Please provide any proof that Tay-Sachs only found in Ashkenazi Jews.
In the meantime:
quote:Genetic Testing and Genetic Screening
When social groupings with a strong endogamous tradition (such as ethnic or racial groups) intermarry for centuries, they are at higher risk for pairing recessive genes and passing on a genetic disorder. In the United States, the best knowns of these clustered autosomal recessive disorders are Tay-Sachs disease, beta-thalassemia, sickle-cell anemia, and cystic fibrosis. For Tay-Sachs, concentrated primarily among Ashkenazi Jews of northern and eastern European ancestry, about one in thirty is a carrier, and approximately one in every 3,000 newborns will have the disorder. For cystic fibrosis, about one in thirty Americans of European descent is a carrier, with a similar incidence rate. In contrast, approximately one in every 12 American blacks is a carrier for sickle-cell anemia and one in every 625 black newborns will have the disorder. Irish and northern Europeans are at greater risk for phenylketonuria. In the United States, one in 60 Caucasians is a carrier, and about one in every 12,000 newborn Caucasians is affected (Detailed information on the Incidence of Genetic Disorders can be found in Burhansstipanov et al. 1987, p. 6-7).
When both parents are carriers of the autosomal recessive gene, the probability that each live birth will be affected by the disorder is 25 percent. However, being a carrier, or passing on the gene so that one's offspring is also a carrier, typically poses no more of a health threat than carrying a recessive gene for a different eye color. That is, carrier status typically poses no health threat at all. The health rationale behind carrier screening is to inform prospective parents about their chances of having a child with a genetic disorder.
In the United States, the two most widespread genetic screening programs for carriers have been for Jews of northern European descent (Tay-Sachs) and for Americans of western African descent (sickle-cell anemia). From 1972 to 1985, there was widespread prenatal screening for both disorders, and by 1988, newborn screening for sickle-cell anemia had become common (Duster 1990). It is the autosomal recessive disorders, located in risk populations that coincide with ethnicity and race, that are of special interest as we turn to address genetic screening for populations that are at greatest risk for a disorder.
It is important to distinguish between a genetic screen and a genetic test. A genetic test is done when there is reason to believe that a particular individual is at high risk for having a genetic disorder, or for being a carrier of a gene (recessive) for a disorder. So for example, a sibling of someone who has been diagnosed with Huntington's (a late-onset neurological disorder) would be a candidate for a genetic test for that disorder. A genetic screen, on the other hand, is used for a population that is at higher risk for a genetic disorder. Thus, with the risk figures cited above, Ashkenazi Jews were the subjects of genetic screening for Tay-Sachs.
quote:Originally posted by lamin: To Arwa: Re "race" and disease, then what about Tay Sach's disease--found only among the Ashkenazi clinal subset of Europeans? Has this disease ever been diagnosed among generic Africans or South Asians or East Asians?
Are you saying Ashkenazi Jews are a race?
If you could find a desease that only effected Ashkenazi Jews you would have two groups
Ashkenazi in group one.
And non Ashkenazi in group two.
Group two would include Africans, Asians, Europeans and non Ashkenazi Jews.
If the basis of your race grouping is 'said disease' then you may not place Ashkenazi in a race group [subset] with people who don't have this disease.
If 'some' have it, and some don't - this would then be non-concordant to race-typology, therefore yet again *contradicting* race.
It would be like claiming skin color is racial, the grouping certain blacks in the race catagory of "whites who are black", technically falsifying the original premise.
You can't have it both ways Lamin.
You can't claim a disease is racial - then assign it to only 'subset' of a so called 'race'.
Lack of prescence of assigned trait in all members of the claimed race-group is the only possible method of falsification.
A theory with no intrinsic method of falsification is not valid, and race is notorious for producing pseudo-scientific theories rooted in cicular reasoning and so, impossible to falsify.
Posts: 15202 | Registered: Jun 2004
| IP: Logged |
posted
To Arwa: You used the word "race", I did not. But here's something for you. Suppose you were a physician and you were required to prescreen pregnant mothers for genes possibly destructive to their fetus's life chances, and your patients had limited financial resources to run the required batteries of genome tests, would you test all your patients for the Tay Sach's cluster of gene(s) or just those of Eastern European Ashkenazi background?
Re "concordance": what the dialogue shows is that while it may be necessary to be Ashkenazi to be "Tay-Sachs" prone(probability), it will not be sufficient. But that in itself constitute no grounds not to test.
Posts: 5492 | Registered: Nov 2004
| IP: Logged |
Absolutely not! This is no better than those who favoured eugenics in Nazi Germany. They were also saying it was to help people. If you allow this to happened, then you automatically permit to screen test every Black person who enters in the UK for AIDS, TB and other diseases, because that is what the Conservative party wants to legislate. You are opening the Pandora's box, if you allow this to happen.
Posts: 2198 | Registered: Jun 2006
| IP: Logged |
posted
To Arwa, You may be right and just don't know what to think given the correctness of Bayesian probability statistics in things like quality control testing--as in new drugs for the marketplace, testing for Down's syndrome for pregnant womem over the age of 40--if they are in the "woman's right to choose" group, etc.
There are reliable tests and there are bogus, ideologically motivated tests--as in the case hysterical claims about AIDS in Africa. There is a whole literature on charlatan medical claims. I am talking about genuine humanistic Bayesian approaches to human genetics.
I am a bit unclear on this: where do we go wrong when we look ONLY at the genome profiles and at the Y and MtDNA haplotypes of 2 sets of familes and conclude that one family is North East Asian with 99% probability and the other Southwest African with a 99% probability?
And when biologists classify flora and fauna cladistically and taxonomically where exactly do they go wrong when they transfer the same approach to humans?
Posts: 5492 | Registered: Nov 2004
| IP: Logged |
quote:And when biologists classify flora and fauna cladistically and taxonomically where exactly do they go wrong when they transfer the same approach to humans?
Actually you have it backwards Lamin.
Biologist do classify humans cladistically as species homo-sapiens.
They simply don't classify homo-sapiens into sub-species or race.
Most species, like humans in fact do *not* classify into sub-species.
The reason humans do not classify into sub-species is because human beings are a recent species that has constantly interbred.
In most situations where there are sub-species there is breeding isolation typically on the order of 100's of thousand to millions of years, and even then the sub-species status is transient and usually a precursor to speciation.
That's why most species have no sub-species.
The original theory dividing humans into taxonomically defined races was based precisely on the premise of "ancient isolation" and separation of human populations on the order of millions of years.
For example 1 theory held that Europeans were descendant of Chimpanzees's, Africans of Gorillas and Asians of Orangataun.
The reason that this notion isn't reflected in current biological texts is simply that it has proven to be wrong.
Thus there are no taxon for humans beneath species level.
So Lamin the real question is -> Are *you saying* biologists are wrong?
If you are saying that biologists are wrong, then can you tell us why?
