenous Puerto Rico: DNA evidence upsets established history By Rick Kearns
Reprinted with permission, from Indian Country Today Posted: October 06, 2003 - 1:34pm EST by: Rick Kearns / Correspondent / Indian Country Today
History is written by the conquerors. The Native peoples of North America know this all too well, as they are still trying to bring the truth to light. Now, their long-lost Caribbean cousins are beginning the same process.
It’s an uphill battle.
Most Puerto Ricans know, or think they know, their ethnic and racial history: a blending of Taino (Indian), Spanish and African. Students of the islands’ past have read the same account for over 300 years; that the Native people, and their societies, were killed off by the Spanish invaders by the 1600s. It was always noted though, how many of the original colonists married Taino women or had Taino concubines, producing the original mestizaje (mixture) that, when blended with African, would produce Puerto Ricans.
Those first unions, according to the conventional wisdom, explain why some Puerto Ricans have "a little bit" of Native heritage. Mainly we are Spanish, we are told, with a little African blood and far-away Taino ancestry.
But the order of that sequence will have to change.
Dr. Juan Martinez Cruzado, a geneticist from the University of Puerto Rico Mayaguez who designed an island-wide DNA survey, has just released the final numbers and analysis of the project, and these results tell a different story. According to the study funded by the U.S. National Science Foundation, 61 percent of all Puerto Ricans have Amerindian mitochondrial DNA, 27 percent have African and 12 percent Caucasian. (Nuclear DNA, or the genetic material present in a gene’s nucleus, is inherited in equal parts from one’s father and mother. Mitochondrial DNA is inherited only from one’s mother and does not change or blend with other materials over time.) http://www.biomedcentral.com/1471-2350/6/30
High frequency of the IVS2-2A>G DNA sequence variation in SLC26A5, encoding the cochlear motor protein prestin, precludes its involvement in hereditary hearing loss Hsiao-Yuan Tang1 , Anping Xia1 , John S Oghalai1 , Fred A Pereira1, 2 and Raye L Alford1
Background Cochlear outer hair cells change their length in response to variations in membrane potential. This capability, called electromotility, is believed to enable the sensitivity and frequency selectivity of the mammalian cochlea. Prestin is a transmembrane protein required for electromotility. Homozygous prestin knockout mice are profoundly hearing impaired. In humans, a single nucleotide change in SLC26A5, encoding prestin, has been reported in association with hearing loss. This DNA sequence variation, IVS2-2A>G, occurs in the exon 3 splice acceptor site and is expected to abolish splicing of exon 3. Methods To further explore the relationship between hearing loss and the IVS2-2A>G transition, and assess allele frequency, genomic DNA from hearing impaired and control subjects was analyzed by DNA sequencing. SLC26A5 genomic DNA sequences from human, chimp, rat, mouse, zebrafish and fruit fly were aligned and compared for evolutionary conservation of the exon 3 splice acceptor site. Alternative splice acceptor sites within intron 2 of human SLC26A5 were sought using a splice site prediction program from the Berkeley Drosophila Genome Project. Results The IVS2-2A>G variant was found in a heterozygous state in 4 of 74 hearing impaired subjects of Hispanic, Caucasian or uncertain ethnicity and 4 of 150 Hispanic or Caucasian controls (p = 0.45). The IVS2-2A>G variant was not found in 106 subjects of Asian or African American descent. No homozygous subjects were identified (n = 330). Sequence alignment of SLC26A5 orthologs demonstrated that the A nucleotide at position IVS2-2 is invariant among several eukaryotic species. Sequence analysis also revealed five potential alternative splice acceptor sites in intron 2 of human SLC26A5.
http://www.ecacc.org.uk/default.asp?Reload=detail2.asp?itemid=92970 ECACC Releases all 5 Human Random Control (HRC) DNA (480 HRC individual DNAs) in Convenient 96 Well Panels Building on the success of the ECACC Human Random Control (HRC) DNA in genetics research (see selected publications list) ECACC has responded to customer demand and re-formatted all 480 HRC DNA samples into a more convenient 96 well format. This new development has been made possible by ECACC’s investment, during 2005, in automated liquid handling technologies. This development along with more efficient work practises has had the added benefit of substantially reducing the price of obtaining the whole 480 HRC DNA resources, bringing it within the scope of individual consumable budgets. The HRC DNA consists of authenticated, high quality purified human genomic DNA. Each of the available 480 samples is from a single individual, providing a control population of randomly selected, non-related UK Caucasian blood donors. The HRC DNA is available as a series of five panels each containing samples from 96 separate individuals in a convenient 8 x 12 well format. This is a readily available, cost effective and renewable source of standardised control DNA samples for use in a range of applications that include: • Population studies • Mutation analysis • SNP genotyping • Validation of technology • Assay development and validation • Association analysis • Comparative genomic hybridisation • Genomic DNA library construction http://www.funpecrp.com.br/gmr/year2002/vol2-1/gmr0004_full_text.htm Frequency of the hypervariable DNA loci D18S849, D3S1744, D12S1090 and D1S80 in a mixed ancestry population of Chilean blood donors M. Acuña1, H. Jorquera2, L. Cifuentes1 and L. Armanet3 1ICBM Genetic Program and 2Medical Technology School, Facultad de Medicina, Universidad de Chile, Casilla 70061, Santiago 7, Chile 3Forensic Medical Service, Santiago, Chile Corresponding author: M. Acuña E-mail: macuna@machi.med.uchile.cl Genet. Mol. Res. 1 (2): 139-146 (2002) Received April 11, 2002 Published June 27, 2002
Comparisons of D1S80 allele distribution between populations (Figure 2) using the ² test showed no significant differences between the Chilean population sample when compared with Southwestern US Hispanics and US Hispanics pooled (Zago et al., 1996; Huckenbeck et al., 1997). The research presented in this paper shows that the hypervariable DNA loci investigated are distinguishable from other Caucasian (Spanish), Black and Oriental populations, but that the D3S1744 locus is indistinguishable from the Caucasian population. All the loci studied are indistinguishable from USA Hispanic populations (Figures 2 and 3). This study provides the first database for DNA markers in low and middle socioeconomic strata in a Chilean population. The results presented indicate that the analysis of these loci may have useful applications in population genetics as well as in identity tests.
http://www.biomedcentral.com/1471-2415/5/5 A polymorphism at codon 31 of gene p21 is not associated with primary open angle glaucoma in Caucasians Thomas Ressiniotis1, 2 , Philip G Griffiths1 , Sharon M Keers2 , Patrick F Chinnery2 and Michael Birch1 1Department of Ophthalmology, Royal Victoria Infirmary, Newcastle upon Tyne, UK 2Department of Neurology, The Medical School, The University of Newcastle upon Tyne, UK
The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2415/5/5 Received 18 January 2005 Accepted 4 April 2005 Published 4 April 2005
Background Primary open angle glaucoma (POAG) is considered to be a neurodegenerative optic neuropathy, in which cell death occurs by apoptosis. p21, is an important protective component of the apoptotic pathway, regulating cellular arrest in the presence of DNA damage. An unstable or altered p21 protein could modify the cellular response to genomic injury and abolish the effect of p21. A previous study on a Chinese cohort suggested that the p21 codon 31 polymorphism may alter the state of apoptosis in glaucomatous optic neuropathy, failing to protect the ganglion cells.The aim of this study was to test the hypothesis that a p21 codon 31 polymorphism is associated with POAG on a Caucasian cohort. Methods 140 POAG patients and a control group of 73 healthy individuals were included in the study. All the subjects were of Caucasian origin. Genomic DNA was amplified by polymerase chain reaction, followed by enzymatic restriction fragment length polymorphism technique (PCR-RFLP). Patients and controls were genotyped for a single nucleotide polymorphism (C/A transversion) in the third base of codon 31 of p21, which leads to a serine (Ser)/arginine (Arg) substitution.
J Forensic Sci, Mar. 2005, Vol. 50, No. 2 Paper ID JFS2004293 Available online at: www.astm.org TECHNICAL NOTE Margaret C. Kline,1 M.S.; Peter M. Vallone,1 Ph.D.; Janette W. Redman;1 David L. Duewer,2 Ph.D.; Cassandra D. Calloway,3,4 M.S.; and John M. Butler,1 Ph.D. Mitochondrial DNA Typing Screens with Control Region and Coding Region SNPs∗
ABSTRACT: Mitochondrial DNA (mtDNA) analysis has found an important niche in forensic DNA typing. It is used with highly degraded samples or low-copy number materials such as might be found from shed hair or bones exposed to severe environmental conditions. The primary advantage of mtDNA is that it is present in high copy number within cells and therefore more likely to be recovered from highly degraded specimens. A major disadvantage to traditional forensic mtDNA analysis is that it is time-consuming and labor-intensive to generate and review the 610 nucleotides of sequence information commonly targeted in hypervariable regions I and II (HVI and HVII) of the control region. In addition, common haplotypes exist in HVI/HVII mtDNA sequences that can reduce the ability to differentiate two unrelated samples. In this report we describe the utility of two newly available screening assays for rapid exclusion of non-matching samples. The LINEAR ARRAY mtDNA HVI/HVII Region-Sequencing Typing Kit (Roche Applied Science, Indianapolis, IN) was used to type 666 individuals from U.S. Caucasian, African American, and Hispanic groups. Processing of the LINEAR ARRAY probe panels “mito strips” was automated on a ProfiBlot workstation. Observable variation in 666 individuals is reported and frequencies of the mitotypes within and between populations are presented. Samples exhibiting the most common Caucasian mitotype were subdivided with a multiplexed amplification and detection assay using eleven single nucleotide polymorphisms in the mitochondrial genome. These types of screening assays should enable more rapid evaluation of forensic casework samples such that only samples not excluded would be subjected to further characterization through full HVI/HVII mtDNA sequence analysis.
This paper makes it clear that a popular race used in biological research is caucasian.
-------------------- C. A. Winters Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
quote: how does this help you? Other than the dubious use of the word "caucasian" the highlighted passage above says that a group of people, who we know may look very similar, continue to carry the mtdna of their maternal ancestry - from different parts of the world. This seriously undermines your position regarding race.
Dr. Winters replied
quote: This helps support my position because some of these people are identified as caucasian, which identifies a race. It shows that races can be identified biologically and that these people were disguishd by their race andt geographical ancestry.
Dr. Winters, based on the findings of the study you cited, can one look at a Hispanic woman and, from just her outer appearance, predict what type of ancestral mtdna she has?
Posts: 1038 | From: Franklin Park, NJ | Registered: Aug 2005
| IP: Logged |
I asked Dr. Winters: quote: -------------------------------------------------------------------------------- how does this help you? Other than the dubious use of the word "caucasian" the highlighted passage above says that a group of people, who we know may look very similar, continue to carry the mtdna of their maternal ancestry - from different parts of the world. This seriously undermines your position regarding race. --------------------------------------------------------------------------------
Dr. Winters replied quote: -------------------------------------------------------------------------------- This helps support my position because some of these people are identified as caucasian, which identifies a race. It shows that races can be identified biologically and that these people were disguishd by their race andt geographical ancestry. --------------------------------------------------------------------------------
Dr. Winters, based on the findings of the study you cited, can one look at a Hispanic woman and, from just her outer appearance, predict what type of ancestral mtdna she has?
No.
-------------------- C. A. Winters Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
posted
^ If anything, Winters teaches us that there is no end to his silly notions, even if it means the of logic itself.
quote:Calypso asks: Dr. Winters, based on the findings of the study you cited, can one look at a Hispanic woman and, from just her outer appearance, predict what type of ancestral mtdna she has?
quote:Clyde Winters replied: No.
Then does this not mean that biological race does not exist? Posts: 26243 | From: Atlanta, Georgia, USA | Registered: Feb 2005
| IP: Logged |
quote:Dr. Winters, based on the findings of the study you cited, can one look at a Hispanic woman and, from just her outer appearance, predict what type of ancestral mtdna she has?
Dr. Winters replied:
quote:No.
Thanks for the reply Dr. Winters. Your answer is absolutely correct. One cannot look at any particular human being and tell with certainty their ancestral mtdna or Y chromosome.
This is one of the big problems with racial categories. Race is not merely phenotype but also lineage.
From your answer you've conceded that phenotype can belie lineage.
Humans have been so mobile that you have West African men with R lineages; Europeans with E3b; J in North and East Africa as well as Europe; european maternal DNA in North Africa; on and on it goes.
Look at any mtdna or Y chromosome map and what strikes you immediately is how confusing it is. Lineages far flung are all over the map criss-crossing continents, deserts, oceans!!!