Also give us your list of the appropriate sub-species of human beings, in your view. (?)
posted
People mistake the .01% observed overall genetic variation in Humans to imply "races". As such, this biologically insensible viewpoint grasps on lack of understanding of phenomena, for instance, 'variation' in the number of "copies" of certain genes, and the higher incidence of certain naturally selected genes and their subsequent flow between spatially separated populations, mutations in genes that regulate melanin content and so forth, which have no bearings on the overall integrity of humans as a single species. As mentioned time and again, even chimpanzees that look visibly similar in phenotype from a single chimp population, actually show greater genetic variation than humans from the same population.
Posts: 5964 | Registered: Jan 2005
| IP: Logged |
"There is more and more hard genetic evidence that all of humanity has evolved as a single unit, with regional variations, but that's all they are, slight variations," said Templeton. "A race has to be a sharply defined, geographically circumscribed population that represents an isolated or nearly isolated lineage within the species. There's nothing at all like that in humanity. In terms of the living world, it's really hard to find a species so genetically homogeneous across its populations as humans."Posts: 15202 | Registered: Jun 2004
| IP: Logged |
quote:Originally posted by Lord of the Nile: Go suck on some sleeping pills and go to bed old man.
You are the only insomaniac in North America yet to hear of race. You and your Egyptsearch merrymen are living in some dream world.
Sweet dreams!
Lord
Shut up and quit trolling, anyone can see that Clyde posted no evidence to back his claims, why don't you try reading the stuy for yoursel and see.
Posts: 2595 | From: Vicksburg | Registered: Feb 2006
| IP: Logged |
The multitude of subjective and non-uniform socio-ethnic constructs across the globe, is the actual figment of humans, which has no bearings on biological realities that result in say, this...
^...these are the sort of natural world realities that science recognizes and makes note of, and one which transcends the cultural social constructs of the human world.
It is simple: in science, falsifiable material is presented, and such, it is up to those who wish to challenge the matter at hand, to rise to the occasion. It doesn't boil down to the idea of what one culture has to say [or describe] about this or that matter; one either has the goods to make a case contrary to that of the status quo, or one doesn't.
Posts: 5964 | Registered: Jan 2005
| IP: Logged |
Lessons from History: Why Race and Ethnicity Have Played a Major Role in Biomedical Research By Troy Duster Ph.D., The Journal of Law, Medicine & Ethics
quote:A recent paper entitled “Whole Genome Patterns of Common DNA Variation in Three Diverse Human Populations,” which emanated from the HapMap project, demonstrates the problem.11 This paper is well-intentioned, well-crafted, and designed to help understand health differences among human population groups.The researchers were searching for, and found, patterns of SNPs differentially distributed in three population groups, formed from a total of seventy-one persons who were Americans of African descent, Americans of European descent, or Han Chinese.
However, what makes these three populations diverse is the phenotype associated with a racial classification system – not a genotypic pattern of similarity that triggered the inquiry. Indeed, the authors note that the SNP patterns of genetic diversity that they found among African-Americans suggest more diversity than that in the other two populations – a finding consistent with our knowledge of genetic diversity on the African continent. So why was the question of genetic variation raised using these racial and ethnic categories? The answer is a scientific Catch-22. The main reason is convenience: the data were originally collected and marked that way in the Coriell Cell Repositories. That is an understandable rationale. However, by deploying these pre-existing categories, any differences that emerge are likely to be “racialized” – no matter how many caveats and demurrers appear in the text of a scientific paper. Moreover, the African-American group is said to be “admixed.” But, in terms of genotype, all three groups are “admixed.” So it must actually be the phenotype to which the authors refer with the designation of “three diverse populations.”
quote: The scientists looked at people from three broad racial groups - African, Asian and European. Although there was an underlying similarity in terms of how common it was for genes to be copied, there were enough racial differences to assign every person bar one to their correct ethnic origin. This might help forensic scientists wishing to know more about the race of a suspect.
Use of forensic science in crime investigation, please read following article:
Thank you Dr Clyde Winters. That was a great article you posted. Your analysis is impecable. Only dreamers live in a raceless world!
Thanks for your support. I could present more articles by geneticists who claim that race exist in science and biology but we have already discussed this matter and I will not continue this discussion here.
All I have said is that scientist accept the fact that race exist. Even in the abstract of the article by Dr. Duster posted by Arwa, Dr. Duster admits:
quote:
Before any citizen enters the role of scientist, medical practitioner, lawyer, epidemiologist, and so on, each and all grow up in a society in which the categories of human differentiation are folk categories that organize perceptions, relations, and behavior. That was true during slavery, during Reconstruction, the eugenics period, the two World Wars, and is no less true today. While every period understandably claims to transcend those categories, medicine, law, and science are profoundly and demonstrably influenced by the embedded folk notions of race and ethnicity.
If race has always been a part of the normal discourse in science why is it that the members of this forum are attacking anyone who admits the obvious, and these say people even claim that race does not exist when the scientist make it clear that it does like the scientist of the study under discussion in this thread.
To understand this phenomena we have to look into the fields of sociology and political science to understand the desire on the part of many African Americans who are members of the "bourgeois" to deny the existence of race.
This begs the question : "Was race ever absent in genetics"? It is interesting that many members of the Black "bourgeois" claim that race is being re-introduced to genetics or science generally. The evidence is clear that it has always been a part of genetics, especially in relation to forensic sciences and medical sciences. Moreover, the brother on the street has never believed that "race" science or social customs that support the concept of races has ever disappeared in the public discourse. Granted many professional anthropologists and geneticists have tried to push race in the background, yet these researchers have never claimed that race did not exist in science, they just prayed it would be pushed aside and all people would be looked upon as "human beings".
This has long been the dream of minorities and especially the "Black establishment intellegensia" and "bourgeois" since the 1920's. Everytime these Blacks have been allowed to "associate" with whites freely, they build up this imagined reality of a race neutral society. And as is the case, this "dream"-- fantasy is smashed to smithereens as the "race card" has a resurgence. These Blacks continue this "race neutral" rhectoric until it smacks them in the face.
I am sorry to tell you this but no matter how you seek to hide in your "bourgeois" imaginations race will always rise its head up in science because race(s) exist.
You guys can attack me as long as you wish. It is the geneticists at 13 leading research institutions that maintain that RACE EXIST.
Here you cowardly attack the reporters of the message, instead of the Messengers of race. In this case leading geneticist from 13 research institutions. Instead of writing disparaging statements about Lord and I, you should be trying to form committees to write letters to the journals who published this study, and the newspapers and other media that publicized it .
But alas, this would be too "manly" and you might feel jeopardize your job or standing with your non-Black/African friends. Instead , you find articles written by other "bourgeois" Blacks praying that the idea of race in science will disappear like Duster--who at least has the forthrightness to admit that the view is pervasive among many scientists.
But like most cowardly Negroes, you attack another Afro-American, instead of standing up like a man and voicing your concern in the media. Shame on you.
There are just under 30,000 genes in the human genome, which consists of about 3 billion "letters" of the DNA code. The scientists found that more than 10 per cent of these genes appear to be multiplied in the 270 people who took part in the study. They do not know why some genes are copied and some are not. One gene, called CCL3L1, which is copied many times in people of African descent, appears to confer resistance to HIV. Another gene involved in making a blood protein is copied many times in people from south-east Asia and seems to help against malaria. Other research has shown that variation in the number of copies of some genes is involved in Alzheimer's and Parkinson's disease.