You just don't have the necessary isolation that would be required for any groups to develop into sub-species.
No subspecies mean no races.Posts: 1038 | From: Franklin Park, NJ | Registered: Aug 2005
| IP: Logged |
It seems to me that George Gill is defending the "concept" of races, because apparently as a "Forensic" anthropologist, that is what he is expected to do. The pressure of the job to seek divisions and characterize people based on unscientific 'socially' constructed as opposed to biologically authenticated 'races', warrants him to defend the said social constructs. There is a difference between human 'races' being a real 'social construct' and being a 'real' biological phenomenon.
Here you are going too far. Other physical anthropologist outside of forensics can also determine race scientifically and not as a social construct. http://www.kacike.org/MartinezEnglish.html
I am not sure what you mean I'm going too far, when you haven't answered my questions with regards to George Gill. But just to take bio-anthropologists in America as an example, since George Gill is one of them; outside of the AAA, how many American bio-anthropologists who are not "forensics" or work with cops in criminal investigation, claim that social constructs of human 'races' are scientifically valid? They had better outnumber the members of the AAA, and their work has to be up-to-date, not from the 19th century. I ask this, because the AAA stance on human 'races' is quite clear, and doesn't support you. Moreover, how many "human" races do these folks propose up-to-date, and on what basis? Please get back to me on this a.s.a.p.
Posts: 5964 | Registered: Jan 2005
| IP: Logged |
Gill has already made it clear that about half the scientists believe race exist and the other half belive race does not exist. The biology literature is full of reference to race.
Do you have the comprehensive list of 'half' of these scientists, and how Gill has communicated with them. Do these scientists fall outside of Gill's line of work, which is "forensics", and do you have their up-to-date peer reviewed defense of human 'races'?
With regards to your mention of "literature full of references of race", are these "scientific" definitions of race as opposed to "social contructs" of ethnicity? For instance, you post...
Race
From Wikipedia, the free encyclopedia
Jump to: navigation, search
This article may benefit form being shortened by the use of summary style.
Summary style moves large sections to sub-articles that are summarized in the main article. For other uses, see Race (disambiguation).
The term race distinguishes a population of humans (or non-humans) from other populations. The most widely used human racial categories are based on visible traits (especially skin color and facial features), genes, and self-identification. Conceptions of race, as well as specific racial groupings, vary by culture and over time and are often controversial, for scientific reasons as well as their impact on social identity and identity politics. Legal definitions, common usage, and scientific meaning can all be conflated, causing confusion and controversy.
Do you think that the above is a scientific definition of race? Notwithstanding the pending answer, the wiki piece has something quite instructive therein, i.e. concepts of "races", essentially with regards to social constructs, vary from culture to culture; in this regard, who is to say whose social construct is the valid one, and whose isn't? You bet ya, science does! Science is the discipline that deals with anatomy and the corresponding genetic constituents. You cannot separate anatomy from DNA. Science is the discipline that puts forth the challenge, i.e. via falsefiable material, and any one from any culture, should feel free to objectively disprove the matter at hand. So science isn't subject to cultural variation. It is the study of the natural world, understanding it, and adopting to such accordingly. And now, to the rest of your post...
Webster's Dictionary defines race as "a group of people of common ancestry or stock". Descent is defined as 'derivation from an ancestor'.
Please show us how, George Gill's 'divisions' of humans based on mere physical 'resemblance' fits this definition?
Posts: 5964 | Registered: Jan 2005
| IP: Logged |
posted
What Mr. Winters doesnt understand is that from a forensic perspective BLACK is ONLY meaningful as a statistic. When it comes to measuring poverty levels, health care, crime rates, access to affordable housing and other population statistics, BLACK is a meaningful term. However, that does NOT mean that BLACK is a race. Race and socio-economic statistics based on superficial characteristics are TWO different things. More importantly, the FACT that SUPERFICIAL characteristics, like skin color, are the MAIN determiner of socio-economic status, based on HISTORICALLY invalid concepts of race are the REASON why we should NOT be parroting OUTDATED racist IDEOLOGIES. It is only if you FOLLOW such a SOCIO ECONOMIC model that the SUFFERING of BLACKS world wide is JUSTIFIED and NECESSARY because THEY are too much of a burden on the ADVANCED "civilizations" of the Western World and WHITE "race". In other words, RACE and SOCIO-ECONOMIC policy go hand in hand, because you CANT have one without the OTHER and historically that is the BASIS for the DISPARITY between WHITES and BLACKS in the world today. But remember, NONE of this has ANYTHING to do with RACE being a SCIENTIFICALLY VALID concept. It ONLY has to do with using SUPERFICIAL characteristics to define RACE as a MECHANISM for enforcing SOCIAL and ECONOMIC POLICY.
Posts: 8890 | Registered: May 2005
| IP: Logged |
quote: Do you have the comprehensive list of 'half' of these scientists, and how Gill has communicated with them. Do these scientists fall outside of Gill's line of work, which is "forensics", and do you have their up-to-date peer reviewed defense of human 'races'?
Supercar this is not how research works. Gill has made a claim. This claim remains confirmed until someone shows otherwise. If you believe he is wrong about the demographics of who does and does not support the concept of race it is up to you to disconfirm his thesis. Right now his statement remains valid.
The fact that the articles by Tang et al and others were concerned with race confirms the reality of race being a part of science as even noted by Duster.
Supercar
quote:
Please show us how, George Gill's 'divisions' of humans based on mere physical 'resemblance' fits this definition?
Gill's definition of race is probably based on his discipline. Every definition of this or that phenomena is depended upon the field or discipline in which the term is used.
Your job is show how Gill's definition of race is not supported by his field of study.
.
-------------------- C. A. Winters Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
posted
No, Dr. Winters, the problem is that you don't understand what you are citing.
Nor do you want to.
That's why you never answer anyone's questions or reply to specifics. You just spam materials you don't understand and pretend you are making some kind of point, but it never works, because no one on ES is that stupid.
At least when you discuss some of your wilder linguistic theories you honestly seem to think you know what you're talking about, and it's fun to discuss.
But your pseudo-biology threads are boring, because you don't even know *how* to discuss the topic. Posts: 15202 | Registered: Jun 2004
| IP: Logged |
The following statement was adopted by the Executive Board of the American Anthropological Association, acting on a draft prepared by a committee of representative American anthropologists.
We believe that it represents generally the contemporary thinking and scholarly positions of a majority of anthropologists.
In the United States both scholars and the general public have been conditioned to viewing human races as natural and separate divisions within the human species based on visible physical differences.
With the vast expansion of scientific knowledge in this century, however, it has become clear that human populations are not unambiguous, clearly demarcated, biologically distinct groups. Evidence from the analysis of genetics (e.g., DNA) indicates that most physical variation, about 94%, lies within so-called racial groups. Conventional geographic "racial" groupings differ from one another only in about 6% of their genes. This means that there is greater variation within "racial" groups than between them. In neighboring populations there is much overlapping of genes and their phenotypic (physical) expressions. Throughout history whenever different groups have come into contact, they have interbred. The continued sharing of genetic materials has maintained all of humankind as a single species.
Physical variations in any given trait tend to occur gradually rather than abruptly over geographic areas. And because physical traits are inherited independently of one another, knowing the range of one trait does not predict the presence of others. For example, skin color varies largely from light in the temperate areas in the north to dark in the tropical areas in the south; its intensity is not related to nose shape or hair texture. Dark skin may be associated with frizzy or kinky hair or curly or wavy or straight hair, all of which are found among different indigenous peoples in tropical regions. These facts render any attempt to establish lines of division among biological populations both arbitrary and subjective.[Posts: 15202 | Registered: Jun 2004
| IP: Logged |
posted
^ This is fine statement but individual anthropolgists conduct research in any way they wish. It is just wishful thinking to believe that everyone follows this policy as noted by Dr. Gill.
Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
posted
copyright January 13, 2003 Scientific American Magazine
The Reality of Race There's hardly any difference in the DNA of human races. That doesn't mean, argues sociologist Troy Duster, that genomics research can ignore the concept.
By Sally Lehrman
Race doesn't exist, the mantra went. The DNA inside people with different complexions and hair textures is 99.9 percent alike, so the notion of race had no meaning in science. At a National Human Genome Research Institute (NHGRI) meeting five years ago, geneticists were all nodding in agreement. Then sociologist Troy Duster pulled a forensics paper out of his briefcase. It claimed that criminologists could find out whether a suspect was Caucasian, Afro-Caribbean or Asian Indian merely by analyzing three sections of DNA.
"It was chilling," recalls Francis S. Collins, director of the institute. He had not been aware of DNA sequences that could identify race, and it shocked him that the information can be used to investigate crimes. "It stopped the conversation in its tracks."
In large part thanks to Duster, Collins and other geneticists have begun grappling with forensic, epidemiological and pharmacogenomic data that raise the question of race at the DNA level. The NHGRI now routinely includes experts from the social disciplines to assist in guiding research priorities and framing the results for the public. "The complexities of the DNA sequence require not just simplistic statements about similarities between groups but a full appreciation of history, anthropology, social science and politics," Collins has realized. "Duster is a person that rather regularly gets tapped on the shoulder and asked for help."
The urbane 66-year-old Duster, who splits his time between appointments at the University of California at Berkeley and New York University, examines how the public absorbs news about genetics into existing beliefs and how those perceptions also shape the use of genetic sequencing, DNA probes and other molecular techniques.
Those techniques have revealed that race is minor at the DNA level. The genetic differences between any two randomly selected individuals in one socially recognized population account for 85 percent of the variation one might find between people of separate populations. Put another way, the genetic difference between two individuals of the same race can be greater than those between individuals of different races--table sugar may look like salt, but it has more similarities with corn syrup. But genetics cannot prove that race doesn't exist, Duster explains. No amount of logic will erase the concept or destroy the disparities that arise from it, because people use race to sort their social groupings and to define their social and economic interactions. Moreover, they do so in ways that have significant biological consequences. Duster recently helped to draft a 15-page statement for the American Sociological Association showing how race persists as a factor in disparities in health and other areas of life. "You cannot just get rid of the concept without doing tremendous damage to the epidemiologic research done so far," Duster says. African-Americans are three times as likely to die from heart disease, for example. "Blacks are redlined by banks, followed by department store security, pulled over by the police. This can produce hypertension," he points out. "It can give you a heart attack."
A new approach, gene clustering, avoids race by dividing according to medically important markers, such as genes for the enzymes necessary to metabolize drugs. But society will very likely re-create racial categories and rankings under the new terms, Duster predicts. And by failing to name the social context, this strategy gives base-pair differences undue emphasis at the expense of environmental influences. Race is a social reality, Duster observes, and he warns that science itself is a social institution susceptible to essentialist perceptions of race.
Raised in poverty during the Great Depression by a mother from an upper-class family, Duster, whose father died when he was nine, grew up navigating between Chicago's tough streets and its privileged intellectual and civic parlors. He witnessed firsthand the complexities of social categories and learned to "code-switch" from one to another, much as he capably moves among sociology, anthropology and genetics now.
Duster started out as a journalist but quit in moral indignation when chided for failing to interview a trapped subway motorman waiting for a leg amputation. He turned to sociology and joined Berkeley in 1967, quickly developing a reputation for thought-provoking work on drugs and social policy. In the 1970s Duster was a familiar voice in National Institutes of Health committees reviewing grants for research on mental health and drug abuse. While sitting on a panel for President Jimmy Carter's Commission on Mental Health, he began to hear researchers speculate that drug addiction and mental illness were linked to genetic susceptibilities.
Duster found the conversations alarming. His book, Backdoor to Eugenics, aimed to stimulate public debate by showing how genetic-screening policies tended to reinforce the power structures already within society. Since then, he has pressed geneticists and molecular biologists to consider the social meaning that emerges from what they perceive as unbiased fact.
At first they resisted. As a member of the Ethical, Legal and Social Implications Working Group advising the agencies on human genome research, Duster urged the NIH and the Department of Energy to challenge The Bell Curve, the 1994 best-seller that argued that race correlated with intelligence. Government officials held up a response for eight months, convinced that the nonexistence of race at the genome level spoke for itself.
Duster, along with fellow committee member Dorothy Nelkin of New York University, highlighted the ways in which cultural context influences the application of medical and behavioral genetics. Now Collins is relying on Duster and other collaborators, such as University of Wisconsin molecular biologist Pilar Ossorio, to help explain why race must be acknowledged even if it is biologically inconsequential. "It's a tightrope between trying to rescue the importance and meaning of research on race without giving it a false reality," Duster says.