Are there any other practical applications?
The scientists looked at people from three broad racial groups - African, Asian and European. Although there was an underlying similarity in terms of how common it was for genes to be copied, there were enough racial differences to assign every person bar one to their correct ethnic origin. This might help forensic scientists wishing to know more about the race of a suspect.
Who made the discovery and where can we read more about it?
Scientists from 13 research centres were involved, including Britain's Sanger Institute in Cambridge, which also took a lead role in deciphering the human genome. The research is published in Nature, Nature Genetics and Genome Research.
quote:Originally posted by rasol: No they do not. The populations were separated into 4 distinct ethnic groups beforehand.
Concievably you could separate out 4 populations in Nigeria, or in Utah for that matter and still produce 4 distinct, Nigerian, or Utah clusters.
Would that prove the existence of 4 Nigeria races, or 4 Utah races, or 4 Chinese races? No.
Nor do the authors claim otherwise.
The only one claiming the study validates race, is you.
quote:Originally posted by Calypso:
Dr. Winters wrote: "Because these geneticists claim they can differiate people into racial categories based on biological differences."
So what? The factors underlying the criteria used to separate the individuals into groups in the first place (probably hair texture, skin color, etc.,)are also biological. How does that prove the reality of races? No one has ever contended that there are no regional differences among people.
Poor Winters and his fanfare just don't (won't) get it.
So, by the studies I suppose all 'Asians' are of the same race. Black Asian Dravidians of India are the same race as Siberians and Japanese. But I forgot all those blacks of India are (according to you) descended from African Saharan Manding! LOLAnd What about Europeans? Is not Europe a part of greater Asia hence the geologically correct term Eurasia?
You of course failed to answer any of Rasol's questions because you cannot. Biological 'race' does not exist plain and simple!
Posts: 26267 | From: Atlanta, Georgia, USA | Registered: Feb 2005
| IP: Logged |
posted
When the word race was used in the GENETIC BREAKTHROUGH article, who was using it? The population geneticists or the journalist who wrote the article?
I see population geneticists talking about geographic populations.
I see a journalist dumbing it down writing about races.
James Lupski uses "human genetics." Matthew Hurles uses "genetic differences." Stephen Scherer, Charles Lee, Mark Walport, Nigel Carter, none of them are quoted using the word race.
Steve Connors, journalist, is the one who took the three regional identifiers, African, Asian, and European, and inferred the involvement of races rather than geographical populations.
We need be careful when attributing words to a source. Does the source indeed use the word or concepts we ascribe to them?
Posts: 8014 | From: the Tekrur in the Western Sahel | Registered: Feb 2006
| IP: Logged |
posted
^^Excellent observation, Takruri! Of course, the individual who cited the source obviously missed this and in his frantic emotional rush to cite it (mis-cite it), he did not realize that the scientists never made the claim nor used the term 'races'!!
I wonder what Clyde will say now. He might as well go back to his rantings on Saharan Dravidians and Mandingo Olmecs.
Posts: 26267 | From: Atlanta, Georgia, USA | Registered: Feb 2005
| IP: Logged |
quote:I am sorry to tell you this but no matter how you seek to hide in your "bourgeois" imaginations race will always rise its head up in science because race(s) exist.
you confuse the word race with racism. If race excists in science, don't you think every child in this world would know where the gene of race is found on which chromosome?
Posts: 2198 | Registered: Jun 2006
| IP: Logged |
posted
^LOL Deep down Clyde knows this, but is desperate to deny it!
He knows no recent and most of all accurate scientific study supports the notion of 'race' and for the very reason that it debunks his own nonsense claims that Dravidian blacks of India are NOT recently descended from Africa let alone have any links with West African Mandingos, and that the Olmecs of Central America despite having features like broad noses and lips are NOT of West African descent as well since neither populations carries recent African ancestry!!
He knows that in racial typology this man below is 'negroid'...
..even though he and his people are the most genetically distant in relation to Africans despite their very black very 'African' appearances.
Whereas a blonde hair, blue-eyed Nordic European who carries E3b is closely related to Africans.
Thus genetics has blown 'racial' typology up into smoke, so now people like Clyde and Evil-Euro can do nothing but desperately breathe in that smoke only to choke on it. Posts: 26267 | From: Atlanta, Georgia, USA | Registered: Feb 2005
| IP: Logged |
What is your genetic classification? I asked because as I was walking down the street today I met two E3B guy one from the Philipines and the other from Algeria who were ranting about how some phenotypically black individuals were planning to undermine the genetic integrity of the R1a and R1b categories....
What a dumbo...the E3B guys.
Tehehe
Lord
Posts: 83 | From: Quebec, Canada | Registered: Feb 2006
| IP: Logged |
quote:Originally posted by alTakruri: When the word race was used in the GENETIC BREAKTHROUGH article, who was using it? The population geneticists or the journalist who wrote the article?
I see population geneticists talking about geographic populations.
I see a journalist dumbing it down writing about races.
James Lupski uses "human genetics." Matthew Hurles uses "genetic differences." Stephen Scherer, Charles Lee, Mark Walport, Nigel Carter, none of them are quoted using the word race.
Steve Connors, journalist, is the one who took the three regional identifiers, African, Asian, and European, and inferred the involvement of races rather than geographical populations.
We need be careful when attributing words to a source. Does the source indeed use the word or concepts we ascribe to them?
Anyone who isn't as dumb as Winters needs them to be would realise that in this entire thread - not a single sentense in support of race has been atributed to any biologist.
Meanwhile Alan Templeton, Shomarka Keita, Spencer Wells, Rick Kittles and Nina Jablonsky have all been quoted directly and in opposition to race-typologies.
Actual comments from these scholars go unaddressed by Winters, because he has no idea of how to respond.
That's why he spams instead of addressing the citations or answering the questions.
It adds up....
Another boring pointless fiasco of a thread by Winters.
Posts: 15202 | Registered: Jun 2004
| IP: Logged |
Actual comments from these scholars go unaddressed by Winters, because he has no idea of how to respond...
Funny. I find it interesting that Clyde thinks that people who confront his claims are behaving "cowardly", while his "unaddressing" of what he was requested to address, speaks of a "manly" behavior. Posts: 5964 | Registered: Jan 2005
| IP: Logged |
posted
Dr. George Gill (and Jaime Stuart) Does Race Exist? A proponent's perspective by George W. Gill Slightly over half of all biological/physical anthropologists today believe in the traditional view that human races are biologically valid and real. Furthermore, they tend to see nothing wrong in defining and naming the different populations of Homo sapiens. The other half of the biological anthropology community believes either that the traditional racial categories for humankind are arbitrary and meaningless, or that at a minimum there are better ways to look at human variation than through the "racial lens."
Are there differences in the research concentrations of these two groups of experts? Yes, most decidedly there are. As pointed out in a recent 2000 edition of a popular physical anthropology textbook, forensic anthropologists (those who do skeletal identification for law-enforcement agencies) are overwhelmingly in support of the idea of the basic biological reality of human races, and yet those who work with blood-group data, for instance, tend to reject the biological reality of racial categories.
Where does George Gill stand in the "great race debate?" Read on. I happen to be one of those very few forensic physical anthropologists who actually does research on the particular traits used today in forensic racial identification (i.e., "assessing ancestry," as it is generally termed today). Partly this is because for more than a decade now U.S. national and regional forensic anthropology organizations have deemed it necessary to quantitatively test both traditional and new methods for accuracy in legal cases. I volunteered for this task of testing methods and developing new methods in the late 1980s. What have I found? Where do I now stand in the "great race debate?" Can I see truth on one side or the other—or on both sides—in this argument?
Findings First, I have found that forensic anthropologists attain a high degree of accuracy in determining geographic racial affinities (white, black, American Indian, etc.) by utilizing both new and traditional methods of bone analysis. Many well-conducted studies were reported in the late 1980s and 1990s that test methods objectively for percentage of correct placement. Numerous individual methods involving midfacial measurements, femur traits, and so on are over 80 percent accurate alone, and in combination produce very high levels of accuracy. No forensic anthropologist would make a racial assessment based upon just one of these methods, but in combination they can make very reliable assessments, just as in determining sex or age. In other words, multiple criteria are the key to success in all of these determinations.
While he doesn't believe in socially stipulated "age" categories, Gill says, he can "age" skeletions with great accuracy. I have a respected colleague, the skeletal biologist C. Loring Brace, who is as skilled as any of the leading forensic anthropologists at assessing ancestry from bones, yet he does not subscribe to the concept of race. [Read Brace's position on the concept of race.] Neither does Norman Sauer, a board-certified forensic anthropologist. My students ask, "How can this be? They can identify skeletons as to racial origins but do not believe in race!" My answer is that we can often function within systems that we do not believe in.
As a middle-aged male, for example, I am not so sure that I believe any longer in the chronological "age" categories that many of my colleagues in skeletal biology use. Certainly parts of the skeletons of some 45-year-old people look older than corresponding portions of the skeletons of some 55-year-olds. If, however, law enforcement calls upon me to provide "age" on a skeleton, I can provide an answer that will be proven sufficiently accurate should the decedent eventually be identified. I may not believe in society's "age" categories, but I can be very effective at "aging" skeletons. The next question, of course, is how "real" is age biologically? My answer is that if one can use biological criteria to assess age with reasonable accuracy, then age has some basis in biological reality even if the particular "social construct" that defines its limits might be imperfect. I find this true not only for age and stature estimations but for sex and race identification.
"I am more accurate at assessing race from skeletal remains that from looking at living people standing before me," Gill says. The "reality of race" therefore depends more on the definition of reality than on the definition of race. If we choose to accept the system of racial taxonomy that physical anthropologists have traditionally established—major races: black, white, etc.—then one can classify human skeletons within it just as well as one can living humans. The bony traits of the nose, mouth, femur, and cranium are just as revealing to a good osteologist as skin color, hair form, nose form, and lips to the perceptive observer of living humanity. I have been able to prove to myself over the years, in actual legal cases, that I am more accurate at assessing race from skeletal remains than from looking at living people standing before me. So those of us in forensic anthropology know that the skeleton reflects race, whether "real" or not, just as well if not better than superficial soft tissue does. The idea that race is "only skin deep" is simply not true, as any experienced forensic anthropologist will affirm.
Position on race Where I stand today in the "great race debate" after a decade and a half of pertinent skeletal research is clearly more on the side of the reality of race than on the "race denial" side. Yet I do see why many other physical anthropologists are able to ignore or deny the race concept. Blood-factor analysis, for instance, shows many traits that cut across racial boundaries in a purely clinal fashion with very few if any "breaks" along racial boundaries. (A cline is a gradient of change, such as from people with a high frequency of blue eyes, as in Scandinavia, to people with a high frequency of brown eyes, as in Africa.)
"Clines" represent gradients of change, such as that between areas where most people have blue eyes and areas in which brown eyes predominate. Morphological characteristics, however, like skin color, hair form, bone traits, eyes, and lips tend to follow geographic boundaries coinciding often with climatic zones. This is not surprising since the selective forces of climate are probably the primary forces of nature that have shaped human races with regard not only to skin color and hair form but also the underlying bony structures of the nose, cheekbones, etc. (For example, more prominent noses humidify air better.) As far as we know, blood-factor frequencies are not shaped by these same climatic factors.
So, serologists who work largely with blood factors will tend to see human variation as clinal and races as not a valid construct, while skeletal biologists, particularly forensic anthropologists, will see races as biologically real. The common person on the street who sees only a person's skin color, hair form, and face shape will also tend to see races as biologically real. They are not incorrect. Their perspective is just different from that of the serologist.
So, yes, I see truth on both sides of the race argument.
Those who believe that the concept of race is valid do not discredit the notion of clines, however. Yet those with the clinal perspective who believe that races are not real do try to discredit the evidence of skeletal biology. Why this bias from the "race denial" faction? This bias seems to stem largely from socio-political motivation and not science at all. For the time being at least, the people in "race denial" are in "reality denial" as well. Their motivation (a positive one) is that they have come to believe that the race concept is socially dangerous. In other words, they have convinced themselves that race promotes racism. Therefore, they have pushed the politically correct agenda that human races are not biologically real, no matter what the evidence.
Consequently, at the beginning of the 21st century, even as a majority of biological anthropologists favor the reality of the race perspective, not one introductory textbook of physical anthropology even presents that perspective as a possibility. In a case as flagrant as this, we are not dealing with science but rather with blatant, politically motivated censorship. But, you may ask, are the politically correct actually correct? Is there a relationship between thinking about race and racism?
Does discussing the concept of race promote racism? Race and racism Does discussing human variation in a framework of racial biology promote or reduce racism? This is an important question, but one that does not have a simple answer. Most social scientists over the past decade have convinced themselves that it runs the risk of promoting racism in certain quarters. Anthropologists of the 1950s, 1960s, and early 1970s, on the other hand, believed that they were combating racism by openly discussing race and by teaching courses on human races and racism. Which approach has worked best? What do the intellectuals among racial minorities believe? How do students react and respond?
Three years ago, I served on a NOVA-sponsored panel in New York, in which panelists debated the topic "Is There Such a Thing as Race?" Six of us sat on the panel, three proponents of the race concept and three antagonists. All had authored books or papers on race. Loring Brace and I were the two anthropologists "facing off" in the debate. The ethnic composition of the panel was three white and three black scholars. As our conversations developed, I was struck by how similar many of my concerns regarding racism were to those of my two black teammates. Although recognizing that embracing the race concept can have risks attached, we were (and are) more fearful of the form of racism likely to emerge if race is denied and dialogue about it lessened. We fear that the social taboo about the subject of race has served to suppress open discussion about a very important subject in need of dispassionate debate. One of my teammates, an affirmative-action lawyer, is afraid that a denial that races exist also serves to encourage a denial that racism exists. He asks, "How can we combat racism if no one is willing to talk about race?"