Indeed, although he maintains that race is significant in genetics, Duster insists it is misleading to reinscribe race as a definitive system to group people who share geographic origins and thus some genes. For one, concepts of race vary geographically as well as historically. The ethnic status of South Asians, for example, has changed over the past century in the U.S. and more often serves to define a political and cultural "other" than something biological. In 1920 Oregon granted citizenship to Bhagat Singh Thind of India during a ban on Asian immigration. But the U.S. Supreme Court disagreed, stating that even though Thind should be considered "Caucasian," he still wasn't "white." (Thind, who had joined the U.S. Army during World War I, managed to stay in the country, earn a Ph.D. and publish 15 books on metaphysics.)
Researchers have also advocated assessing health risks within ethnic groups based on inherited variations in just one DNA base pair. But such single-nucleotide polymorphism (SNP) profiles can be deceptive, Duster warns. Ethnic differences in drug metabolism or response to tobacco exist, but they appear to be minimal and depend strongly on the environment. The emphasis on DNA, he remarks, transforms health status into a biological inevitability, and it is tempting to use the same tools to profile criminality or intelligence at the genome level.
Specific variations in DNA can be linked to ancestral geographic origins, but those differences only occasionally offer a medically important clue. They fail to define any essential characteristics of a whole group. Race, itself a fluid idea, is part of the environmental context of the genome, Duster suggests. "Race is a relationship," he says. "When you talk about race as a relationship, it prevents anyone from giving it false meaning."
-------------------------------------------------------------------------------- Sally Lehrman is a medical technology and health policy journalist based in San Francisco.
-------------------- C. A. Winters Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
quote:Originally posted by Clyde Winters: This is fine statement but individual anthropolgists conduct research in any way they wish.
The above is and immaterial comment, with no bearing on the fact that the majority of scholars in the field disagree with your ill-informed opinion.
quote: It is just wishful thinking to believe that everyone follows this policy
Incorrect, as it is not a *policy*, but rather a professional assessment from leading scholars in the field.
You may not agree with it, but you know nothing about anthropology, and show a very poor aptitude for learning.
Therefore you can't intelligently refute it.
This is why you resort to blind google/spamming and rhetorical response in hopes of finding something to somehow support your racialist views. You've failed to do so.
Posts: 15202 | Registered: Jun 2004
| IP: Logged |
quote:There's hardly any difference in the DNA of [human races.]
Invalidates race biologically, hence conceding the material point.
quote: That doesn't mean, argues sociologist Troy Duster
Sociologist = Appeal to Authority fallacy.
quote:But genetics cannot prove that race doesn't exist, Duster explains.
Burdan of proof fallacy. The burdan is actually on racialist to prove fundamental genetic divisions within designated races....which your article admits do not exist.
quote: No amount of logic will erase the concept or destroy the disparities that arise from it, because people use race to sort their social groupings
Non-sequitur. Social groupings are sociology, not biology. No amount of reference to social groups can validate race biologically.
Well that didn't help you did it?
Google up something else.....something more relevant and less desparate sounding.
Posts: 15202 | Registered: Jun 2004
| IP: Logged |
quote: Do you have the comprehensive list of 'half' of these scientists, and how Gill has communicated with them. Do these scientists fall outside of Gill's line of work, which is "forensics", and do you have their up-to-date peer reviewed defense of human 'races'?
Supercar this is not how research works. Gill has made a claim. This claim remains confirmed until someone shows otherwise.
Been done. Now, try answering the questions I asked as per layout, without a single one unaddressed.
quote:Clyde Winters:
If you believe he is wrong about the demographics of who does and does not support the concept of race it is up to you to disconfirm his thesis.
Gill is an American 'forensics' physical anthropologist. The question is, do you know what the AAA is?
quote:Clyde Winters:
quote:Supercar:
Please show us how,George Gill's 'divisions' of humans based on mere physical 'resemblance' fits this definition?
Gill's definition of race is probably based on his discipline. Every definition of this or that phenomena is depended upon the field or discipline in which the term is used.
What definition would that be; the social constructs of race, or the biological, and hence, valid definition of 'race'? If you are capable enough to blindly quote people, then surely you should be just as capable of citing their definitions.
quote:Clyde:
Your job is show how Gill's definition of race is not supported by his field of study.
Why, because you can't read, and therefore, keep asking for things that have already been addressed. It is your job to answer the questions I asked you pertaining to George Gill's unsubstantiated claims. Why have you failed in doing your job?
Posts: 5964 | Registered: Jan 2005
| IP: Logged |
Do you have the comprehensive list of 'half' of these scientists, and how Gill has communicated with them. Do these scientists fall outside of Gill's line of work, which is "forensics", and do you have their up-to-date peer reviewed defense of human 'races'?
Supercar this is not how research works. Gill has made a claim. This claim remains confirmed until someone shows otherwise. --------------------------------------------------------------------------------
Been done. Now, try answering the questions I asked as per layout, without a single one unaddressed.
As I said before you will have to prove that Gill is wrong not me. The research of Tang et al, and the other researchers cited in this thread prove that race is part of the scientific discourse.
Supercar
quote:
Gill is an American 'forensics' physical anthropologist. The question is, do you know what the AAA is?
[quote]
Yes I belong to the organization. In addition I have presented papers at the AAA annual conferences on my Indus Valley and Olmec decipherments. How many papers have you presented at the AAA.
Your job is show how Gill's definition of race is not supported by his field of study. --------------------------------------------------------------------------------
Why, because you can't read, and therefore, keep asking for things that have already been addressed. It is your job to answer the questions I asked you pertaining to George Gill's unsubstantiated claims. Why have you failed in doing your job?
I am doing my job posting research and researchers who claim race exist. It is your job to illustrate that these reseachers are wrong.
Up to now you have not done so.
Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
...then where are the answers to my questions? You are at least smart enough to know that not doing your job, can get you fired.
Posts: 5964 | Registered: Jan 2005
| IP: Logged |
posted
^ You have never asked a legitimate question. You are asking questions about Gill's, these are questions only Dr. Gill can answer. Since you're so smart maybe you can read his mind and find the answer to your question.
The fact remains, I have confirmed that race is part of the scientific discourse my job is well done.
.
-------------------- C. A. Winters Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
LOL. You belong to the American Anthropological Association, and yet, cannot see that the AAA stance on race [clickable] doesn't support you?
quote:Clyde:
In addition I have presented papers at the AAA annual conferences on my Indus Valley and Olmec decipherments.