"How can we combat racism," asks an affirmative-action lawyer, "if no one is willing to talk about race?" Who will benefit? In my experience, minority students almost invariably have been the strongest supporters of a "racial perspective" on human variation in the classroom. The first-ever black student in my human variation class several years ago came to me at the end of the course and said, "Dr. Gill, I really want to thank you for changing my life with this course." He went on to explain that, "My whole life I have wondered about why I am black, and if that is good or bad. Now I know the reasons why I am the way I am and that these traits are useful and good."
A human-variation course with another perspective would probably have accomplished the same for this student if he had ever noticed it. The truth is, innocuous contemporary human-variation classes with their politically correct titles and course descriptions do not attract the attention of minorities or those other students who could most benefit. Furthermore, the politically correct "race denial" perspective in society as a whole suppresses dialogue, allowing ignorance to replace knowledge and suspicion to replace familiarity. This encourages ethnocentrism and racism more than it discourages it.
Dr. George W. Gill is a professor of anthropology at the University of Wyoming. He also serves as the forensic anthropologist for Wyoming law-enforcement agencies and the Wyoming State Crime Laboratory.
Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
Dr. George Gill (and Jaime Stuart) Does Race Exist? A proponent's perspective by George W. Gill
Slightly over half of all biological/physical anthropologists today believe in the traditional view that human races are biologically valid and real....
This would be a distortion of reality by George Gill, if this claim is attributed to him, because we've already cited geneticists and bio-anthropologists, and indeed the AAA, who have made it clear that they don't see the validity of "social constructs" of human "races" in science. Are you calling these experts, at their own very words, liars? If not, then is Geogre Gill correct to characterize and generalize as he did? If yes, what is George Gill's basis for this; reading the minds of bio-anthropologists, when they haven't actually said anything of the sort to him? If you have no answers to these questions, then case is dismissed!
Posts: 5964 | Registered: Jan 2005
| IP: Logged |
quote: I have been able to prove to myself over the years, in actual legal cases, that I am more accurate at assessing race from skeletal remains than from looking at living people standing before me.
A physical anthropologists who believes in the fundamental division of human beings into races yet admits that he cannot look at a living person and accurately determine their race!!! Do the dead have more definite racial affiliations than do the living?
Posts: 1038 | From: Franklin Park, NJ | Registered: Aug 2005
| IP: Logged |
posted
In fact, how many "races" does George Gill propose there are; what are the basis of these "races" other than mere "physical" resemblances?
It seems to me that George Gill is defending the "concept" of races, because apparently as a "Forensic" anthropologist, that is what he is expected to do. The pressure of the job to seek divisions and characterize people based on unscientific 'socially' constructed as opposed to biologically authenticated 'races', warrants him to defend the said social constructs. There is a difference between human 'races' being a real 'social construct' and being a 'real' biological phenomenon.
Posts: 5964 | Registered: Jan 2005
| IP: Logged |
It seems to me that George Gill is defending the "concept" of races, because apparently as a "Forensic" anthropologist, that is what he is expected to do. The pressure of the job to seek divisions and characterize people based on unscientific 'socially' constructed as opposed to biologically authenticated 'races', warrants him to defend the said social constructs. There is a difference between human 'races' being a real 'social construct' and being a 'real' biological phenomenon.
Here you are going too far. Other physical anthropologist outside of forensics can also determine race scientifically and not as a social construct. http://www.kacike.org/MartinezEnglish.html
The Use of Mitochondrial DNA to Discover Pre-Columbian Migrations to the Caribbean: Results for Puerto Rico and Expectations for the Dominican Republic
Dr. Juan C. Martínez Cruzado
A slide show, for use with Internet Explorer, accompanies this paper PDF Version for printing 360 KB
In this study, we use Mitochrondrial DNA technology (mtDNA) to improve our understanding of the pre-Columbian migrations to the Antilles that gave rise to the Taínos. As a basis for our work, we need to review various studies, principally of the archaeological type, that have given us knowledge of the pre-Columbian migrations to the Greater Antilles. [1]
It is known that more than 8,000 years ago the Greater Antilles were inhabited by nomads who depended for their survival upon the foods that they could collect and the animals that they could hunt. That era is known as the Lithic Era, which is distinguished by the stone tools that these people made. [2]
Some 4,000 years later, we begin to note a great quantity of tools and adornments made of shells and some made of bone. That era is known as the Archaic Era, populated by nomads who appear to have subsisted principally on seafoods, but who also ate terrestrial products. It was not until some 2,200 years ago that a ceramic culture arrived in the Greater Antilles, consisting of agriculturalists who built permanent settlements near their areas of cultivation. [3]
Little is known about the migrations from which the nomads originated, better known as the pre-ceramic culture. Three routes have been identified by which there could have been migratory waves to the Greater Antilles: proceeding from the Florida Peninsula by means of Cuba, proceeding from the Yucatan Peninsula also by means of Cuba, and proceeding from the Orinoco Delta by means of the Lesser Antilles. Dental studies done by Dr. Edwin Crespo, as in other studies, suggest that there were at least two migratory waves to the Greater Antilles. For this reason, confirmation of the use of the routes does not necessarily indicate that the other routes were not also used. [4]
Distinct ceramic cultures existed in the Greater Antilles. Even before the time of Christ, on the island of Vieques, there already existed a Huecoid culture and Saladoid culture, clearly distinguishable by their ceramics, but also through other cultural aspects. For example, while the burials of the Saladoids can be found relatively easily, the remains of Huecoid bones have never been found. All that has been found is one milk tooth. For this reason, it is believed that the religions of both cultures could have contained very different elements. Furthermore the Huecoids were specialists in working with semi-precious stones, which they frequently sculpted in the form of animals. Among them the figure of a bird stands out that many have identified as the Andean condor, for which reason they attach a continental origin to this region. Deposits with ceramic elements very similar to those of the Huecoids have been found near the mouth of the Guapo River in Venezuela. From there they would have taken the maritime route eastward toward Puerto Rico, Vieques, and other islands in the Northeastern Caribbean. The Saladoids, on the other hand, migrated from the region of Saladero near the mouth of the Orinoco River by means of the Lesser Antilles until they arrived in the Greater Antilles. [5]
The Huecoid culture lasted some few hundred years, but the Saladoid culture, evolving with time, lasted until approximately the year A.D. 600. Certain evidence has been found in Puerto Rico that suggests great, natural events of a catastrophic nature that could have put an end to the Saladoid culture. What is certain is that a clearly distinct culture developed beginning from that date, the Ostionoid, which is divided into two stages known as pre-Taíno and Taíno. We do not know if the Ostionoid culture represents a marked cultural change of the Saladoid culture people due to the natural catastrophic events or some other type of event, or if it represents the arrival of a new migratory wave of Southamerican origin. [6]
In conclusion, the archaeological evidence can identify four pre-Columbian migrations to the Greater Antilles: two pre-ceramic and two ceramic. The actual number of pre-Columbian migrations very well might have been only four, but there could have been many more. [7]
We will see now what the mtDNA that we can extract from the contemporary inhabitants of the Major Antilles could offer us. The vast majority of our genetic material, perhaps better known as DNA, is found in the nucleus of the cell. The mtDNA, however, is not located in the nucleus of the cell but in an organelle known as the mitochondria. While nuclear DNA is inherited in equal parts from one’s father and mother, mtDNA is inherited only from one’s mother. It does not mix with that of the father and for that reason remains intact generation after generation, thus maintaining its original identity. That is to say, despite the intensive mestizaje (genetic “mixture”) that has characterized our region over the centuries, we Caribbeans have mtDNAs that have maintained their original identity and that can be identified as African, Indian, or Caucasian . Their identity depends upon the women in our genetic tree at the end of the strictly maternal ancestral line. If this great-great-great grandmother were indigenous, then the corresponding Caribbean would have an indigenous mtDNA. He or she would have inherited it intact from that great-great-great grandmother who lived through those terrible first years of the colonization by means of his or her great-great grandmothers, great grandmothers, and maternal grandmother. [8]
In addition to the geneticists at the 13 research institutes that found races can be determined biologically; other geneticists through their research have also determined the race of individuals based on genes.
Tang H, Quertermous T, Rodriguez B, Kardia SL, Zhu X, Brown A, Pankow JS, Province MA, Hunt SC, Boerwinkle E, Schork NJ, Risch NJ.
Division of Public Health Sciences, Fred Hutchinson Cancer Research Center, Seattle, WA, USA.
We have analyzed genetic data for 326 microsatellite markers that were typed uniformly in a large multiethnic population-based sample of individuals as part of a study of the genetics of hypertension (Family Blood Pressure Program). Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic) and were recruited from 15 different geographic locales within the United States and Taiwan. Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories. Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity. On the other hand, we detected only modest genetic differentiation between different current geographic locales within each race/ethnicity group. Thus, ancient geographic ancestry, which is highly correlated with self-identified race/ethnicity--as opposed to current residence--is the major determinant of genetic structure in the U.S. population. Implications of this genetic structure for case-control association studies are discussed. In this paper Tang was using genetics to explore ancestry. Since he is using genetics to explore racial ancestry the paper is concerned with biology, not geography.
Most importantly caucasian is a racial term it is not a geographical term. Caucasians live in many different geographic regions (Europe, Auatralia, Latin America and etc.) therefore the term can only be applied to race, not geography.
.
-------------------- C. A. Winters Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
posted
Gill has already made it clear that about half the scientists believe race exist and the other half belive race does not exist. The biology literature is full of reference to race.
Race From Wikipedia, the free encyclopedia Jump to: navigation, search This article may benefit form being shortened by the use of summary style. Summary style moves large sections to sub-articles that are summarized in the main article. For other uses, see Race (disambiguation). The term race distinguishes a population of humans (or non-humans) from other populations. The most widely used human racial categories are based on visible traits (especially skin color and facial features), genes, and self-identification. Conceptions of race, as well as specific racial groupings, vary by culture and over time and are often controversial, for scientific reasons as well as their impact on social identity and identity politics. Legal definitions, common usage, and scientific meaning can all be conflated, causing confusion and controversy.
Webster's Dictionary defines race as "a group of people of common ancestry or stock". Descent is defined as 'derivation from an ancestor'.
The term Caucasian race or Caucasian is used to refer to people whose ancestry can be traced back to Europe, North Africa, West Asia, South Asia and parts of Central Asia. It was once considered a useful taxonomical categorization of human racial groups based on a presumed common geographic and/or linguistic origin. Below are science articles where race is discussed. This makes it clear that race is part of the science discourse.
[QUOTE]
Forensic value of the multicopy Y-STR marker DYS464
John M. Butler * , Richard Schoske 1 Biotechnology Division, National Institute of Standards and Technology, Gaithersburg, MD, USA Abstract. The tetranucleotide Y-chromosome short tandem repeat (Y-STR) marker, DYS464, first reported by Redd et al. [Forensic Sci. Int. 130 (2002) 97] appears to be the most polymorphic Y-STR marker discovered to date. A single primer pair can generate up to four distinct peaks over an allele range of 9–20 repeats. Allele calls can be made based on peaks that are present (conservative approach; C-type) or a combination of alleles and peak height ratios (expanded typing method; E- type). We have observed 113 C-types and 179 E-types in 679 males from three US populations. D 2003 Elsevier B.V. All rights reserved. Keywords: Y-STR; Y-chromosome; DYS464; Multicopy loci; DNA typing 1. Introduction DYS464 occurs at least four times in the highly palindromic region near the center of the long arm of the Y-chromosome [1–3]. In forensic casework applications where the amount of typable DNA material may be limited, the use of highly polymorphic markers is advantageous in order to limit the number of markers needed to distinguish unrelated individuals. Page 2 The primers VIC-CTTTGGGCTATGCCTCAGTTT and GCCATACCTGGGTAACAGA- GAGAC produce green-labeled amplicons in the size range of 242–286 bp for DYS464 alleles 9–20, while the primers 6FAM-AGTTTACGAGCTTTGGGCTATG and GTGGCAAGATCTCATTTCTTCAA generate blue dye-labeled polymerase chain reac- tion (PCR) products that are 327–367 bp in size. PCR conditions are as previously described for the Y-STR 20plex [5]. An allelic ladder was created for DYS464 (Fig. 1), which contains all of the major alleles as well as single-base variants observed in our population study [3]. 3. Results and discussion We observed 179 expanded types with DYS464 in 679 male samples from three different US population sets: 265 African–Americans, 262 Caucasians, and 152 His- panics.
Race is a key element in biological research. Biological researchers constantly use the term caucasian in reference to individuals and human populations. Lets look at the definitions of this term: Caucasian "A caucasoid person". Caucasoid: " of the major divisions of the human species whose members characteristically have skin color ranging from very light to brown...."
These definitions make it clear that use of this term implies discussion of race or the caucasoid human species. This term is frequently used in reference to the caucasoid species in numerous biological studies. Use of this term makes it clear race exist. Below are examples from different biological research papers.
Indigenous Puerto Rico: DNA evidence upsets established history By Rick Kearns
Reprinted with permission, from Indian Country Today Posted: October 06, 2003 - 1:34pm EST by: Rick Kearns / Correspondent / Indian Country Today
History is written by the conquerors. The Native peoples of North America know this all too well, as they are still trying to bring the truth to light. Now, their long-lost Caribbean cousins are beginning the same process.
It’s an uphill battle.
Most Puerto Ricans know, or think they know, their ethnic and racial history: a blending of Taino (Indian), Spanish and African. Students of the islands’ past have read the same account for over 300 years; that the Native people, and their societies, were killed off by the Spanish invaders by the 1600s. It was always noted though, how many of the original colonists married Taino women or had Taino concubines, producing the original mestizaje (mixture) that, when blended with African, would produce Puerto Ricans.
Those first unions, according to the conventional wisdom, explain why some Puerto Ricans have "a little bit" of Native heritage. Mainly we are Spanish, we are told, with a little African blood and far-away Taino ancestry.