You belong to AAA, and yet, still don't know the biological definition of race? Does AAA go by the biological definition of race, or your social constructs?
quote:Clyde Winter:
How many papers have you presented at the AAA.
^Clumsy smokescreen. What genetics or bio-anthropological papers have you presented at the AAA?
Posts: 5964 | Registered: Jan 2005
| IP: Logged |
posted
^ Then you are wasting your time, Supe! LOL
I almost feel sorry for Clyde who is humiliating himself yet again on this board!
LMAO @ ".. I belong to the organization. In addition I have presented papers at the AAA annual conferences..."
If I didn't know any better, I'd say Clyde has resorted to outright lying. Either that or the AAA is ROTFL at him as much as I am! Posts: 26243 | From: Atlanta, Georgia, USA | Registered: Feb 2005
| IP: Logged |
You are asking questions about Gill's, these are questions only Dr. Gill can answer. --------------------------------------------------------------------------------
You've got to be kidding; you mean, you can cite George Gills, and not know what he is talking about?
I know exactly what he's talking about. Race exist as a scientific reality. You're the one questioning his statistics.
Gill, like Tang et al make it clear race is part of the scientific discourse.
How many papers have you presented at the AAA. --------------------------------------------------------------------------------
^Clumsy smokescreen. What genetics or bio-anthropological papers have you presented at the AAA?
Friday, April 16th ... in Highland Chiapas. 9:30. Clyde Winters (Loyola U - Chicago) Olmec Symbolism in the Mayan Writing. 9:50. Nestor Quiroa (U Illinois ... www.aaanet.org/csas/mtg99/program/pfri.html - 47k - Cached - Similar pages
Saturday, April 17th ... 11:15. Samuel Cooper (Bar Ilan U) The Classification of Biblical Sacrifice. 11:35. Clyde Winters (Loyola U - Chicago) Harappan Origins of Yogi. 11:55. ... www.aaanet.org/csas/mtg99/program/psat.html - 50k - Cached - Similar pages preliminary program csas98
... Mexican Villages. 4:10 Clyde A. Winters (Uthman dan Fodio I) Jaguar Kings: Olmec Royalty and Religious Leaders in the First Person. 4:30 ... www.aaanet.org/csas/mtg98/Prelimp5.htm - 39k - Cached - Similar pages
Thursday April, 3 - Early Afternoon ... Russia [1413]. 2:30 pm - Clyde A. Winters (Uthman dan Fodio Institute) - The Decipherment of Olmec Writing [1414]. 2:50 pm - James ... www.aaanet.org/csas/mtg97/final.htm
.
-------------------- C. A. Winters Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
posted
^ No it doesn't and for the reasons already cited including from your own source!
'Race' implies genetic distinctions that correlate with phenotype such as skin color and facial features. However, genetics has shown this not to be the case.
Black Dravidians and Black Andamanese are no more related to black Africans that light skinned Chinese and Japanese. 'White Europeans' if they carry recent African lineages are on the other hand closely related to black Africans.
The groups in study labelled as 'African', 'European', and 'Asian' were done so based on geography. This does NOT imply racial divisions as not all Asians are 'racially' the same.
Race is purely a social construct with no basis on biology.
You still have not answered Rasol and Supe's fundamental questions pertaining to your notions, so therefore it is over. You lost so give it a rest Winters. Posts: 26243 | From: Atlanta, Georgia, USA | Registered: Feb 2005
| IP: Logged |
I assume that one can discount with the term "race" since biologists don't use it in their analyses of biological species and sub-species.
On the basis of your argument then humans all belong to 1 species for which there no subgroupings.
If so, then shouldn't that mean that every person is equally related to every other person--as should be be evidenced by genetic research.
But we are told that some groups or humans are related to other groups but not related to other groups based on lineages and the notion of MRCA.
The question then is how do we parse or interpret all of this?
Problems are compounded in the case of humans because humans do not have natural habitats or sub-species modes of communication or even specific diets.
But the impact of the environment is evident for humans in that some phenotypical traits seem to have adaptive qualities as say in the case pigmentation.
So is there some biologic principle at work here in much the same way that such a principle works in nature as a whole.
I guess the situation is similar to that of an atheist or agnostic in a world where the majority of humans believe in a Deity and take it so seriously that they pattern their whole lives on their beliefs. The non-believer could hardly ever convince such persons of his/her own beliefs.
Similarly people who believe that races exist act very confidently on such--as the Police(with deadly force) and Immigration personnel(holding cells) in the West. If told that "race is social construct" such individuals would be puzzled but amused--while they slip on the handcuffs.
Posts: 5492 | Registered: Nov 2004
| IP: Logged |
quote:If so, then shouldn't that mean that every person is equally related to every other person
Nope. The existence of families negates this - family isn't a race or sub-species.
What you are seeking is an escape from your burden of proof. It won't work.
Pretend that family demarcates race - and now every species on earth has millions of 'races'.
Race works the other way around: It is the specific and *falsified* claim regarding millions of individual humans placed in one assumptive breeding class.
Ideologically many people are addicted to these assumptions.
Winters has grounded much of his fallacious work on them: for example, the idea that Dravidians are a branch of the Mandingo.
And idea genetics has completely exploded.
That's why Winters hates genetics.
btw: Make no mistake that Winters know this.
He is akin to Evil Euro in this respect - waging a war against the terrible truth. His goal is simply to find a sucker who will believe him.
quote:The question then is how do we parse or interpret all of this?
This reminds me of a comment I once read on another forum.
A discussant stated that if anthropologists couldn't tell us who belonged to which race - then anthropology was a waste of time.
Another discussant - obviously with their thinking cap on - noted that it is not only *not* the duty of a scientific discipline to affirm and a priori' ideology, but that even attempting to do so was the every essence of bad science.
Population geneticists study genetic traits within and between groups - or populations.
It is not the job of science to affirm 'race'.
Nor does interpretation of population genetics require race.
Race is more akin to superstition - it is what people use when they either do not have, or cannot comprehend a scientific answer.
Posts: 15202 | Registered: Jun 2004
| IP: Logged |
I know exactly what he's talking about. Race exist as a scientific reality. You're the one questioning his statistics.
How can you claim to know what the man is talking about, when you can't even do the no-brainer thing of telling us what the man's definition is for "races". Does it conform to the unwavering 'objective' definition of biology, or does it take the shape of the variable, subjective and pseudo-scientific social constructs?
quote:Originally posted by Clyde Winters:
Supercar
quote: ^Clumsy smokescreen. What genetics or bio-anthropological papers have you presented at the AAA?
Friday, April 16th ... in Highland Chiapas. 9:30. Clyde Winters (Loyola U - Chicago) Olmec Symbolism in the Mayan Writing. 9:50. Nestor Quiroa (U Illinois ... www.aaanet.org/csas/mtg99/program/pfri.html - 47k - Cached - Similar pages
Saturday, April 17th ... 11:15. Samuel Cooper (Bar Ilan U) The Classification of Biblical Sacrifice. 11:35. Clyde Winters (Loyola U - Chicago) Harappan Origins of Yogi. 11:55. ... www.aaanet.org/csas/mtg99/program/psat.html - 50k - Cached - Similar pages preliminary program csas98
... Mexican Villages. 4:10 Clyde A. Winters (Uthman dan Fodio I) Jaguar Kings: Olmec Royalty and Religious Leaders in the First Person. 4:30 ... www.aaanet.org/csas/mtg98/Prelimp5.htm - 39k - Cached - Similar pages
Thursday April, 3 - Early Afternoon ... Russia [1413]. 2:30 pm - Clyde A. Winters (Uthman dan Fodio Institute) - The Decipherment of Olmec Writing [1414]. 2:50 pm - James ... www.aaanet.org/csas/mtg97/final.htm
Your mind must be out of this world; how do these qualify as 'molecular genetics' and bio-anthropology?
Posts: 5964 | Registered: Jan 2005
| IP: Logged |
posted
Supercar I have listed my presentations at AAA.
You make it appear that you are an expert on everything. It should be a no brainer for you present a list of some of your presentations, books and articles on genetics, bio-anthropology or anything related to anthropology.
.
-------------------- C. A. Winters Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
Until now, you present allel frquencies in different area--no dispute about that!
But do you dispute leading scienties, even chairmen of the National Human Genome Research Institute (NHGRI)?
quote: Current genetic data also refute the notion that races are genetically distinct human populations. There are no gene variants that are present in all individuals of one population group and in no individuals of another. No sharp genetic boundaries can be drawn between human population groups. However, frequencies of genetic variants and haplotypes differ across the world.
quote:The vast majority of common genetic variants present today existed in our common ancestral pool. This is not surprising, given the relative recency of the migration of humans out of Africa and the continuous exchange of DNA between populations. Trade, war, and exploration led to well-documented travel among peoples geographically distant from one another as far back as the Middle Ages, if not earlier (Smedley, 1999). However, because of evolutionary forces, such as genetic drift, founder effect, and selection, the frequencies of some genetic differences are not constant in all populations throughout the world.
In addition, because of our evolutionary past, variation itself is not spread evenly among population groups
NOTE!!!!!
quote:Still, researchers using new technologies have shown that DNA variation measured in humans from across the globe can be used to roughly categorize individuals into clusters based on the similarity of certain sections of their genetic code (Risch, Burchard, Ziv, & Tang, 2002; Rosenberg et al., 2002). Those categories—labeled by Risch and his colleagues as Africans, Caucasians, Pacific Islanders, East Asians, and Native Americans—loosely correspond to the social categories of race (Risch et al., 2002; Rosenberg et al., 2002). It should be noted, however, that these findings only result if one starts with individuals whose recent ancestors all derive from one geographic area—and of course that does not apply to an increasing proportion of individuals. It should also be noted that the number of “groups” is subject to the analysis of the data and the geographic areas of the world that are sampled. Human genetic variation is a continuum across the world (Serre & Pääbo, 2004).
And NOTE!!! AGAIN !!!!
quote:Race and ethnicity are complex sociopolitical constructs. They are variable and fluid, changing over time and differing throughout the world (see, e.g., Harris, Consorte, Lang, & Byrne, 1993; Jacobson, 1998; Snowden, 1983). How can researchers reconcile what may at first blush seem contradictory claims?
So when it comes to the relationship between self-identified race and the genetic contribution to the likelihood of developing a disease or a given trait, self-identified race is a surrogate for ancestral geographic origin, which is a surrogate for variation across the genome, which is a surrogate for variation in disease-relevant alleles, which is a surrogate for individual disease risk (Collins, 2004).
You question about the Hispanic woman is to broad of a category because this depends on the social construct of the observer and the participant (i.e Hispanic). The Hispanic label is a North American one placed on people who speak Spanish as a way to lump them all in a neat 'target'. The Hispanic may not want to be labelled as such but by default that is what it ends up to be, hence a category that one is forced to deal with!
Americans look at Hispanics and many cannot differentiate. Hispanics can be Indio (indigena/native american as in Aztec, Maya, Quechua, Carib, etc), African, European (Spaniard), but many are mestizo/mulato referencing origins, be it Cuba, PR, RD, now Mexico (since most recent are Indians-check out your gardner vs the TV version (telemundo/univision) of Hispanics. Again, some people are proud of their native origins and neglect the Hispanic image (the few) while the many adopt it to hide those same origins.
Posts: 1290 | From: usa | Registered: May 2005
| IP: Logged |
Though I doubt we'll get any except a repition of previously stated fallacies (which have already been corrected). Posts: 26243 | From: Atlanta, Georgia, USA | Registered: Feb 2005
| IP: Logged |
posted
Arwa you did not post the entire paper. The authors of the study you posted mentions that some scientist believe they are able to use genetic research to detect specific self-identified races.