But the order of that sequence will have to change.
Dr. Juan Martinez Cruzado, a geneticist from the University of Puerto Rico Mayaguez who designed an island-wide DNA survey, has just released the final numbers and analysis of the project, and these results tell a different story. According to the study funded by the U.S. National Science Foundation, 61 percent of all Puerto Ricans have Amerindian mitochondrial DNA, 27 percent have African and 12 percent Caucasian. (Nuclear DNA, or the genetic material present in a gene’s nucleus, is inherited in equal parts from one’s father and mother. Mitochondrial DNA is inherited only from one’s mother and does not change or blend with other materials over time.) http://www.biomedcentral.com/1471-2350/6/30
High frequency of the IVS2-2A>G DNA sequence variation in SLC26A5, encoding the cochlear motor protein prestin, precludes its involvement in hereditary hearing loss Hsiao-Yuan Tang1 , Anping Xia1 , John S Oghalai1 , Fred A Pereira1, 2 and Raye L Alford1
Background Cochlear outer hair cells change their length in response to variations in membrane potential. This capability, called electromotility, is believed to enable the sensitivity and frequency selectivity of the mammalian cochlea. Prestin is a transmembrane protein required for electromotility. Homozygous prestin knockout mice are profoundly hearing impaired. In humans, a single nucleotide change in SLC26A5, encoding prestin, has been reported in association with hearing loss. This DNA sequence variation, IVS2-2A>G, occurs in the exon 3 splice acceptor site and is expected to abolish splicing of exon 3. Methods To further explore the relationship between hearing loss and the IVS2-2A>G transition, and assess allele frequency, genomic DNA from hearing impaired and control subjects was analyzed by DNA sequencing. SLC26A5 genomic DNA sequences from human, chimp, rat, mouse, zebrafish and fruit fly were aligned and compared for evolutionary conservation of the exon 3 splice acceptor site. Alternative splice acceptor sites within intron 2 of human SLC26A5 were sought using a splice site prediction program from the Berkeley Drosophila Genome Project. Results The IVS2-2A>G variant was found in a heterozygous state in 4 of 74 hearing impaired subjects of Hispanic, Caucasian or uncertain ethnicity and 4 of 150 Hispanic or Caucasian controls (p = 0.45). The IVS2-2A>G variant was not found in 106 subjects of Asian or African American descent. No homozygous subjects were identified (n = 330). Sequence alignment of SLC26A5 orthologs demonstrated that the A nucleotide at position IVS2-2 is invariant among several eukaryotic species. Sequence analysis also revealed five potential alternative splice acceptor sites in intron 2 of human SLC26A5.
http://www.ecacc.org.uk/default.asp?Reload=detail2.asp?itemid=92970 ECACC Releases all 5 Human Random Control (HRC) DNA (480 HRC individual DNAs) in Convenient 96 Well Panels Building on the success of the ECACC Human Random Control (HRC) DNA in genetics research (see selected publications list) ECACC has responded to customer demand and re-formatted all 480 HRC DNA samples into a more convenient 96 well format. This new development has been made possible by ECACC’s investment, during 2005, in automated liquid handling technologies. This development along with more efficient work practises has had the added benefit of substantially reducing the price of obtaining the whole 480 HRC DNA resources, bringing it within the scope of individual consumable budgets. The HRC DNA consists of authenticated, high quality purified human genomic DNA. Each of the available 480 samples is from a single individual, providing a control population of randomly selected, non-related UK Caucasian blood donors. The HRC DNA is available as a series of five panels each containing samples from 96 separate individuals in a convenient 8 x 12 well format. This is a readily available, cost effective and renewable source of standardised control DNA samples for use in a range of applications that include: • Population studies • Mutation analysis • SNP genotyping • Validation of technology • Assay development and validation • Association analysis • Comparative genomic hybridisation • Genomic DNA library construction http://www.funpecrp.com.br/gmr/year2002/vol2-1/gmr0004_full_text.htm Frequency of the hypervariable DNA loci D18S849, D3S1744, D12S1090 and D1S80 in a mixed ancestry population of Chilean blood donors M. Acuña1, H. Jorquera2, L. Cifuentes1 and L. Armanet3 1ICBM Genetic Program and 2Medical Technology School, Facultad de Medicina, Universidad de Chile, Casilla 70061, Santiago 7, Chile 3Forensic Medical Service, Santiago, Chile Corresponding author: M. Acuña E-mail: macuna@machi.med.uchile.cl Genet. Mol. Res. 1 (2): 139-146 (2002) Received April 11, 2002 Published June 27, 2002
Comparisons of D1S80 allele distribution between populations (Figure 2) using the ² test showed no significant differences between the Chilean population sample when compared with Southwestern US Hispanics and US Hispanics pooled (Zago et al., 1996; Huckenbeck et al., 1997). The research presented in this paper shows that the hypervariable DNA loci investigated are distinguishable from other Caucasian (Spanish), Black and Oriental populations, but that the D3S1744 locus is indistinguishable from the Caucasian population. All the loci studied are indistinguishable from USA Hispanic populations (Figures 2 and 3). This study provides the first database for DNA markers in low and middle socioeconomic strata in a Chilean population. The results presented indicate that the analysis of these loci may have useful applications in population genetics as well as in identity tests.
.
-------------------- C. A. Winters Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
posted
Basically, what you are saying is that scientists are trying to find genetic markers that are UNIQUE to people with "white" skin complexion. The problem here is that people with "white" skin complexion VARY in so many genetic markers, that they CANNOT be lumped together as one RACE. They DONT all descend from one SPECIES of man called WHITE. WHITE skin is PURELY a function of environment and has NOTHING to do with being European. Just like most BLACK people on the planet, like the Andamanese, some South East Asians, Indians and Papuans and Australians all have DIFFERENT genetic markers. The fact that certain populations with "white" skin have common genetic or other biological markers does NOT make white skin, black skin or any other skin color the basis of some groups being from a FUNDAMENTALLY different STOCK of humans. ALL humans descend from Africans and ALL humans were ORIGINALLY black and even BLACK people are BORN white. SKIN COLOR is not RACE and RACE is not a SPECIES or indicator of some BIOLOGICAL difference between various human populations. MOST humans share the SAME BASIC biology, meaning ALL of them are the SAME SPECIES. The variations of markers from one person to the next is NOT an indication of RACE.
Forensics is about TRENDS in a LOCAL population. Therefore, because LOCAL populations can be analyzed and craniofacial data correlated with phenotypical traits, cultural traits and other "superficial" characteristics, it is easier to identify skeletal remains from a FORENSIC perpective. HOWEVER, introduce a skeletal sample FROM OUTSIDE the SAMPLE set of the LOCAL population and you will SEE how LIMITED forensics can be. If I dropped off the skeleton of a Mongolian steppes person at the lab of a forensics expert, the ODDs that his RECONSTRUCTION would MATCH that of a Mongolian is extremely UNLIKELY. Why? Because the sample data that they use MAY or MAY not cause the skeleton to be MIS analyzed or MIS identified. But how often are you going to find the skeleton of a Mongolian in a field in Northern Oklahoma? MOST times localized sample sets, work just fine. But there are MANY cases where they wont. And in the case of a Mongolian, if that MOngolian was of DARKER skin complexion, then it is even LESS likely that the forensics reconstruction would match.