quote:
Race and Ethnicity in the Genome Era: The Complexity of the Constructs Vence L. Bonham, Esther Warshauer-Baker, Francis S. Collins, from National Human Genome Research Institute, National Institutes of Health
American Psychologist, Vol. 60, No. 1, p 9-15 Still, researchers using new technologies have shown that DNA variation measured in humans from across the globe can be used to roughly categorize individuals into clusters based on the similarity of certain sections of their genetic code (Risch, Burchard, Ziv, & Tang, 2002; Rosenberg et al., 2002). Those categories—labeled by Risch and his colleagues as Africans, Caucasians, Pacific Islanders, East Asians, and Native Americans—loosely correspond to the social categories of race (Risch et al., 2002; Rosenberg et al., 2002).It should be noted, however, that these findings only result if one starts with individuals whose recent ancestors all derive from one geographic area—and of course that does not apply to an increasing proportion of individuals. It should also be noted that the number of “groups” is subject to the analysis of the data and the geographic areas of the world that are sampled. Human genetic variation is a continuum across the world (Serre & Pääbo, 2004). She continues
quote: At the present time, most of the specific gene variants involved in particular traits have not yet been discovered (Collins et al., 2003). However, researchers do have the tools with which to study variation across the entire genome in a set of individuals and to try to correlate that with health outcomes. Variation across the genome, in turn, can correlate with ancestral geographic origin, but this correlation is far from perfect. Ancestral geographic origins, in turn, correlate to some degree with self-identified race or ethnicity, but as noted earlier, this relationship is blurry and context dependent. So when it comes to the relationship between self-identified race and the genetic contribution to the likelihood of developing a disease or a given trait, self-identified race is a surrogate for ancestral geographic origin, which is a surrogate for variation across the genome, which is a surrogate for variation in disease-relevant alleles, which is a surrogate for individual disease risk (Collins, 2004).
This passage makes it clear that use of geographical terms to designate populations is just a continuation of grouping people into races.
It supports my contention that many scientist believe genetics can be used to determine race. It also illustrates why the journalists who wrote about the 13 institutes that determined genes can be correlated to individuals who self-identify their race were accurately reporting what the research means:
There are just under 30,000 genes in the human genome, which consists of about 3 billion "letters" of the DNA code. The scientists found that more than 10 per cent of these genes appear to be multiplied in the 270 people who took part in the study. They do not know why some genes are copied and some are not. One gene, called CCL3L1, which is copied many times in people of African descent, appears to confer resistance to HIV. Another gene involved in making a blood protein is copied many times in people from south-east Asia and seems to help against malaria. Other research has shown that variation in the number of copies of some genes is involved in Alzheimer's and Parkinson's disease.
Are there any other practical applications?
The scientists looked at people from three broad racial groups - African, Asian and European. Although there was an underlying similarity in terms of how common it was for genes to be copied, there were enough racial differences to assign every person bar one to their correct ethnic origin. This might help forensic scientists wishing to know more about the race of a suspect.
Who made the discovery and where can we read more about it?
Scientists from 13 research centres were involved, including Britain's Sanger Institute in Cambridge, which also took a lead role in deciphering the human genome. The research is published in Nature, Nature Genetics and Genome Research.
You are either a lousy linguist or you just come here to play around.
And stop quoting that article. You have misused it to a certain point that it wants to get help at UNHCHR. Start to search a scientific article, where it claims to have found a gene in only one human group.
You quoted:
quote:Ancestral geographic origins, in turn, correlate to some degree with self-identified race or ethnicity, but as noted earlier, this relationship is blurry and context dependent.
blurrycontext dependent<<< any alarm bell ringing!!
Speaking of context, the segment you quoted is called:
The Series of Weak Correlations In this section the authors were summarizing the weak allegation on connections between genetic and race.
Now allow me to quote the whole segment:
quote:The Series of Weak Correlations
The real connections between genetic variation and self-identified race travel through several intermediate steps. It is true that variation in specific genes can increase the likelihood of developing certain diseases and/or human traits. These are not deterministic “DNA oracles,” however—the role of the environmentis extremely important for nearly all behaviors and common diseases, and gene-environment interactions are complex and dynamic. As a result, the presence of specific susceptibility genesis far from a perfect predictor of the true probability of experiencing a given illness or exhibiting a given trait.
At the present time, most of the specific gene variants involved in particular traits have not yet been discovered (Collins et al., 2003). However, researchers do have the tools with which to study variation across the entire genome in a set of individuals and to try to correlate that with health outcomes. Variation across the genome, in turn, can correlate with ancestral geographic origin, but this correlationis far from perfect. Ancestral geographic origins, in turn, correlate to some degree with self-identified race or ethnicity, but as noted earlier, this relationshipis blurry and context dependent. So when it comes to the relationship between self-identified race and the genetic contribution to the likelihood of developing a disease or a given trait, self-identified raceis a surrogate for ancestral geographic origin, which is a surrogate for variation across the genome, which is a surrogate for variation in disease-relevant alleles, which is a surrogate for individual disease risk ( Collins, 2004).
Now, it's your turn.
Posts: 2198 | Registered: Jun 2006
| IP: Logged |
posted
^His turn to what?... embarass himself again?
quote:rasol says: He [Winters] is akin to Evil Euro in this respect - waging a war against the terrible truth. His goal is simply to find a sucker who will believe him.
Volunteers?
Posts: 26243 | From: Atlanta, Georgia, USA | Registered: Feb 2005
| IP: Logged |
posted
To all forum members. Does this segment support grouping people into races? http://tinyurl.com/sz9kt
quote:Still, researchers using new technologies have shown that DNA variation measured in humans from across the globe can be used to roughly categorize individuals into clusters based on the similarity of certain sections of their genetic code (Risch, Burchard, Ziv, & Tang, 2002; Rosenberg et al., 2002). Those categories—labeled by Risch and his colleagues as Africans, Caucasians, Pacific Islanders, East Asians, and Native Americans—loosely correspond to the social categories of race (Risch et al., 2002; Rosenberg et al., 2002). It should be noted, however, that these findings only result if one starts with individuals whose recent ancestors all derive from one geographic area—and of course that does not apply to an increasing proportion of individuals. It should also be noted that the number of “groups” is subject to the analysis of the data and the geographic areas of the world that are sampled. Human genetic variation is a continuum across the world (Serre & Pääbo, 2004).
Race and ethnicity are complex sociopolitical constructs. They are variable and fluid, changing over time and differing throughout the world (see, e.g., Harris, Consorte, Lang, & Byrne, 1993; Jacobson, 1998; Snowden, 1983). How can researchers reconcile what may at first blush seem contradictory claims?
UBBFriend: Email this page to someone!
![[Big Grin]](biggrin.gif)
Of course. Apparently 'Lord of denial' does not even know that E3b is not indigenous to the Philippines. Regardless, the only "dumbo" was him for telling that ridiculous lie. 
![[Embarrassed]](redface.gif)
Clyde, you are waging a war that has been lost a long time ago.![[Roll Eyes]](rolleyes.gif)
![[Smile]](smile.gif)
Printer-friendly view of this topic