Posts: 8896 | Registered: May 2005
| IP: Logged |
quote: The fact that certain populations with "white" skin have common genetic or other biological markers does NOT make white skin, black skin or any other skin color the basis of some groups being from a FUNDAMENTALLY different STOCK of humans. ALL humans descend from Africans and ALL humans were ORIGINALLY black and even BLACK people are BORN white. SKIN COLOR is not RACE and RACE is not a SPECIES or indicator of some BIOLOGICAL difference between various human populations. MOST humans share the SAME BASIC biology, meaning ALL of them are the SAME SPECIES. The variations of markers from one person to the next is NOT an indication of RACE.
These scientists are not talking about skin color. They are talking about genes.
You are not a scientist. You are a layman. Why should anyone listen to your ranting if you have not done original/primary research disconfirming the particular findings of these scientists.
These scientist claim they have found a gene indicating the white race.
Your comments are only your opinion, unless you can cite some of your own research disputing this research. Or an article that specifically disconfirms the findings of these sicentist.
.
-------------------- C. A. Winters Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
• Genomic DNA library construction http://www.funpecrp.com.br/gmr/year2002/vol2-1/gmr0004_full_text.htm Frequency of the hypervariable DNA loci D18S849, D3S1744, D12S1090 and D1S80 in a mixed ancestry population of Chilean blood donors M. Acuña1, H. Jorquera2, L. Cifuentes1 and L. Armanet3 1ICBM Genetic Program and 2Medical Technology School, Facultad de Medicina, Universidad de Chile, Casilla 70061, Santiago 7, Chile 3Forensic Medical Service, Santiago, Chile Corresponding author: M. Acuña E-mail: macuna@machi.med.uchile.cl Genet. Mol. Res. 1 (2): 139-146 (2002) Received April 11, 2002 Published June 27, 2002
Comparisons of D1S80 allele distribution between populations (Figure 2) using the ² test showed no significant differences between the Chilean population sample when compared with Southwestern US Hispanics and US Hispanics pooled (Zago et al., 1996; Huckenbeck et al., 1997). The research presented in this paper shows that the hypervariable DNA loci investigated are distinguishable from other Caucasian (Spanish), Black and Oriental populations, but that the D3S1744 locus is indistinguishable from the Caucasian population. All the loci studied are indistinguishable from USA Hispanic populations (Figures 2 and 3). This study provides the first database for DNA markers in low and middle socioeconomic strata in a Chilean population. The results presented indicate that the analysis of these loci may have useful applications in population genetics as well as in identity tests.
Tang et al:
quote: Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic) and were recruited from 15 different geographic locales within the United States and Taiwan. Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories. Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity.
-------------------- C. A. Winters Posts: 13012 | From: Chicago | Registered: Jan 2006
| IP: Logged |
quote:The research presented in this paper shows that the hypervariable DNA loci investigated are distinguishable from other Caucasian (Spanish), Black and Oriental populations, but that the D3S1744 locus is indistinguishable from the Caucasian population. All the loci studied are indistinguishable from USA Hispanic populations (Figures 2 and 3). This study provides the first database for DNA markers in low and middle socioeconomic strata in a Chilean population. The results presented indicate that the analysis of these loci may have useful applications in population genetics as well as in identity tests.
This study shows allelic frequencies variation in a Chilean population. It is a X^2 test.
Posts: 2198 | Registered: Jun 2006
| IP: Logged |
posted
Tang et al noted that genetics can differiate the races:
quote: Subjects identified themselves as belonging to one of four major racial/ethnic groups (white, African American, East Asian, and Hispanic) and were recruited from 15 different geographic locales within the United States and Taiwan. Genetic cluster analysis of the microsatellite markers produced four major clusters, which showed near-perfect correspondence with the four self-reported race/ethnicity categories. Of 3,636 subjects of varying race/ethnicity, only 5 (0.14%) showed genetic cluster membership different from their self-identified race/ethnicity.
This finding is supported by Redon et al in their Nature study who note that:
quote:
In contrast to other classes of human genetic variation, the population genetics of copy number variation remains unexplored. The distribution of copy number variation within and among different populations is shaped by mutation, selection and demographic history. A range of polymorphisms, including SNPs25, microsatellites59 and Alu insertion variants60, has been used to investigate population structure. To demonstrate the utility of copy number variation genotypes for population genetic inference we performed population clustering61 on 67 genotyped biallelic CNVs. We obtained the optimal clustering with the assumption of three ancestral populations, with the African, European and Asian populations clearly differentiated (Fig. 7). Population differentiation of individual variants is commonly estimated by the statistic FST, which varies from 0 (undifferentiated) to 1 (population-specific)62. The average FST for the same 67 autosomal CNVs was 0.11, very similar to that observed for all autosomal Phase I HapMap SNPs (0.13)25.
posted
Dr. Winters highlighted this portion of study cited:
quote:That is to say, despite the intensive mestizaje (genetic “mixture”) that has characterized our region over the centuries, we Caribbeans have mtDNAs that have maintained their original identity and that can be identified as African, Indian, or Caucasian . Their identity depends upon the women in our genetic tree at the end of the strictly maternal ancestral line. If this great-great-great grandmother were indigenous, then the corresponding Caribbean would have an indigenous mtDNA. He or she would have inherited it intact from that great-great-great grandmother who lived through those terrible first years of the colonization by means of his or her great-great grandmothers, great grandmothers, and maternal grandmother.
Dr. Winters how does this help you? Other than the dubious use of the word "caucasian" the highlighted passage above says that a group of people, who we know may look very similar, continue to carry the mtdna of their maternal ancestry - from different parts of the world. This seriously undermines your position regarding race.
Posts: 1038 | From: Franklin Park, NJ | Registered: Aug 2005
| IP: Logged |
You can't distinguish "races" from one another by allelic frequencies for any gene. ^Read the article you posted^
Another exemple, the ABO blood groups.
As long homo sapiens exchanges (by sex) genes within self and can't do with other groups, then you will always have homo sapiens
Posts: 2198 | Registered: Jun 2006
| IP: Logged |
posted
A journalist writing about the work of the geneticists used the word race. So far no quotes from any of the scientists has been posted showing that they themselves propound the social concept of race as a concept with valid application in population genetics.
Until such quotes manifest please refrain from repeating the innacurate, erroneous, misstatement that:
quote: ... geneticists at the 13 research institutes [] found races can be determined biologically
Posts: 8014 | From: the Tekrur in the Western Sahel | Registered: Feb 2006
| IP: Logged |
UBBFriend: Email this page to someone!
![[Roll Eyes]](rolleyes.gif)
![[Embarrassed]](redface.gif)
You of course failed to answer any of Rasol's questions because you cannot. Biological 'race' does not exist plain and simple!
![[Big Grin]](biggrin.gif)
![[Wink]](wink.gif)
Printer-friendly view of this topic